Î³ Dual Covalent Modifier and Agonist - ACS

Subscriber access provided by - Access paid by the | UCSB Libraries

Article

17-OxoDHA is a PPARa/g dual covalent modifier and agonist Daichi Egawa, Toshimasa Itoh, Yui Akiyama, Tomoko Saito, and Keiko Yamamoto ACS Chem. Biol., Just Accepted Manuscript • DOI: 10.1021/acschembio.6b00338 • Publication Date (Web): 23 Jun 2016 Downloaded from http://pubs.acs.org on June 28, 2016

Just Accepted “Just Accepted” manuscripts have been peer-reviewed and accepted for publication. They are posted online prior to technical editing, formatting for publication and author proofing. The American Chemical Society provides “Just Accepted” as a free service to the research community to expedite the dissemination of scientific material as soon as possible after acceptance. “Just Accepted” manuscripts appear in full in PDF format accompanied by an HTML abstract. “Just Accepted” manuscripts have been fully peer reviewed, but should not be considered the official version of record. They are accessible to all readers and citable by the Digital Object Identifier (DOI®). “Just Accepted” is an optional service offered to authors. Therefore, the “Just Accepted” Web site may not include all articles that will be published in the journal. After a manuscript is technically edited and formatted, it will be removed from the “Just Accepted” Web site and published as an ASAP article. Note that technical editing may introduce minor changes to the manuscript text and/or graphics which could affect content, and all legal disclaimers and ethical guidelines that apply to the journal pertain. ACS cannot be held responsible for errors or consequences arising from the use of information contained in these “Just Accepted” manuscripts.

ACS Chemical Biology is published by the American Chemical Society. 1155 Sixteenth Street N.W., Washington, DC 20036 Published by American Chemical Society. Copyright © American Chemical Society. However, no copyright claim is made to original U.S. Government works, or works produced by employees of any Commonwealth realm Crown government in the course of their duties.

Page 1 of 44

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

ACS Chemical Biology

17-OxoDHA is a PPARα α/γγ dual covalent modifier and agonist

Daichi Egawa, Toshimasa Itoh, Yui Akiyama, Tomoko Saito, Keiko Yamamoto*

Laboratory of Drug Design and Medicinal Chemistry, Showa Pharmaceutical University, 3-3165 Higashi-Tamagawagakuen, Machida, Tokyo 194-8543, Japan

*Corresponding author Keiko Yamamoto: [email protected]; Tel, +81 42 721 1580; Fax, +81 42 721 1580

1

ACS Paragon Plus Environment


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Abstract 17-Hydroxy docosahexaenoic acid (17-HDHA) is an oxidized form of docosahexaenoic acid (DHA) and known as a specialized proresolving mediator. We found that further oxidized product, 17-oxodocosahexaenoic acid (17-oxoDHA), activates peroxisome proliferator-activated receptors γ (PPARγ) and PPARα in transcriptional assays and thus can be classified as an α/γ dual agonist. ESI mass spectroscopy and X-ray crystallographic analysis showed that 17-oxoDHA binds to PPARγ and PPARα covalently, making 17-oxoDHA the first of a novel class of PPAR agonist, the PPARα/γ dual covalent agonist. Furthermore, the covalent binding sites were identified as Cys285 for PPARγ and Cys275 for PPARα.

2


Page 2 of 44

Page 3 of 44

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Introduction PPARα and PPARγ are believed to play an important role as lipid sensors and are thus targets for drugs to treat diseases such as dyslipidemia (fibrates) and diabetes (thiazolidinediones, TZD).1,2 The development of PPARα and PPARγ dual agonists is one strategy for the treatment of metabolic syndrome.3,4 Although development of fibrates occurred far earlier (in the 1930s) than that of TZDs (in the 1990s), the study of drugs targeting PPARα seems to have fallen behind that of PPARγ. For example, more than 10 X-ray crystal structures of PPARγ-ligand binding domain (PPARγ-LBD)/fatty acids have been reported, but only structures for PPARα-LBD complexed with a synthetic ligand have been reported.5–17 Protein can be covalently modified with fatty acids possessing an electrophilic functional group18

such

as

4-oxo-docosahexaenoic

acid

(4-oxoDHA)19

nitro-fatty

acids20,

or

4-hydroxynonenal. We previously investigated the structure–reactivity relationship for conjugate addition reactions, targeting PPARγ and demonstrated that the position of the dienone in the oxo-fatty acid correlates to the reactivity.21 We focused here on 17-oxo-docosahexaenoic acid (17-oxoDHA) instead of 4-oxoDHA because 17-oxoDHA has an anti-inflammatory activity in vitro22,23 and it is reported that 3



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

17-oxoDHA is an agonist of PPARγ24. 17(S)-Hydroxy docosahexaenoic acid (17(S)-HDHA) is the precursor of 17-oxoDHA and is a specialized proresolving mediator (SPM).25–27 From these interests, we investigated the interactions between 17-oxoDHA and PPARs and here report that 17-oxoDHA represents a novel class of PPARα/γ dual agonist that functions as dual covalent modifier.

Results and Discussion Cell-based assay We first examined the transcriptional activity of PPARγ, PPARα and PPARδ using a dual luciferase reporter assay kit for 17-oxoDHA and a SPM, 17(S)-HDHA (Figure 1). Figure 2a shows the fold activation of PPARγ, PPARα, and PPARδ at 3 µM. 17(S)-HDHA slightly activated PPARγ, PPARα and PPARδ, whereas 17-oxoDHA significantly activated PPARγ and PPARα but did not activate PPARδ. We compared the concentration dependence of PPARγ and PPARα activation using pioglitazone and WY14643 as positive controls (Figure 1). PPARγ was activated by 17-oxoDHA as well as 4-oxoDHA, whereas 4-oxoDHA did not activate PPARα at all (Figure 2b, cd), 4


Page 4 of 44

Page 5 of 44

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


indicating that 4-oxoDHA is a selective PPARγ agonist and 17-oxoDHA is an α/γ dual agonist in our transcriptional assay. To confirm whether 17-oxoDHA is a partial agonist of PPARγ, we tested the competitive transcriptional activity of 17-oxoDHA against pioglitazone (10 µM) activation of PPARγ and found that 17-oxoDHA inhibited pioglitazone activity in a concentration dependent manner (Figure 2c). This result indicates that 17-oxoDHA acts as a partial agonist of PPARγ. Moreover, we compared the activities of the polyunsaturated oxo-fatty acids 4-oxoDHA, 9-oxo-octadecadienoic acid (9-oxoODE), 13-oxo-octadecadienoic acid (13-oxoODE), and 17-oxoDHA. It seems that the activity is related to the oxidized position (Figure 2e). Consequently, the position of the carbonyl is important for PPARα activation, and the position is more sensitive than for PPARγ activation because PPARγ is activated by various oxo-fatty acids.21 It should be noted that although many synthetic dual agonists (glitazars) have been designed, no effective “fatty acid dual agonist” has been reported. Electrospray-ionization (ESI) mass spectrometry We suggested previously that Cys285 of PPARγ can form a covalent bond with several oxo-fatty acids. On the other hand, no oxo-fatty acids forming a covalent bond with PPARα have 5



