α-Lipoic Acids Promote the Protein Synthesis of C2C12 Myotubes by

Feb 7, 2016 - Sample protein concentration was measured with a BCA protein assay method kit (Thermo Scientific, Meridian, Rockford, IL, USA). ... Prot...
1 downloads 3 Views 5MB Size
Download PDF
Article pubs.acs.org/JAFC

α‑Lipoic Acids Promote the Protein Synthesis of C2C12 Myotubes by the TLR2/PI3K Signaling Pathway Yuanyuan Jing,∥ Xingcai Cai,∥ Yaqiong Xu, Canjun Zhu, Lina Wang, Songbo Wang, Xiaotong Zhu, Ping Gao, Yongliang Zhang, Qingyan Jiang, and Gang Shu* College of Animal Science and National Engineering Research Center for Breeding Swine Industry, South China Agricultural University, Guangzhou 510640, Guangdong, China ABSTRACT: Skeletal muscle protein turnover is regulated by endocrine hormones, nutrients, and inflammation. α-Lipoic acid (ALA) plays an important role in energy homeostasis. Therefore, the aim of this study was to investigate the effects of ALA on protein synthesis in skeletal muscles and reveal the underlying mechanism. ALA (25 μM) significantly increased the protein synthesis and phosphorylation of Akt, mTOR, and S6 in C2C12 myotubes with attenuated phosphorylation of AMPK, Ikkα/β, and eIF2α. Intraperitoneal injection of 50 mg/kg ALA also produced the same results in mouse gastrocnemius. Both the PI3K (LY294002) and mTOR (rapamycin) inhibitors abolished the effects of ALA on protein synthesis in the C2C12 myotubes. However, AICAR (AMPK agonist) failed to block the activation of mTOR and S6 by ALA. ALA increased TLR2 and MyD88 mRNA expression in the C2C12 myotubes. TLR2 knockdown by siRNA almost eliminated the effects of ALA on protein synthesis and the Akt/mTOR pathway in the C2C12 myotubes. Immunoprecipitation data showed that ALA enhanced the p85 subunit of PI3K binding to MyD88. These findings indicate that ALA induces protein synthesis and the PI3K/Akt signaling pathway by TLR2. KEYWORDS: protein synthesis, lipoic acid, inflammation, TLR2, mTOR

■

important anti-inflammatory agent.17 A series of evidence indicates that ALA reduces inflammatory cytokine activation by suppressing NF-κB DNA binding activity and in part by suppressing the activation of c-jun N-terminal kinase (JNK).18 However, to date, no evidence demonstrates the role of the inflammation pathway in ALA-induced muscle protein synthesis. Thus, the purpose of this paper is to identify the effects of ALA on the protein synthesis of C2C12 myotubes and its potential underlying signaling pathway. We investigated the pathways involved in ALA modulation of the TLR2/PI3K/Akt signaling pathway in C2C12 myotubes.

INTRODUCTION The mass of skeletal muscles is determined by the balance between protein synthesis and degradation. Excessive protein degradation induces muscle atrophy, which is associated with increased morbidity and mortality,1,2 such as cancer cachexia3 and disuse atrophy.4 The phosphatidylinositol 3-kinase (PI3K)/ Akt pathway is a crucial intracellular signaling mechanism in protein synthesis and muscle hypertrophy.5,6 Activation of the PI3K/Akt pathway is sufficient to induce hypertrophy and block skeletal muscle atrophy.6 PI3K/Akt can activate mTOR and downstream target proteins (S6K1, S6, 4E-BP1),7 thereby regulating intracellular amino acid concentration to increase translation initiation and protein synthesis in skeletal muscles.8−10 α-Lipoic acid (ALA) is an endogenous short-chain fatty acid that serves as a cofactor of mitochondrial α-ketoacid dehydrogenase.11 An increasing amount of data shows that ALA plays an important role in energy homeostasis12 and cell growth and apoptosis.13 Rong et al.14 reported that pre- and posttreatment with ALA can activate Akt/mTOR/S6K1 and 4E-BP1 phosphorylation in cerebral endothelial cells. In mesangial cells, ALA dose-dependently regulates cell proliferation and matrix protein secretion by the mTOR/p70S6K/4E-BP1 signaling pathway under high-glucose conditions.15 However, whether ALA activates the Akt/mTOR pathway in C2C12 myotubes and modulates skeletal muscle protein turnover remains unclear. A chronic state of inflammation is a central mechanism underlying the pathophysiology of insulin resistance. Inflammatory mediators inhibit PI3K/Akt signaling through several mechanisms,16 such as serine-phosphorylation of IRS-1, induction of SOCS3, and activation of JNK or NFκB signaling in insulin-target tissues. ALA has also been reported as an © 2016 American Chemical Society

