Chem. Res. Toxicol. 1991, 4,21-26
21
(+)-CC-1065 Produces Bending of DNA That Appears To Resemble Adeninenhymine Tracts Introduction Sir: (+)-CC-1065 is a potent antitumor antibiotic produced by Streptomyces zelensis (1). Although (+)-CC-1065 was found t o produce delayed death in mice (2),subsequent analogues have been designed and synthesized that not only have improved antitumor efficacy but also lack this toxicity (3). One such compound was recently introduced into phase I clinical trials (4). Collaborative studies between the University of Texas and Upjohn have resulted in a series of contributions that have (1) determined the covalent reaction between (+)-CC-1065 and DNA that leads to the (+)-CC-1065-DNA adduct (Scheme I) (5),(2) determined the sequence specificity of (+)-CC-1065 (6), and (3) partially defined the effect of covalent modification of DNA structure (7). Biochemical and biological consequences, such as repair recognition (8) and genotoxicity (9), have also been described. Reviews on the mechanism of action (IO)and biological effects (11) have been published. Facilitated by the extensive array of analogues synthesized by Upjohn scientists (12),structure-activity relationships have been sharply defined (Figure 1). Of particular significance is our observation that the A subunit of (+)-CC-1065 has sufficient structural information to elicit the sequence specificity of the entire drug molecule, although the nature of B and C subunits can modulate or fine tune this specificity (Figure 1) (6b). In previous publications (6b,c, 10b) we have argued that the primary basis for the sequence selectivity of (+)-CC-1065 is a sequence-dependent catalytic actiuation and/or a sequence-dependent conformational flexibility. In contrast t o this result, we have recently demonstrated that the sequence selectivity of (-)-CC-1065, the synthetic enantiomer, is largely determined by noncovalent binding interactions. Adeninelthymine tracts (A-tracts) in DNA have been demonstrated by gel electrophoresis (13),electron microscopy (14),X-ray diffraction (15),and hydroxyl-radical footprinting (16) to produce bends in DNA. The precise structural basis for the A-tract-associated bend in DNA is still controversial (13,but the junction bend model (13) seems t o be the most probable. Both high-field 'H NMR (19) and hydroxyl-radical footprinting (20) results are consistent with narrowing of the minor groove due to a high propeller twist angle in a n A.T base pair at the junction site as a structural basis for this effect. In this communication we demonstrate, using hydroxyl-radical footprinting and high-field proton NMR, t h a t the bend in DNA, which is entrapped or induced by (+)-CC-1065, appears t o resemble in overall respects a naturally occurring A-tract bend. The possible relationship of this bend t o sequence selectivity and biological consequences of such a feature associated with a potent DNA-reactive drug are discussed.
Materials and Methods (A) Materials. (+)-CC-1065was obtained from the Upjohn
Co., and the oligodeoxynucleotideswere prepared on an Applied Biosystem automated DNA synthesizer (Model 381A). Reagents used to prepare NMR buffer, sodium phosphate (99.99%) and sodium chloride (99.99%),were purchased from Aldrich Co.; HPLC water was purchased from Baxter Scientific Co.; hydroxylapatite used to purify 12-mer duplex and the (+)-CC1065-12-mer adduct was purchased from CalBiochem Co.; and Sephadex G-25 (superfine) was purchased from Pharmacia Co. (B) Methods. (1) DNA Bending Experiments. Both of the complementary oligonucleotides (21 bp) were labeled with [ y 32P]ATP(Amersham) by T4polynucleotide kinase and hybridized together, and the resulting duplex DNA was gel-purified by 12%