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

been reported. PPARα and PPARγ contain a conserved cysteine residue (Cys276 and Cys285, respectively). We therefore used ESI mass spectroscopy to examine if 17-oxoDHA covalently binds to PPARγ and/or PPARα. PPARα-LBD or PPARγ-LBD in ammonium acetate buffer was incubated with four equivalents of 4-oxoDHA or 17-oxoDHA at room temperature for 20 min, and then we collected ESI mass spectra. It is important to analyze the denatured protein to detect the covalent modification by oxo-fatty acids, so we set the desolvation temperature to over 200°C. Figure 3 shows the ESI mass spectra of PPARγ-LBD and PPARα-LBD in the absence and presence of oxo-DHA. In the absence of oxo-fatty acids, the PPARγ-LBD peak showed a 31,410 Da product corresponding to the molecular weight (MW) of PPARγ-LBD (Figure 3a). In the presence of 4-oxoDHA, PPARγ-LBD produced a product peak at 31,753 Da, an increase in MW corresponding to 4-oxoDHA (342 Da) and identical to our previous report.21 17-oxoDHA produced a product peak for which the mass was increased by the MW of 17-oxoDHA (342 Da) and one or two NH4+ ions derived from the ammonium acetate buffer. These results suggest that 17-oxoDHA as well as 4-oxoDHA covalently bind to PPARγ.

6


Page 6 of 44

Page 7 of 44

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


In the case of PPARα-LBD, only trace amounts of 4-oxoDHA covalently bound to PPARα, whereas essentially all of the 17-oxoDHA covalently bound to PPARα within 20 min (Figure 3b). Numerous PPARα agonists, such as fibrates and glitazones, have been synthesized, but no “covalent PPARα fatty acid agonist” has been reported. 17-OxoDHA is the first identified PPARα/γ “dual covalent agonist”. Point mutagenesis study PPARγ-LBD has only one cysteine residue, Cys285, which covalently binds to oxo-fatty acids. PPARα-LBD contains seven cysteine residues; Cys275 and Cys276 are adjacent and line the ligand-binding cavity, and Cys276 corresponds to Cys285 in PPARγ. The covalent binding site in PPARα was identified by ESI mass spectrometry using two serine mutants, C275S and C276S. Figure 4 shows the time course of covalent bond formation between 17-oxoDHA and the wild type (WT) or each mutant of PPARα. The peaks of PPARα/17-oxoDHA adduct (30,672 Da) increased time-dependently from the apo form of WT PPARα (30,328 Da; Figure 4a). The reaction was almost completed within 20 min. Similar results were obtained with the C276S mutant (Figure 4b), whereas the reaction was much slower with the C275S mutant and was not complete after 60 min (Figure 4c). Figure 4d shows the 7



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 8 of 44

covalent-bond formation ratio by peak area. This indicates that progression of the reaction was not affected by C276S mutagenesis, but in the C275S mutant, progression of the reaction was clearly suppressed. Therefore, the dominant binding site is Cys275 and not Cys276. X-ray crystallographic analysis Prior to conducting the point mutagenesis study described above, we hypothesized that the binding site is Cys276 because this residue corresponds to Cys285 of PPARγ, which is responsible for the covalent binding of oxo-fatty acids. To understand the binding mode, we attempted to solve the crystal structures of PPARα-LBD in addition to PPARγ-LBD. In contrast to PPARγ-LBD, there is no well-established crystallization method for PPARα-LBD.

First, we examined crystallization of the

PPARα-LBD/17-oxoDHA complex using reported conditions but were unsuccessful. It seems that the polyunsaturated fatty acid is unstable under the crystallization conditions used. After detailed

investigations,

we

obtained

crystals

of

a

ternary

complex,

PPARα-LBD/17-oxoDHA/steroid receptor coactivator 1 (SRC1) peptide. The data collection statistics and refinement of the crystal structure are summarized in Table 1. PPARγγ 8


Page 9 of 44

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


As expected 17-oxoDHA covalently binds to Cys285 in PPARγ (Figure 5a, b). Figure 5b shows continuous the electron density (mesh) from the sulfur atom to the beta carbon of 17-oxoDHA. The orientation of the head carboxylate is opposite that of other covalent binding oxo-fatty acids (4-oxoDHA etc.)19 and the carboxylate interacts with the back bone amide group of Glu343 on β-strand 3−4. The tail part of 17-oxoDHA interacts closely with the aromatic ring of Tyr473. Instead of a canonical hydrogen bond interaction, this hydrophobic interaction may guide helix 12 to the active position, resulting in PPARγ showing transcriptional activity (Figure 2). Another possibility is that the bound 17-oxoDHA is wrapped around helix 3. It has been reported that some partial agonist activity results from stabilization of helix 3 or the β-sheet, but not from direct interaction with helix 12. 17-OxoDHA may activate PPARγ by a mechanism similar to those of partial agonists.28 PPARα α As expected, the crystal structure showed that 17-oxoDHA covalently binds to Cys275 in PPARα. Figure 5d shows the continuous electron density from Cys275, but not Cys276, to 17-oxoDHA. The head carboxylate forms a hydrogen bond with Tyr464 on helix 12, which is the canonical binding mode for PPAR activation. The conjugated double bond of 17-oxoDHA is 9



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 10 of 44

distant from the carboxylate. Binding with Cys275, farther from helix 12, locates the carboxylate in exactly the right position and without strain. WY14643 and 17-oxoDHA activated the C276S mutant. In the case of the C275S mutant, WY14643 also activated the C275S mutant, whereas 17-oxoDHA had a moderate activation effect (Figure 6). Thus, the activation of PPARα by 17-oxoDHA might be based on C275-17-oxoDHA covalent binding.

Conclusion Although 17-oxoDHA is a biosynthetic oxo-fatty acid that has an anti-inflammatory activity, it has received minimal research attention. In this study, we showed that 17-oxoDHA is a dual agonist and a covalent modifier of both PPARα and γ. ESI mass spectrometry showed that Cys275 of PPARα is responsible for covalent binding. This is different from the Cys285 binding site of PPARγ. To confirm the binding site, we solved the crystal structures of both PPARγ-LBD and PPARα-LBD complexed with 17-oxoDHA, in which 17-oxoDHA is accommodated in the opposite orientation in the ligand-binding pocket. The results of transactivation can be explained by the crystal structures. It should be noted that this is the first report of the crystal structure of PPARα/fatty acid complex, in addition to PPARα/covalent modifier complex. This report is not 10


Page 11 of 44

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


only informative for drug design targeting metabolic syndrome or design of covalent modifier for other target proteins, but also useful for understanding various subjects, such as fatty acid metabolites, nutrition and energy homeostasis.