■

MATERIALS AND METHODS

Cell Culture. The C2C12 cell (skeletal muscle immortalized mouse cell line) was obtained from ATCC and cultured in high Dulbecco’s modified Eagle’s medium (DMEM) (Gibco BRL, Carlsbad, CA, USA) supplemented with 10% fetal bovine serum (Gibco BRL), 100 μg/mL streptomycin, and 100 U/mL penicillin (Gibco BRL) at 37 °C under a humidified 5% CO2 atmosphere. When the myoblasts reached approximately 80−90% confluency, cells were allowed to differentiate in DMEM with 2% horse serum, 100 U/mL penicillin, and 100 μg/mL streptomycin (Gibco BRL). C2C12 myotubes were differentiated for 6 days before treatment. After treatment, the cells were washed twice with phosphate-buffered saline (PBS) before protein extraction. Animals. Twenty male Kunming mice (3 weeks old) were obtained from the Guangdong Experimental Animal Center. Animal maintenance and experiments were in accordance with “Instructive Notions with Respect to Caring for Laboratory Animals” established by the Ministry Received: Revised: Accepted: Published: 1720

December 16, 2015 February 6, 2016 February 7, 2016 February 7, 2016 DOI: 10.1021/acs.jafc.5b05952 J. Agric. Food Chem. 2016, 64, 1720−1729