nondenaturing polyacrylamide gel electrophoresis. Duplexed at room oligonucleotideswere modified with 28 pM (+)-CC-1065 temperature for 3 days, followed by ethanol precipitation to remove unbound drug molecules. Drug-modified and nonmodified duplexes were self-ligated to produce multimers, which were electrophoresed on 8% polyacrylamide gel and then located by autoradiography. (2) Hydroxyl-Radical Footprinting. Individual strands of by using T4 polythe 21-mer were labeled with [T-~~P]ATP nucleotide kinase and hybridized to an excess of unlabeled complementary strand, and the resulting duplex DNA was gel-purified by 12% nondenaturing polyacrylamide gel electrophoresis. The 3' end labeling was accomplished by using the appropriate [a3T]dNTPand the Klenow fragment of DNA polymerase 1(BRL). Hydroxyl-radicalcleavage of the drug-modified and nonmodified 21-mer was carried out at room temperature for 5 min with the same reagent as published (20), except for changes in the concentrations of hydrogen peroxide (1.5%). The reaction was stopped by the addition of thiourea and 3 M sodium acetate to a final concentration of 0.3 M. The DNA was precipitated by the addition of 2 volumes of ethanol. The samples were dried, redissolved in formamideldye mixture, and loaded directly onto a 20% sequencing gel. (3) Preparation and Purification of 12-mer Duplex for NMR Studies. The non-self-complementaryd(GGCGGAGTTAGG).(CCTAACTCCGCC) dodecanucleotide for NMR was synthesized in house on a 10-pmolscale by using the phosphoramidite approach on an automated DNA synthesizer. The oligomers were then deprotected separately with saturated ammonium hydroxide at 55 "C overnight. Solvent was evaporated at room temperature. The synthesized dodecamers were purified separately on a Machery-Nagel Nuclogen-DEAE 60-7 HPLC column with an increasing gradient from 15 mM sodium phosphate to 1M sodium chloride and 15 mM sodium phosphate in 20% acetonitrilelwater (pH 6.8). The purified single-stranded dodecamers were then desalted on four '*C Sep-Pak cartridges (Waters). Solvent was evaporated at room temperature. Equal amounts of salt-free single-stranded 12-merwere annealed by heating up to 65 "C for 2 h and then allowed to cool down to room temperature slowly in 1.0 mL of NMR buffer (10 mM sodium phosphate, 100 mM sodium chloride, pH 6.85). This 12-mer duplex solution was then allowed to cool down to 4 "C overnight. The crude 12-mer duplex was applied to a hydroxylapatite column (25 cm X 3.0 cm) and eluted with a gradient from 10 to 200 mM sodium phosphate buffer (pH 6.85) at room temperature to remove the free single-stranded material. The 12-mer duplex (25 mg) was then lyophilized, redissolved in 3-5 mL of HPLC water, and desalted on a superfine Sephadex G-25 column (50 cm X 3 cm) eluted with HPLC water. The desalted pure 12-mer duplex was lyophilized and redissolved in 0.5 mL of NMR buffer. The sample was lyophilized to dryness, redissolved in 0.5 mL of 99.996% DzO, and then transferred into a 5-mm ultrathin NMR tube for NMR studies. (4) Preparation and Purification of (+)-CC-1065-12-mer Duplex Adduct. 12-merduplex adduct was prepared by adding 6 mg of (+)-CC-1065 in 0.2 mL of DMF solution to 20 mg of purified 12-mer duplex in 0.5 mL of NMR buffer (10 mM sodium phosphate, 100 mM sodium chloride, pH 6.85). The reaction mixture was allowed to stir and reacted at room temperature for 5 days. The reaction mixture was lyophilized to dryness and redissolved in 1.0 mL of HPLC water. This solution was then desalted on four 18C Sep-Pak cartridges. The desalted 12-mer adduct was lyophilized, redissolved in 1.0 mL of HPLC water, applied to hydroxylapatite column (25 cm X 3 cm), and eluted with a gradient from 10 to 150 mM sodium phosphate buffer (pH 6.85) at room temperature to remove the free drug and other impurities. Following desalting as described for the duplex, the pure adduct solution was lyophilized, redissolved in 0.5 mL of NMR buffer, lyophilized, and redissolved in 99.996% DzO. This yellowish adduct solution was then transferred into a 5-mm ultrathin NMR tube for 'H NMR studies. (5) NMR Experiments. One- and two-dimensional proton NMR data sets were recorded on a General Electric GN-500 FT
0893-228~/91/2704-0021$02.50/0 0 1991 American Chemical Society
22 Chem. Res. Toxicol., Vol. 4, No. 1, 1991
Communications
Scheme I. Reaction of (+)-CC-1065 with N3 of Adenine in DNA and Products from Thermal Cleavage Reaction"
H+ (+)-CC-1065
(+)-CC-1065-DNA ADDUCT
a Species A is the products produced by thermal treatment, and species B is the products produced by thermal and subsequent piperidine treatment. The exact nature of the species generated on the 5' side of the strand break is unknown @a).