Methods Materials. 17-oxoDHA, 17(S)-HDHA and 4-oxoDHA were prepared in our laboratory.29,30 All other substrates and reagents were purchased from commercial sources and were used without further purification. Microwave-Assisted Solid-Phase Peptide Synthesis. To a 5 mL bottom-filtration reaction tube was transferred 100.5 µmol (145.6 mg, loading 0.69 mmol g-1) of Fmoc-Rink amide AM resin (200–400 mesh, Nova Biochem), which was swollen in 2 mL of DCM for 30 min at RT. After the resin were washed with DMF (5 × 2 mL), 2 mL of 20% piperidine in DMF was added to the resin. The reaction tube was shaken for 10 min at 70 °C under microwave irradiation and washed with DMF (5 × 2 mL). Fmoc-amino acid (3 equiv.), coupling

cocktail

(HBTU

(2-(1H-benzotriazol-1-yl)-1,1,3,3-tetramethyluronium

hexafluorophosphate) (113 mg, 298 µmol) and HOBt (1-hydroxybenzotriazole) (54.7 mg, 357 11



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 12 of 44

µmol) in DMF 700 µL) and DIEA (N,N-diisopropylethylamine) (113.2 µL, 650 nmol) dissolved in 586.8 µL NMP were added to the resin. For Fmoc-Arginine and Fmoc-lysine coupling reaction, COMU

((1-Cyano-2-ethoxy-2-oxoethylidenaminooxy)dimethylaminomorpholinocarbenium

hexafluorophosphate) (140 mg 350 µmol) in DMF 700 µL ) and DIEA (122 µL, 700 nmol) dissolved in 578 µL NMP was used as a coupling cocktail. The reaction mixture was shaken for 10 min at 70 °C under microwave irradiation, and the resin was washed with DMF (5 × 2 mL). When using Fmoc-E, Fmoc-K and Fmoc-H for the coupling reaction, the reaction time was 20 min and using Fmoc-R, the reaction time was 60 min. For deprotection, the resulting resin in 2 mL of 20% piperidine in DMF and shaken for 3 min at 70°C under microwave irradiation and washed

with

DMF

(5

×

2

mL).

After

peptide

elongation,

SRC1-2

peptide

(H-Leu-Thr-Glu-Arg-His-Lys-Ile-Leu-His-Arg-Leu-Leu-Gln-Glu-Gly-CONH2) was cleaved from the solid support with a cleavage cocktail (1.5 mL) of TFA/triisopropylsilane/water (95:2.5:2.5 v/v) at RT for 1.5 h. After collecting the flow-through, 1.5 mL TFA was added to the resin and collected three times. The SRC1-2 peptide in the collected TFA solution was precipitated with 40 mL ice-cold diethyl ether and the peptide was collected by centrifuge. The peptide precipitation was dried under reduced pressure. The crude product (183 mg) were purified by column 12


Page 13 of 44

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


chromatography on a Biotage IsoleraTM Flash Purification System (a linear gradient (0 to 100%) of H2O/acetonitrile containing 0.01% trifluoroacetic acid, 12 mL min-1, silica cartridge (Purif-Pack ODS-30, Shoko Scientific)) to afford SRC1-2 peptide (155 mg, 84%). The SRC1-2 peptide was characterized by a JMS-T100LP AccuTOF LC-Plus (JEOL) in electrospray positive mode. HRMS (ESI-TOF) m/z calcd for C81H142N28O21 ([M+2H]2+): 1843.08549, found: 1843.09043. Plasmid Construction and Point Mutagenesis Study. hPPARα-LBD

was

amplified

(pCMX-GAL-hPPARα)

from

the

plasmid

using

contain

a

hPPARα-LBD sense

sequence primer

5’-GACGACGACAAGATGGGTGAAAACCTGTACTTCCAGGGTGCAGATCTCAAATCTCT GGCCAAGAGAATCTACGAGGCC-3’

and

an

antisense

primer

5’-GAGGAGAAGCCCGGTTTAGTACATGTCCCTGTAGATCTCCTGCAGTAGCGGGTGC-3 ’ and cloned into pET-41 Ek/LIC vector by using the the pET-41 Ek/LIC Vector Kit (Novagen). hPPARα-LBD mutants (C275S and C276S) were generated using Pfu TurboTM DNA polymerase (Agilent Technologies). The C275S and C276S mutant plasmids were transformed into E. coli DH5α cells and plasmids were purified using a QIAprep spin miniprep kit (Qiagen). The 13



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 14 of 44

sequence of the C275S and C276S mutagenic primers (forward direction only) are 5’-CCGCATCTTTCACAGCTGCCAGTGCACG-3’

and

5’-CATCTTTCACTGCAGCCAGTGCACGTCAGT-3’, respectively. The plasmids (wild type, C275S and C276S) were confirmed by di-deoxy sequencing. Transfection and Transactivation assay. COS-7 cells were cultured in Dulbecco’s modified Eagle’s medium (DMEM) supplemented with 5% fetal bovine serum (FBS). Cells were seeded on 24-well plates at a density of 2 × 104 per well. After 24 h, a mixture containing 0.18 µg of a reporter plasmid (MH100 × 4-TK-Luc)31, 0.05

µg

of

a

GAL4-hPPAR

chimera

expression

plasmid

(pCMX-GAL-hPPARα, pSG5-GAL-hPPARγ or pCMX-GAL-hPPARδ)32, 0.02 µg of the internal control plasmid containing sea pansy luciferase expression constructs (pRL-CMV), and 0.75 µL of the Trans IT-LT1 reagent (Mirus) were added to each well.33 The MH100 × 4-TK-Luc reporter plasmid contains four copies of the MH100 GAL4 binding site. After 8 h incubation, the cells were treated with either the ligand or ethanol vehicle and were cultured for 16 h. Cells in each well were harvested with a cell lysis buffer, and their luciferase activity was measured using a

14


Page 15 of 44

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


luciferase assay kit (Promega). Transactivation that was measured as luciferase activity was normalized with the internal control. All experiments were performed in triplicate. Protein Expression and Purification. The human PPARα-ligand binding domain The human PPARα-ligand binding domain (LBD) (aa 201–468) was expressed using a pET-41-Ek/LIC vector with an N-terminal 6×His tag and a GST tag cleavable by TEV protease. E. coli Rosetta (DE3) was freshly transformed with the plasmid and grown in five flasks containing 1 L of 2×TY medium with kanamycin 34 µg mL-1 and chloramphenicol 50 µg mL-1 at 37°C to an OD

at

600

nm

of

1.0.