Article

Journal of Agricultural and Food Chemistry of Science and Technology of the People’s Republic of China. The Kunming mice were fed chow food and water ad libitum for 7 days with a 12:12 h light/dark cycle in a temperature-controlled room. The mice were divided into two groups according to body weight. α-Lipoic acid (50 mg/kg, Sigma, St. Louis, MO, USA) was intraperitoneally administered. The mice were sacrificed 3 h after administration, and gastrocnemius samples were obtained and frozen immediately in liquid nitrogen. Protein Synthesis Measurements. Protein synthesis was measured in vitro in the C2C12 myotubes using the total protein/ genomic DNA ratio and the SUnSET method as previously described.19 C2C12 myotubes were treated with ALA (0, 5, and 25 μM; Sigma) for 48 h. In each well, 10 μg/mL of puromycin was added to the culture medium at 30 min of each treatment. Sample protein concentration was measured with a BCA protein assay method kit (Thermo Scientific, Meridian, Rockford, IL, USA). DNA concentration was measured with a Hipure Tissue DNA kit (Magen, Guangzhou, Guangdong, China). Puromycin expression was analyzed through Western blot as described below. Western Blot. C2C12 myotubes were lysed in cold RIPA lysis buffer containing 1 mM phenylmethanesulfonyl fluoride. The cell lysates were incubated at 4 °C for 15 min and then centrifuged for 10 min at 12000g and 4 °C to remove insoluble materials. The total protein concentration was determined with a BCA protein assay method kit. An equal amount of protein (20 μg) was loaded into each lane. After separation on 10% sodium dodecyl sulfate (SDS)−polyacrylamide gel electrophoresis gels, the proteins were transferred to polyvinylidene fluoride (PVDF) membranes and then blocked with 5% (wt/vol) nonfat dry milk in Trisbuffered saline containing Tween 20 for 2 h at room temperature. Subsequently, the PVDF membranes were incubated with the indicated primary antibodies. Incubation of primary antibodies was performed at 4 °C overnight. Thereafter, the membranes were incubated with the appropriate secondary antibody (1:5000; Bioss, Beijing, China) for 1 h at room temperature. Protein expression was measured with a FluorChem M Fluorescent Imaging System (ProteinSimple, Santa Clara, CA, USA) and normalized to β-actin (Cell Signaling Technology Inc., Danvers, MA, USA) expression. Immunoprecipitation. C2C12 cells were cultured on 60 mm circular plates and transfected by lipofectamine 2000 (Invitrogen Life Technologies, Carlsbad, CA, USA) with 5 μg of MYD88-flag plasmid for 6 h (MYD88 flag was a gift from Ruslan Medzhitov; Addgene plasmid 13093, New Haven, CT, USA). Cell lysates were harvested after treatment with ALA (25 μM) for 48 h. The cells were washed twice with ice-cold PBS and lysed in cold lysis buffer as described above. After measurement of the protein concentration, equal amounts of total protein were mixed with a primary antibody and incubated at 4 °C overnight. Protein-A and -G beads (Beyotime Institute of Biotechnology, Shanghai, China) were then added and incubated at 4 °C for 24 h. The lysates were centrifuged for 5 s at 4 °C and washed three times with PBS. Then, the precipitates were subjected to 2% SDS-PAGE analysis and Western blotting. RNA Extraction, Reverse Transcript, and qPCR. Total RNA was isolated from skeletal muscles (gastrocnemius muscles) or C2C12 myotubes using Tri-Reagent according to the manufacturer’s instructions. RNA was quantified by measuring optical density at 260 nm. Reverse transcription was performed with 2 μg of total RNA and SuperScript III reverse transcriptase. qPCR was performed with an Mx3005P system (Stratagene, La Jolla, CA, USA) using β-actin RNA as an internal control. The primer sequences utilized for qPCR are shown in Table 1. Immunocytochemistry. C2C12 cells were fixed in 4% paraformaldehyde, permeabilized with 0.4% Triton X-100, and then blocked with PBS containing 1% goat serum for 1 h at room temperature. The cells were then immunostained with anti-mouse MHCII antibody (Cell Signaling Technology Inc.) at 4 °C overnight. Thereafter, membranes were incubated with the appropriate FITC (Bioss) for 1 h at room temperature. The nuclei were revealed through DAPI (Biosharp, Hefei, Anhui, China) staining for 15 min. The cells were observed with a Nikon Eclipse Ti-s microscope, and images of the myotubes were captured with Nis-Elements BR software (Nikon Instruments, Tokyo, Japan).

Table 1. PCR Primer Sequences and Amplification Parameters gene

primer sequence (5′−3′)

product size (bp)

Tm (°C)