NMR spectrometer a t room temperature. Two-dimensional phase-sensitive NOESY experiments were recorded at six different mixing times: 60,90,120,250,400,and 500 ms at 23 "C. Chemical shifts were referenced relative to external TSP in D20 for 'H resonances, and 85% H3P04 in D20 for 31Presonances. Approximately 20 mg of the (+)-CC-1065-12-mer adduct in 0.5 mL of 10 mM NaH2P04and 100 mM NaCl, pH 6.85, buffer was used for 'H NMR experiments.
Results (A) Determination of the Directionality of the DNA Bend Produced by (+)-CC-1065. We have recently shown (21), by a gel electrophoresis assay, that (+)-CC1065 produces a bend in DNA of about 17-22', which compares well to that produced by a n A6-tract (22). A comparison of the bending of DNA produced by the "A", "AB", and "ABC" subunits (Scheme I) with (+)-CC-1065 showed that, like the sequence specificity, the A subunit -Modulation of Sequence Specificity -DNA Winding -Inhibition of LigaselEndonuclease -Delayed Death
/
\
-Increase Rate of Alkylation -Increase Cytotoxic Potency
-Antitumo; Activity -Sequence Speciiicity -DNA Bending -UVRABC Nuclease Recognition and Incision Figure 1. Structural and biological consequences of covalent
modification of DNA attributable to different portions of the drug molecule (3, 6b,c, 7u, lob, 21).
Chart I. Twenty-one Base Pair Sequences Used in the DNA Bending Experiments 21-A: 21-8: 21-C:
J'GAGGACCATGATTACGGATTCS' 3'CTGGTACTAATGCCTAAGCTC5' 5IAAAAACCATGATTACGGATTC3' 3ITTGGTACTAATGCCTAAGTTT5' SGAGGACCGGAAAAACGGATTCY 3'CTGGCCTTTTTGCCTAAGCTC5'
has sufficient structural information to account for the entire amount of DNA bending produced by (+)-ABC. Although the B and C subunits actually reduced the apparent DNA bending produced by the A subunit by a small amount, the presence of the bulky (+)-CC-1065-DNA adduct does not significantly affect the mobility of ligated multimers and thus the bending magnitude calculated (21). Three different 21 base pair sequences (Chart I) were designed to determine whether the (+)-CC-1065 molecule bending direction is into the minor or major groove of DNA (sequence 21-B), and whether modification of an A-tract at the 3' end by (+)-CC-1065 would increase or decrease the intrinsic bending of DNA associated with an A-tract (sequence 21-C). When oligomers containing in-phase bends (i.e., on the same side of the helix) are ligated into multimers, the resulting ligation products have an overall curve, eventually, if long enough, forming circles. This slows the rate of gel migration of the multimers under nondenaturing conditions, the extent of retardation being related to the amount of bending occurring, in this case, in the vicinity of the drug modification site. The gel results are shown in Figure 2A, and a plot of RL (apparent vs actual length) vs multimer number is shown in Figure 2B. Sequence 21-A contains a unique (+)-CC-1065bonding site in the highly reactive sequence 5'GATTA* (A* is the covalent modification site). Drug modification of this oligomer followed by ligation results in retardation of its gel electrophoretic mobility consistent with (+)-CC-1065-induced bending of DNA (compare lanes 1 and 2 in Figure 2A). For sequence 21-B, which contains a separate A-tract in phase with a (+)-CC-1065 bonding site, retardation of gel migrations of ligated multimers under nondenaturing condition in the absence of drug is significantly less than
Chem. Res. ToxicoZ., VoZ. 4, No. 1, 1991 23
Communications A
T
2 1 - A ~ 21-BBP 21-C BP n C D C D DnC
A
C
i i i ll
5 ’ T G G G C G G A G T T A G G G G C G G G A 3 ‘
I
3 ’ C G C C T C A A T C C C C G C C C T A C C S ’
+4?+4 .