Protein

synthesis

was

then

induced

with

0.5

mM

isopropyl-β-D-thiogalactopyranoside and the cultures were further incubated at 20°C for 16 h. Cells were harvested and resuspended in 80 mL lysis buffer (20 mM Tris-HCl pH 8.0, 100 mM NaCl, 1 mM TCEP, 1 mM EDTA, 1 × Protease inhibitor cocktail (Nacalai Tesque)). Cells were lysed by sonication, and the soluble fraction was isolated by centrifugation (18,000 × g for 20 min). The supernatant was applied to cOmplete His-Tag Purification Resin (Roche Diagnostics GmbH) and the resin was thoroughly washed in wash buffer (20 mM Tris-HCl pH 8.0, 100 mM NaCl, 1 mM TCEP, 1 mM EDTA). The human PPARα-LBD was eluted with elution buffer (20 15



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 16 of 44

mM Tris-HCl pH 8.0, 100 mM NaCl, 1 mM TCEP, 1 mM EDTA, 250 mM imidazole). The protein solution was dialyzed overnight at 4°C, dialysis with 500 mL of buffer A (20 mM Tris-HCl pH 8.0, 10% glycerol, 1 mM TCEP), and then loaded onto a HisTrapTM HP (1 mL) column (GE Healthcare) equilibrated with buffer A. The elution was performed by imidazole gradient buffer from 0 to 250 mM. TEV protease was added to the protein solution and incubated overnight at RT. Dithiothreitol was added to a final concentration of 10 mM to the cleaved protein, and then the mixture was passed through Glutathione SepharoseTM 4B (GE Healthcare). The flow-through was concentrated and loaded onto a Superdex 75 (24 mL) gel-filtration column (GE Healthcare) equilibrated with buffer A. The purified protein was concentrated in buffer (20 mM HEPES pH 8.0, 150 mM NaCl, 5% glycerol, 1 mM TCEP) to a concentration of 8 mg mL-1. The human PPARγ-ligand binding domain The human PPARγ-ligand binding domain (LBD) (aa 204–477) was expressed using a modified pET30a vector with an N-terminal 6×His tag cleavable by TEV protease. E. coli Rosetta (DE3) was freshly transformed with the plasmid and grown in four flasks containing 1 L of 2×TY medium with kanamycin 34 µg mL-1 and chloramphenicol 50 µg mL-1 at 37°C to an OD at 600 nm of 1.0. Protein synthesis was then induced with 0.5 mM isopropyl-β-D-thiogalactopyranoside 16


Page 17 of 44

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


and the cultures were further incubated at 20°C for 18 h. Cells were harvested and resuspended in 50 mL lysis buffer (20 mM Tris-HCl pH 8.0, 100 mM NaCl, 1 mM TCEP, 0.5 mM EDTA, 1 × Protease inhibitor cocktail). Cells were lysed by sonication, and the soluble fraction was isolated by centrifugation (18000 × g for 20 min). The supernatant was applied to cOmplete His-Tag Purification Resin and the resin was thoroughly washed in wash buffer (20 mM Tris-HCl pH 8.0, 100 mM NaCl, 1 mM TCEP, 10 mM imidazole). The human PPARγ-LBD was eluted with elution buffer (20 mM Tris-HCl pH 8.0, 100 mM NaCl, 1 mM TCEP, 250 mM imidazole). TEV protease was added to the eluate and the mixture was dialyzed overnight at RT, dialysis with 500 mL of buffer (20 mM Tris-HCl pH 8.0, 1 mM TCEP, 0.5 mM EDTA). The cleaved protein was passed through cOmplete His-Tag Purification Resin. The flow-through was loaded onto a Resource Q (6 mL) column (GE Healthcare) equilibrated with buffer (20 mM Tris-HCl pH 8.0, 1 mM TCEP, 0.5 mM EDTA). The column was eluted with a NaCl gradient from 0 to 0.5 M in the starting buffer. The eluted fractions were concentrated and loaded onto a Superdex 75 (24 mL) gel-filtration column equilibrated with buffer (20 mM Tris-HCl pH 8.0, 1 mM TCEP, 0.5 mM EDTA) ESI mass Spectroscopy. 17



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 18 of 44

All mass spectra of m/z 100–4,000 were acquired with a JMS-T100LP AccuTOF LC-Plus in electrospray positive mode. Samples were introduced into the MS system using a syringe pump (Harvard Apparatus) and a 1 mL Hamilton syringe. For The PPARα-LBD (300 µL) was concentrated in 500 µM ammonium acetate buffer to concentration of 20–54 µM and incubated with a 4-fold excess of ligand for 0–60 min at RT. The injection flow rate was 20 µL min-1. Default source parameters were needle voltage, 2 kV; ion guide peak voltage, 2.5 kV; ion guide bias voltage, 27 V; orifice 1 voltage, 175 V; orifice 2 voltage, 2 V; ring lends voltage, 10 V; detector voltage. 2700 V; orifice 1 temperature, 60°C; desolvation temperature, 200°C; nebulizing gas, 0.5 L min-1; drying gas, 1.5 L min-1. For The PPARγ-LBD (400 µL) was concentrated in 500 µM ammonium acetate buffer to concentration of 23 µM and incubated with a 4-fold excess of ligand at RT. The injection flow rate was 100 µL min-1. Default source parameters were needle voltage, 2.2 kV; ion guide peak voltage, 2.5 kV; ion guide bias voltage, 27 V; orifice 1 voltage, 80 V; orifice 2 voltage, 8 V; ring lends voltage, 15 V; detector voltage. 2700 V; orifice 1 temperature, 25°C; desolvation temperature, 250°C; nebulizing gas, 0.5 L min-1; drying gas, 1.5 L min-1. To determine the molecular weight, spectra were deconvoluted using ESI deconvolution Ver. 2.01 of JEOL. 18


Page 19 of 44

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Protein Crystallization. All crystals were obtained by co-crystallization with the relevant ligand. Co-crystallization was performed by vapor diffusion at room temperature using a hanging drop that was made by mixing protein solution and reservoir solution with 17-oxoDHA 1. For PPARα, 0.75 µL of hPPARα-LBD solution (7.8 mg mL-1, in 20 mM HEPES pH 8.0, 150 mM NaCl, 5% glycerol, 1 mM TCEP) with 250 µM 17-oxoDHA 1 and 1 mM SRC1-2 peptide in 1.25 µL of reservoir solution (100 mM HEPES pH 6.9, 35% (w/v) PEG3350). For PPARγ, 2 µL of hPPARγ-LBD solution (8.0 mg mL-1, in 20 mM Tris-HCl pH 8.0, 1 mM TCEP, 0.5 mM EDTA) with 250 µM 17-oxoDHA 1 in 1 µL of reservoir solution (0.1 M Tris-HCl pH 7.4, 0.825 M sodium citrate).The mixture was stored in the dark and prismatic crystals appeared after a few days. Crystals were flash-cooled in liquid nitrogen after a fast soaking in a cryoprotectant buffer (PPARα; reservoir solution with glycerol 50% (v/v) and PPARγ; reservoir solution with glycerol 24% (v/v)). X-ray Crystallographic Analysis. Diffraction data sets were collected at the beamline NW-12A of the Photon Factory Advanced Ring (PF-AR) at the High Energy Accelerator Research Organization (KEK) (Tsukuba, Japan). 19



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 20 of 44

Reflections were recorded with an oscillation range per image of 1.0°. Data were indexed, integrated, and scaled using the iMOSFLM34–36 and HKL 200037 and the CCP438 suite of programs. The structure PPARα was solved using MR-Rosetta program39–41 in PHENIX42 software for molecular replacement with PDB entry 2P548 which has the highest resolution among PPARα/co-activator complexes. To improve low resolution analysis, the refinement was performed by applying hybrid Rosetta/Phenix refinement program (phenix.rosetta_refine) 43 and phenix.refine program.44,45 Molecular modeling was performed by using COOT. The PDB entry 4CI517 was used as the original search model for PPARγ. Molecular modeling was performed by using COOT46, and the refinement was done by REFMAC47 and Phenix.refine. The coordinate data for the structures were deposited in the Protein Data Bank under the accession numbers 5AZT (PPARα-LBD/17-oxoDHA 1 complex), and 5AZV (PPARγ-LBD/17-oxoDHA 1 complex).