β-actin

S: 5′GGTCATCACTATTGGCAACGAG3′ A: 5′GAGGTCTTTACGGATGTCAACG3′

142

57

MHCIIb

S: 5′-TGATCACCACCAACCCAT-3′ A: 5′-CAGCCTTGTCAGCAACTTC3′

99

58

MAFbx

S: 5′-TCAGAGAGGCAGATTCGCAA3′ A: 5′TCCAGGAGAGAATGTGGCAG-3′

154

59

MuRF1

S: 5′-TTTGACACCCTCTACGCCAT3′ A: 5′TTGGCACTTGAGAGGAAGGT-3′

203

59

Signaling Pathway Inhibitor Cotreatment. To test and verify the mechanisms of α-LA in C2C12 myotubes, the PI3K/Akt inhibitor LY294002 (5 μM, Beyotime Institute of Biotechnology), mTOR inhibitor rapamycin (500 nM, Sigma), and AMPK agonist AICAR (0.5 mM, Beyotime Institute of Biotechnology) were utilized alone or cotreated with ALA (25 μM) for 48 h. The total protein/DNA, phospho-Akt (Thr473), Akt, phospho-AMPK (Thr172), AMPK, phospho-FoxO1 (Ser 256), FoxO1, phosph-mTOR (Ser2481), mTOR, phospho-S6K1 (Thr389), S6K1, phosph-S6 (Ser235/236), S6, phospho-4E-BP1 (Thr37/46), 4E-BP1, phospho-eIF2α (Ser51), and eIF2α (Cell Signaling Technology Inc.) levels of the C2C12 myotubes were investigated. TLR2 siRNA Transfection. The siRNA sequences were as follows: TLR2 (sense) 5′-GCCUUGACCUGUCUUUCAATT-3′, (resense) 5′UUGAAAGACAGGUCAAGGCTT-3′; negative control (sense) 5′UUCUCCGAACGUGUCACGUTT-3′, (resense) 5′-ACGUGACACGUUCGGAGAATT-3′. The C2C12 myoblasts were plated on 12-well plates 1 day before transfection and were grown to 70% confluence. The C2C12 myotubes were treated with 4 pmol of TLR2 siRNA or negative control siRNA and 2 μL of lipofectamine 2000 (Invitrogen, Carlsbad, CA, USA) for 6 h in a transfection medium. Subsequently, the C2C12 myotubes were differentiated for 6 days. Then, total RNA or cell lysate was harvested after treatment with ALA (25 μM) for 48 h. The knockdown efficiency of genes was confirmed by qPCR. The total protein/ DNA, TLR2, Ikkα/β (Santa Cruz Biotechnology, Santa Cruz, CA, USA), MyD88, phospho-IRS-1 (Tyr465), IRS-1, phospho-JNK (Thr183/Tyr185), JNK, and phospho-Ikkα/β (Ser176/177) (Cell Signaling Technology Inc.) levels of C2C12 myotubes were investigated. Statistical Analysis. All data are expressed as means ± standard error. Statistical analyses were performed between treatments through one-way ANOVA followed by LSD post hoc comparisons or Tamhane’s T2 test with GraphPad Prism 6 (GraphPad Software Inc., La Jolla, CA, USA). P < 0.05 was considered to indicate a statistically significant difference between values.

■

RESULTS Effects of α-Lipoic Acid on Protein Synthesis in C2C12 Myotubes. After differentiation, the C2C12 myotubes were exposed to different concentrations of ALA (0, 5, and 25 μM) for 48 h. An equal amount of protein (20 μg) was subjected to Western blot. The results showed that ALA dose-dependently increased the cellular protein content and the incorporation of 1721

DOI: 10.1021/acs.jafc.5b05952 J. Agric. Food Chem. 2016, 64, 1720−1729

Article

Journal of Agricultural and Food Chemistry

Figure 1. ALA promoted protein synthesis of C2C12 myotubes. C2C12 cells were allowed to differentiate in DMEM with 2% horse serum for 6 days. Then, the C2C12 myotubes were treated with ALA (0, 5, and 25 μM) for 48 h. The graph in panel A shows the total protein/genomic DNA ratio. Protein accumulation was normalized by genomic DNA content in myotubes. (B) The rates of protein synthesis were determined with the SUnSET technique. Each sample was added to 10 μg/mL of puromycin in a culture medium at 30 min of each treatment. Puromycin was analyzed by Western blot. (C) Protein turnover related gene expression was measured by qPCR. (D) For Western blot analysis, equal amounts of protein (20 μg) were loaded into each lane with separation on 10% sodium dodecyl sulfate (SDS)−polyacrylamide gel electrophoresis gels. Total protein was immunoblotted with MHCΠ, S6, 4E-BP1, and eIF2α. β-Actin was utilized as a housekeeping gene control. (E) Cells were immunostained with MHCII antibody, and the nuclei were revealed with DAPI staining. Immunofluorescence analysis showed morphological changes in MyHC-positive myotubes after ALA treatment. Scale bar = 100 μm. Each experiment was performed three times, with six repetitions each time. Data are presented as the mean ± SEM. Different letters represent significant differences between groups, and ∗ represents P < 0.05 compared with the control.