.
e
.
.
Figure 3. Comparison of the laser densitometer tracings of
1
B
2
3
4
5
hydroxyl-radical footprinting of the duplex d(5’TGGGCGGAGTTA*GGGGCGGGA3’)*(5’CCATCCCGCCCCTAACTCCGC3’) and its (+)-CC-1065-duplex adduct. (A) Hydroxyl-radical cleavage pattern of the duplex. (B) Hydroxyl-radical cleavage pattern of (+)-CC-l0654uplex adduct. In (B) the hydroxyl-radical cleavage of the covalently modified adenine in the sequenceAGTTA is omitted because of background thermal strand breakage, which leads to relatively significant cleavage at this p~sition.~ (C) Summary of inhibition (dashed-line arrows) or enhancement (solid-linearrows) of hydroxyl-radical cleavage in the (+)-CC-1065-modified21 duplex adduct.
6
1.8
1.6
overall bending induced by (+)-CC-1065 in the A5-tract is similar in magnitude to that produced in the sequence 5’GATTA” (see Figure 2). This result is consistent with the notion that A-tracts have enough flexibility to accommodate a (+)-CC-1065 bending motif without a large additive bending effect.
-m Q)
=I
> a
1.4
1.2
1.o
0
2
4
6
8
10
Multiplicity of Oligomer
Figure 2. (A) Autoradiogram of ligation products 21-A, 21-B, and 21-C bp oligomers modified with (+)-CC-1065 on an 8%
nondenaturing polyacrylamide gel. Lanes 1,3, and 5 are ligation products of control 21-A bp, 21-B bp, and 21-C bp oligomers, respectively. Lanes 2,4, and 6 are ligation products of 21-A, 21-B, and 21-C bp oligomers modified with 28 pM (+)-CC-1065. The ligation products were prepared as described under Materials and Methods. (B) Plot of RL values vs the multimer size for the ligation products of the 21-A, 21-B, and 21-C bp oligomers, with or without (+)-CC-1065 modification shown in panel A. 0 , 0 , 0 , H, A, and A, correspond to lanes 1-6, respectively, in panel A. that after drug modification (lanes 3 and 4 in Figure 2A). The additional retardation in gel electrophoretic mobility and higher RLs in ligated multimers of the (+)-CC-1065modified oligomer (Figure 2B) over those of the nondrug-modified 21-mer containing a separate A-tract proves that the phased A-tract and (+)-CC-1065 both bend DNA in the same direction (i.e., into the minor groove of DNA). The covalent modification of the 3’ end of an A,-tract by (+)-CC-1065 slightly increases the overall bending compared to that intrinsically associated with the A,-tract (compare lanes 5 and 6 in Figure 2A).l However, the
(B) Hydroxyl-Radical Footprinting of the (+)-CC1065-DNA Adduct. A-tracts have been demonstrated to produce an undulation in the intensity of hydroxyl-radical cleavage of the backbone of DNA consistent with a compression of the minor groove a t the 3’ end of the tract (18). The results of hydroxyl-radical footprinting of the (+)CC-1065-DNA adduct in a 21-mer sequence show a pattern of inhibition of cleavage across the minor groove to the 5‘ side of the covalent adduct site on both strands of DNA (see Figure 3B,C). This result suggests that the narrowing of the minor groove occurs between the two thymines within the (+)-CC-1065 bonding region and is consistent with a bending locus in this vicinity.2 We have independently determined that the locus of (+)-CC1065-induced bending is between these thymines in an experiment in which A-tracts were positioned 12 and 13 base pairs from the alkylated adenine (21). In addition Using the thermal cleavage assay, we have shown that the predominant site of covalent bonding by (+)-CC-1065is at the 3’ end of the A-tract. We can exclude the trivial explanation that the inhibition of hydroxyl-radical cleavage is due to a (+)-CC-1065 footprint on two counts: (1) the hydroxyl-radical inhibition pattern does not correspond to the (+)-CC-1065 footprint, and (2) the (+)-CC-1065-truncated analogue (+)-AB produces precisely the same cleavage pattern at the parent compound. Because the hydroxyl-radicalcleavage is carried out to