Acknowledgements This work was financially supported by the Platform for Drug Discovery, Informatics, and Structural Life Science from the Ministry of Education, Culture, Sports, Science and Technology (MEXT) and Japan Agency for Medical Research and Development (AMED), the 20


Page 21 of 44

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


MEXT-Supported Program for the Strategic Research Foundation at Private Universities (2013–2017), and the Takeda Science Foundation, Japan, (to K.Y.), and by a Grant-in-Aid for Scientific Research (No. 25860090) from MEXT (to T.I.). Synchrotron-radiation experiments were performed at the Photon Factory (Proposal No. 2011G685, 2013G656), and we are grateful for the assistance provided by the beamline scientists at the Photon Factory.

Abbreviations PPARα, peroxisome proliferator-activated receptor α; PPARγ, peroxisome proliferator-activated receptor γ; LBD, ligand binding domain; 17-oxoDHA, 17-oxo-docosahexaenoic acid; 4-oxoDHA, 4-oxo-docosahexaenoic acid; 17(S)-HDHA, 17-(S)-hydroxy docosahexaenoic acid

21



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 22 of 44

References 1. Lalloyer, F., and Staels, B. (2010) Fibrates, Glitazones, and Peroxisome Proliferator-Activated Receptors, Arterioscler. Thromb, Vasc. Biol. 30, 894–899. 2. Varga, T., Czimmerer, Z., and Nagy, L. (2011) PPARs are a unique set of fatty acid regulated transcription factors controlling both lipid metabolism and inflammation, Biochim. Biophys. Acta. 1812, 1007–1022. 3. Chatterjee, S., Majumder, A., and Ray, S. (2015) Observational Study of Effects of Saroglitazar on Glycaemic and Lipid Parameters on Indian Patients with Type 2 Diabetes, Sci. Rep. Epub Jan 9, 2015. DOI: 10.1038/srep07706. 4. Cronet, P., Petersen, J. F., Folmer, R., Blomberg, N., Sjöblom, K., Karlsson, U., Lindstedt, E. L., and Bamberg, K. (2001) Structure of the PPARα and -γ ligand binding domain in complex with AZ 242; ligand selectivity and agonist activation in the PPAR family, Structure 9, 699–706. 5. Xu, H. E., Lambert, M. H., Montana, V. G., Plunket, K. D., Moore, L. B., Collins, J. L., Oplinger, J. A., Kliewer, S. A., Gampe, R. T., McKee, D. D., Moore, J. T., and Willson, T. M. (2001) Structural determinants of ligand binding selectivity between the peroxisome proliferator-activated receptors, Proc. Natl. Acad. Sci. U. S. A. 98, 13919–13924. 22


Page 23 of 44

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


6. Xu, H. E., Stanley, T. B., Montana, V. G., Lambert, M. H., Shearer, B. G., Cobb, J. E., McKee, D. D., Galardi, C. M., Plunket, K. D., Nolte, R. T., Parks, D. J., Moore, J. T., Kliewer, S. A., Willson, T. M., and Stimmel, J. B. (2002) Structural basis for antagonist-mediated recruitment of nuclear co-repressors by PPARα, Nature 415, 813–817. 7. Oon Han, H., Kim, S. H., Kim, K.-H., Hur, G.-C., Joo Yim, H., Chung, H.-K., Ho Woo, S., Dong Koo, K., Lee, C.-S., Sung Koh, J., and Kim, G. T. (2007) Design and synthesis of oxime ethers of α-acyl-β-phenylpropanoic acids as PPAR dual agonists, Bioorg. Med. Chem. Lett. 17, 937–941. 8. Sierra, M. L., Beneton, V., Boullay, A.-B., Boyer, T., Brewster, A. G., Donche, F., Forest, M.-C., Fouchet, M.-H., Gellibert, F. J., Grillot, D. A., Lambert, M. H., Laroze, A., Le Grumelec, C., Linget, J. M., Montana, V. G., Nguyen, V., Nicodème, E., Patel, V., Penfornis, A., Pineau, O., Pohin, D., Potvain, F., Poulain, G., Ruault, C. B., Saunders, M., Toum, J., Xu, H. E., Xu, R. X., and Pianetti, P. M. (2007) Substituted 2-[(4-Aminomethyl)phenoxy]-2-methylpropionic Acid PPARα Agonists. 1. Discovery of a Novel Series of Potent HDLc Raising Agents, J. Med. Chem. 50, 685–695.

23



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 24 of 44

9. Artis, D. R., Lin, J. J., Zhang, C., Wang, W., Mehra, U., Perreault, M., Erbe, D., Krupka, H. I., England, B. P., Arnold, J., Plotnikov, A. N., Marimuthu, A., Nguyen, H., Will, S., Signaevsky, M., Kral, J., Cantwell, J., Settachatgull, C., Yan, D. S., Fong, D., Oh, A., Shi, S., Womack, P., Powell, B., Habets, G., West, B. L., Zhang, K. Y. J., Milburn, M. V, Vlasuk, G. P., Hirth, K. P., Nolop, K., Bollag, G., Ibrahim, P. N., and Tobin, J. F. (2009) Scaffold-based discovery of indeglitazar, a PPAR pan-active anti-diabetic agent, Proc. Natl. Acad. Sci. U. S. A. 106, 262–267. 10. Grether, U., Bénardeau, A., Benz, J., Binggeli, A., Blum, D., Hilpert, H., Kuhn, B., Märki, H. P., Meyer, M., Mohr, P., Püntener, K., Raab, S., Ruf, A., and Schlatter, D. (2009) Design and biological evaluation of novel, balanced dual PPARα/γ agonists, ChemMedChem 4, 951–956. 11. Bénardeau, A., Benz, J., Binggeli, A., Blum, D., Boehringer, M., Grether, U., Hilpert, H., Kuhn, B., Märki, H. P., Meyer, M., Püntener, K., Raab, S., Ruf, A., Schlatter, D., and Mohr, P. (2009) Aleglitazar, a new, potent, and balanced dual PPARα/γ agonist for the treatment of type II diabetes, Bioorg. Med. Chem. Lett. 19, 2468–2473. 12. Oyama, T., Toyota, K., Waku, T., Hirakawa, Y., Nagasawa, N., Kasuga, J. I., Hashimoto, Y., Miyachi, H., and Morikawa, K. (2009) Adaptability and selectivity of human peroxisome

24


Page 25 of 44

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


proliferator-activated receptor (PPAR) pan agonists revealed from crystal structures, Acta Crystallogr., Sect. D: Biol. Crystallogr. 65, 786–795. 13. Li, J., Kennedy, L. J., Shi, Y., Tao, S., Ye, X.-Y., Chen, S. Y., Wang, Y., Hernández, A. S., Wang, W., Devasthale, P. V, Chen, S., Lai, Z., Zhang, H., Wu, S., Smirk, R. a, Bolton, S. a, Ryono, D. E., Zhang, H., Lim, N.-K., Chen, B.-C., Locke, K. T., O’Malley, K. M., Zhang, L., Srivastava, R. A., Miao, B., Meyers, D. S., Monshizadegan, H., Search, D., Grimm, D., Zhang, R., Harrity, T., Kunselman, L. K., Cap, M., Kadiyala, P., Hosagrahara, V., Zhang, L., Xu, C., Li, Y.-X., Muckelbauer, J. K., Chang, C., An, Y., Krystek, S. R., Blanar, M. a, Zahler, R., Mukherjee, R., Cheng, P. T. W., and Tino, J. a. (2010) Discovery of an oxybenzylglycine based peroxisome proliferator

activated

receptor

α

selective

agonist

2-((3-((2-(4-chlorophenyl)-5-methyloxazol-4-yl)methoxy)benzyl)(methoxycarbonyl)amino)acetic acid (BMS-687453), J. Med. Chem. 53, 2854–2864. 14. Jin, L., Lin, S., Rong, H., Zheng, S., Jin, S., Wang, R., and Li, Y. (2011) Structural basis for iloprost as a dual peroxisome proliferator-activated receptor α/δ agonist, J. Biol. Chem. 286, 31473–31479.

25



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 26 of 44

15. Kuwabara, N., Oyama, T., Tomioka, D., Ohashi, M., Yanagisawa, J., Shimizu, T., and Miyachi, H. (2012) Peroxisome proliferator-activated receptors (PPARs) have multiple binding points that accommodate ligands in various conformations: phenylpropanoic acid-type PPAR ligands bind to PPAR in different conformations, depending on the subtype, J. Med. Chem. 55, 893–902. 16. Bernardes, A., Souza, P. C. T., Muniz, J. R. C., Ricci, C. G., Ayers, S. D., Parekh, N. M., Godoy, A. S., Trivella, D. B. B., Reinach, P., Webb, P., Skaf, M. S., and Polikarpov, I. (2013) Molecular mechanism of peroxisome proliferator-activated receptor α activation by WY14643: a new mode of ligand recognition and receptor stabilization, J. Mol. Biol. 425, 2878–2893. 17. Dos Santos, J. C., Bernardes, A., Giampietro, L., Ammazzalorso, A., De Filippis, B., Amoroso, R., and Polikarpov, I. (2015) Different binding and recognition modes of GL479, a dual agonist of Peroxisome Proliferator-Activated Receptor α/γ, J. Struct. Biol. 191, 332–340. 18. Schopfer, F., Cipollina, C., and Freeman, B. (2011) Formation and signaling actions of electrophilic lipids, Chem. Rev. 111, 5997–6021.

26


Page 27 of 44

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


19. Itoh, T., Fairall, L., Amin, K., Inaba, Y., Szanto, A., Balint, B. L., Nagy, L., Yamamoto, K., and Schwabe, J. W. R. (2008) Structural basis for the activation of PPARγ by oxidized fatty acids, Nat Struct Mol Biol. 15, 924–931. 20. Schopfer, F. J., Cole, M. P., Groeger, A. L., Chen, C.-S., Khoo, N. K. H., Woodcock, S. R., Golin-Bisello, F., Motanya, U. N., Li, Y., Zhang, J., Garcia-Barrio, M. T., Rudolph, T. K., Rudolph, V., Bonacci, G., Baker, P. R., Xu, H. E., Batthyany, C. I., Chen, Y. E., Hallis, T. M., and Freeman, B. A. (2010) Covalent peroxisome proliferator-activated receptor γ adduction by nitro-fatty acids: selective ligand activity and anti-diabetic signaling actions, J. Biol. Chem. 285, 12321–12333. 21. Egawa, D., Itoh, T., and Yamamoto, K. (2015) Characterization of Covalent Bond Formation between PPARγ and Oxo-Fatty Acids, Bioconjug. Chem. 26, 690–698. 22. Liao, Z., Dong, J., Wu, W., Yang, T., Wang, T., Guo, L., Chen, L., Xu, D., and Wen, F. (2012) Resolvin D1 attenuates inflammation in lipopolysaccharide-induced acute lung injury through a process involving the PPARγ/NF-κB pathway, Respir. Res. Epub Dec 2, 2012. DOI: 10.1186/1465-9921-13-11013:110.

27



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 28 of 44

23. González-Périz, A., Planagumà, A., Gronert, K., Miquel, R., López-Parra, M., Titos, E., Horrillo, R., Ferré, N., Deulofeu, R., Arroyo, V., Rodés, J., and Clària, J. (2006) Docosahexaenoic acid (DHA) blunts liver injury by conversion to protective lipid mediators: protectin D1 and 17S-hydroxy-DHA, FASEB J. 20, 2537–2539. 24. Groeger, A. L., Cipollina, C., Cole, M. P., Woodcock, S.R., Bonacci, G., Rudolph, T. K., Rudolph, V., Freeman, B. A., Schopher, F. J., (2010) Cyclooxygenase-2 generates anti-inflammatory mediators from omega-3 fatty acids, Nat Chem Biol. 6, 433–441. 25. Neuhofer, A., Zeyda, M., Mascher, D., Itariu, B. K., Murano, I., Leitner, L., Hochbrugger, E. E., Fraisl, P., Cinti, S., Serhan, C. N., and Stulnig, T. M. (2013) Impaired Local Production of Proresolving Lipid Mediators in Obesity and 17-HDHA as a Potential Treatment for Obesity-Associated Inflammation, Diabetes 62, 1945–1956. 26. Serhan, C. N. (2014) Pro-resolving lipid mediators are leads for resolution physiology. Nature 510, 92–101. 27. Ramon, S., Baker, S. F., Sahler, J. M., Kim, N., Feldsott, E. a., Serhan, C. N., Martinez-Sobrido, L., Topham, D. J., and Phipps, R. P. (2014) The Specialized Proresolving

28


Page 29 of 44

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Mediator 17-HDHA Enhances the Antibody-Mediated Immune Response against Influenza Virus: A New Class of Adjuvant? J. Immunol. 193, 6031–6040. 28. Bruning, J. B., Chalmers, M. J., Prasad, S., Busby, S. A, Kamenecka, T. M., He, Y., Nettles, K. W., and Griffin, P. R. (2007) Partial agonists activate PPARγ using a helix 12 independent mechanism, Structure 15, 1258–1271. 29. Itoh, T., Saito, T., Yamamoto, Y., Ishida, H., and Yamamoto, K. (2016) Gram scale synthesis of specialized pro-resolving mediator 17(S)-HDHA using lipoxygenase enhanced by water-soluble reducing agent TCEP, Bioorg Med Chem. Lett. 26, 343−345. 30. Yamamoto, K., Itoh, T., Abe, D., Shimizu, M., Kanda, T., Koyama, T., Nishikawa, M., Tamai, T., Ooizumi, H., and Yamada, S. (2005) Identification of Putative Metabolites of Docosahexaenoic Acid as Potent PPARγ Agonists and Antidiabetic Agents, Bioorg. Med. Chem. Lett. 15, 517–522. 31. Kang, T., Martins, T., and Sadowski, I. (1993) Wild type GAL4 binds cooperatively to the GAL1-10 UASG in vitro, J. Biol. Chem. 268, 9629–9635.

29



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 30 of 44

32. Lehmann, J. M., Moore, L. B., Smith-Oliver, T. A., Wilkison, W. O., Willson, T. M., and Kliewer, S. A. (1995) An antidiabetic thiazolidinedione is a high affinity ligand for peroxisome proliferator-activated receptor γ (PPARγ), J. Biol. Chem. 270, 12953–12956. 33. Yamamoto, K., Masuno, H., Choi, M., Nakashima, K., Taga, T., Ooizumi, H., Umesono, K., Sicinska, W., VanHooke, J., DeLuca, H. F., and Yamada, S. (2000) Three-dimensional modeling of and ligand docking to vitamin D receptor ligand binding domain, Proc. Natl. Acad. Sci. U. S. A. 97, 1467–1472. 34. Leslie, A. G. (2006) The integration of macromolecular diffraction data, Acta Crystallogr., Sect. D: Biol. Crystallogr. 62, 48–57. 35. Leslie, A. G. W., and Powell, H. R. (2007) Processing Diffraction Data with Mosflm, in Evolving Methods for Macromolecular Crystallography (Read, R. J., and Sussman, J. L., Ed.), Vol. 245, pp 41–51, Springer, New York. 36. Battye, T. G. G., Kontogiannis, L., Johnson, O., Powell, H. R., and Leslie, A. G. W. (2011) iMOSFLM: A new graphical interface for diffraction-image processing with MOSFLM, Acta Crystallogr., Sect. D: Biol. Crystallogr. 67, 271–281.

30


Page 31 of 44

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


37. Otwinowski, Z., and Minor W. (1997) Processing of X-ray Diffraction Data Collected in Oscillation Mode, Methods in Enzymology, Macromolecular Crystallography, part A, 276, 307-326. 38. Collaborative Computational Project, Number 4. (1994) The CCP4 suite: programs for protein crystallography, Acta Crystallogr., Sect. D: Biol. Crystallogr. 50, 760–763. 39. DiMaio, F., Terwilliger, T. C., Read, R. J., Wlodawer, A., Oberdorfer, G., Wagner, U., Valkov, E., Alon, A., Fass, D., Axelrod, H. L., Das, D., Vorobiev, S. M., Iwaï, H., Pokkuluri, P. R. and Baker, D. (2011) Improved molecular replacement by density- and energy-guided protein structure optimization, Nature 473, 540-543. 40. Terwilliger, T. C., Dimaio, F., Read, R. J., Baker, D., Bunkóczi, G., Adams, P. D., Grosse-Kunstleve, R. W., Afonine P. V. and Echols, N. (2012) phenix.mr_rosetta: molecular replacement and model rebuilding with Phenix and Rosetta, J. Struct. Funct. Genomics 13, 81-90. 41. DiMaio, F., Tyka, M. D., Baker, M. L., Chiu, W., and Baker, D. (2009) Refinement of protein structures into low-resolution density maps using rosetta, J. Mol. Biol. 392, 181-90.

31



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

42. Adams, P. D., Afonine, P. V., Bunkóczi, G., Chen, V. B., Davis, I. W., Echols, N., Headd, J. J., Hung, L. W., Kapral, G. J., Grosse-Kunstleve, R. W., McCoy, A. J., Moriarty, N. W., Oeffner, R., Read, R. J., Richardson, D. C., Richardson, J. S., Terwilliger, T. C., and Zwart, P. H. (2010) PHENIX: a comprehensive Python-based system for macromolecular structure solution, Acta Crystallogr., Sect. D: Biol. Crystallogr. 66, 213–221. 43. DiMaio, F. Echols, N.

Headd, J. J., Terwilliger, T. C., Adams,P. D. and Baker, D. (2013)

Improved low-resolution crystallographic refinement with Phenix and Rosetta, Nature Methods10, 1102-1106. 44. Afonine, P. V., Grosse-Kunstleve, R. W., Echols, N., Headd, J. J., Moriarty, N. W., Mustyakimov, M., Terwilliger, T. C., Urzhumtsev, A., Zwart, P. H., Adams, P.D. (2012) Towards automated crystallographic structure refinement with phenix.refine. Acta Crystallogr D Biol Crystallogr.68, 352-367. 45. Headd, J. J., Echols, N., Afonine, P. V., Grosse-Kunstleve, R. W., Chen, V. B., Moriarty, N. W., Richardson, D. C., Richardson, J. S., Adams, P. D. (2012) Use of knowledge-based restraints in phenix.refine to improve macromolecular refinement at low resolution. Acta Crystallogr D Biol Crystallogr.68, 381-390. 32


Page 32 of 44

Page 33 of 44

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


46. Emsley, P., and Cowtan, K. (2004) Coot: model-building tools for molecular graphics, Acta Crystallogr., Sect. D: Biol. Crystallogr. 60, 2126–2132. 47. Murshudov, G. N., Vagin, A. A., and Dodson, E. J. (1997) Refinement of macromolecular structures by the maximum-likelihood method, Acta Crystallogr., Sect. D: Biol. Crystallogr. 53, 240−255.

33



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 34 of 44

Table 1. Summary of data collection statistics and refinement of crystal structures protein

PPARα-LBD

PPARγ-LBD

X-ray source

KEK-PFAR NW-12A

KEK-PFAR NW-12A

Wavelength (Å)

1.00000

1.00000

Space group

P 41 21 2

C121

a = 59.46, b = 59.46, c =

a = 92.61, b = 60.95, c =

318.19

118.21

α = 90.00, β = 90.00, γ =

α = 90.00, β = 102.36, γ =

90.00

90.00

Resolution range (Å)

47.63–3.41 (3.47–3.41)a

45.56–2.70 (2.83–2.70)a

Total number of reflections

100189

57442

No. of unique reflections

14757

17279

Rmerge

0.114 (0.310)a

0.055 (0.275)a

I / σI

27.8 (11.0)a

14.7 (3.9)a

% completeness

98.6 (98.1)a

96.4 (92.2)a

Redundancy Refinement statistics Resolution range (Å)

6.8 (6.3)a

3.3 (3.2)a

47.63–3.41

45.56–2.70

R factor (Rfree/Rwork)

0.2749/0.2403

0.2455/0.1946

No. atoms

4136

4101

Protein

3975

3965

Petide

87

–

Ligand

50

50

Water

23

85

B-factors

32.6

51.4

Protein

32.0

51.3

Petide

54.2

–

Ligand

48.6

69.9

Water

12.3

44.4

0.008

0.013

Unit cell dimensions (Å) (°)

R.m.s deviations Bond lengths (Å)

34


Page 35 of 44

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Bond angles (°)

1.434

1.293

99

99

0

0

Ramachandran plot Favored regions (%) Outliers (%) a

Values in parentheses are for the highest-resolution shell.

35



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 36 of 44

Figure legends Figure 1 Structures of oxo-fatty acids and PPAR ligands

Figure 2 Transcriptional activity of PPARα, γ and δ stimulated by various ligands. Cos7 cells were transfected

with

a GAL4-PPAR

chimera

expression

plasmid (pCMX-GAL-hPPARα,

pSG5-GAL-hPPARγ or pCMX-GAL-hPPARδ), a reporter plasmid (MH100×4-TK-Luc), and an internal control plasmid containing sea pansy luciferase expression constructs (pRL-CMV). a) Cos7 cells were treated with the 17-oxoDHA (3 µM) and 17(S)-HDHA (3 µM) for PPARγ, α and δ activity in a luciferase reporter assay. b) The concentration-dependent effects of 4-oxoDHA, 17-oxoDHA, and the control compound on PPARγ activity. c) Competitive effect of 17-oxoDHA against activation of PPARγ by 10 µM pioglitazone. d) Concentration-dependent effects of 4-oxoDHA, 17-oxoDHA and the control compound on PPARα activity. e) Effects of various oxo-fatty acids (0, 3 and 10 µM) on PPARα activity.

36


Page 37 of 44

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Figure 3 Deconvoluted ESI mass spectra of PPAR-LBD in the absence or presence of oxo-fatty acids, 17-oxoDHA and 4-oxoDHA. a) PPARγ-LBD. b) PPARα-LBD.

Figure 4 Time course of covalent bond formation between PPARα-LBD and 17-oxoDHA. WT PPARα-LBD, and the C275S and C276S mutants, were incubated with 17-oxoDHA and the ESI mass spectra were collected at 0, 5, 10, 20, 30 and 60 min after addition of the ligand. a) WT PPARα-LBD. b) C276S PPARα-LBD. c) C275S PPARα-LBD. d) Ratio of covalent-bond formation from 0-60 min.

Figure 5 Crystal structure of PPAR-LBD complexed with 17-oxoDHA. a, b) PPARγ-LBD/17-oxoDHA complex. 17-OxoDHA formed a covalent bond with Cys285 and formed hydrogen bonds with the backbone amide group of Glu343. c, d) PPARα-LBD/17-oxoDHA complex. 17-OxoDHA (green)

37



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 38 of 44

formed a covalent bond with Cys275 and formed hydrogen bonds with Tyr464 in helix12 (magenta) and with two additional residues (Tyr314 and His440).

Figure 6 The activity of PPARα mutants C276S (gray) and C275S (black) in cultured cells.

38


Page 39 of 44

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


17-oxoDHA

pioglitazone

17(S)-HDHA WY14643

4-oxoDHA

fig 1 ACS Paragon Plus Environment


b 0.03

PPARg

PPARg luciferase activity

a

0.10 0.1

control 0.3 1 3 10 30

4-oxoDHA

(mM)

control 0.3 1 3 10 30

c

control 0.3 1 3 10 30

17(S)-HDHA

control

PPARa

pioglitazone

(mM)

17-oxoDHA

PPARg

luciferase activity

0.8

0.000

17-oxoDHA

0

control 0.1 0.3 1 3 10 30

0.05 0.05

0.20 0.2 0.10 0.1

control 0.1 0.3 1 3 10 20 30

17(S)-HDHA

(mM)

17-oxoDHA

pioglitazone 10 mM

d

PPARd

PPARa 0.50 0.5

luciferase activity

0.02

control

0

17-oxoDHA

0.000

WY14643

control 0.3 1 3 10 30

control 1 3 10 30 50 100

0.000

4-oxoDHA

17-oxoDHA

e


1 3 10

1 3 10

1 3 10

0.00

1 3 10

PPARa

0.2 0.2

control

luciferase activity

17(S)-HDHA

0

control

0.25 0.25

17-oxoDHA

luciferase activity

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 40 of 44

(mM)

Page 41 of 44

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


a PPARg-LBD (no ligand)

20 min after 4-oxoDHA addition

PPARg (no ligand) 31,410 Da

PPARg/4-oxoDHA 31,753 Da

(calclated. 31,752 Da)


+ NH4+

PPARg/17-oxoDHA

+ 2NH4+

31,755 Da


31,000 Da

32,000 Da

b PPARa-LBD (no ligand)

PPARa (no ligand)


PPARa (no ligand)

30,328 Da

30,327 Da

PPARa/4-oxoDHA


30,669 Da

PPARa/17-oxoDHA


30,670 Da


30,000 Da

31,000 Da



Page 42 of 44

a WT PPARa-LBD apo PPARa

17-oxoDHA complex

time (min)

relative intensity (%)

60 30 20 10 5 0 30,000

30,672

30,328

31,000 Da

b C276S PPARa-LBD apo PPARa 17-oxoDHA complex (+ NH4+)

time (min)


60 30 20 10 5 0 30,000

30,312

30,671

31,000 Da

c C275S PPARa-LBD apo PPARa

17-oxoDHA complex

time (min)


60 30 20 10 5 0 30,000

30,311

30,653

31,000 Da

d WT C275S C276S

100 covalent-bond formation ratio (%)

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

50 0 0 10 20 30 40 50 60 time (min)


fig 4

Page 43 of 44

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


a

c PPARg-LBD/17-oxoDHA

PPARa-LBD/17-oxoDHA

SRC1 peptide

b

d Tyr473

His449

Tyr314 Glu343

His440

Cys276

Tyr464

Ser342

Cys285 Cys275



a

PPARa C276S

0.00

WY14643

control 0.3 1 3 10 30

0.101

control 1 3 10 30 50 100

luciferase activty

0.202

(mM)

17-oxoDHA

b PPARa C275S 0.202

0.00

WY14643

control 0.3 1 3 10 30

0.101

control 1 3 10 30 50 100

luciferase activty

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 44 of 44

17-oxoDHA


(mM)

Î³ Dual Covalent Modifier and Agonist - ACS

Recommend Documents