puromycin in the C2C12 myotubes (Figure 1A,B). Furthermore, ALA increased MHC Π expression (Figure 1C−E) and p-S6 and decreased p-eIF2α (Figure 1D), which means ALA promotes protein translation. Activating transcription factor forkhead (FoxO1) increased MAFbx/MuRF1 expression and activated the ubiquitin-proteasome pathway, eventually causing muscle atrophy. However, ALA still increased the mRNA expression of MAFbx (Figure 1C), which plays an important role during protein degradation. Acute Effects of α-Lipoic Acid on Protein Synthesis in Mouse Skeletal Muscle. ALA (50 mg/kg) was intraperitoneally administered, and the mice were decapitated 3 h after administration. These in vivo data confirm that ALA significantly increased the phosphorylation of FoxO1, Akt, mTOR, S6, and MHC Π expression (Figure 2A) and decreased the phosphorylation of eIF2α and AMPK (Figure 2A) in mice gastrocnemius. 4E-BP1 was not altered in the ALA-treated mouse gastrocnemius (Figure 2A). However, ALA significantly

increased the mRNA expression of MHC-IIb and decreased that of MAFbx (Figure 2B). Potential Signaling Pathway Involves α-Lipoic Acid Induced Protein Synthesis. Akt/mTOR and AMPK, which sense extracellular growth factor and intracellular energy status, respectively, are two key signaling pathways for protein synthesis. The results showed that the activities of Akt and mTOR were significantly enhanced by 4 h of ALA treatment. After 8 h, the pmTOR level remained higher than that of the control, whereas pAMPK/AMPK decreased. In addition, p-eIF2α was reduced in response to 4 h of ALA treatment (Figure 3), which means the initiation of protein translation is transiently activated by ALA. α-Lipoic Acid Regulates the Protein Synthesis of C2C12 Myotubes via the mTOR Signaling Pathway. To identify the role of mTOR in ALA-induced protein synthesis, we utilized the specific mTOR inhibitor (rapamycin, 500 nM) cotreated with 25 μM ALA for 48 h. The results demonstrate that rapamycin significantly inhibited cellular protein content (Figure 4A) and the incorporation of puromycin in the C2C12 myotubes 1722

DOI: 10.1021/acs.jafc.5b05952 J. Agric. Food Chem. 2016, 64, 1720−1729

Article

Journal of Agricultural and Food Chemistry

Figure 2. ALA regulated protein expression in skeletal muscle. Mice were intraperitoneally administered 50 mg/kg ALA for 3 h. (A) For Western blot analysis, equal proteins from the muscle homogenates of ALA-treated mice were immunoblotted with Akt, mTOR, Akt, FoxO1, S6, and eIF2α. (B) Protein turnover-related gene expression was measured by qPCR. β-Actin was utilized as a housekeeping gene control. Each experiment was performed three times, with six repetitions each time. Data are presented as the mean ± SEM. ∗ represents P < 0.05 compared with the control.

Figure 3. Identification of potential signaling pathway in C2C12 myotubes in response to ALA. C2C12 myotubes were treated with 25 μM ALA. Total cell extracts at the indicated hours (1, 2, 4, and 8 h) were analyzed through Western blot. β-Actin was utilized as a housekeeping gene control. Each experiment was performed three times, with six repetitions each time. Data are presented as the mean ± SEM; ∗ represents P < 0.05 compared with the control.

Effects of α-Lipoic Acid on Protein Synthesis Are Independent of the AMPK Signaling Pathway. To reveal the role of AMPK in ALA-induced protein synthesis, the C2C12 myotubes were cotreated with 25 μM ALA and AICAR (0.5 mM, AMPK agonist) for 48 h. The results show that the p-AMPK level

(Figure 4B). Moreover, rapamycin abolished the effect of ALA on the activation of mTOR, p70S6K, and S6. However, 4E-BP1 phosphorylation was altered neither by ALA nor by rapamycin (Figure 4C). 1723

DOI: 10.1021/acs.jafc.5b05952 J. Agric. Food Chem. 2016, 64, 1720−1729

Article

Journal of Agricultural and Food Chemistry

Figure 4. mTOR inhibitor blocked the effects of ALA on protein synthesis in C2C12 myotubes. At the end of C2C12 myotube differentiation, mTOR inhibitor rapamycin (500 nM) was used alone or cotreated with ALA (25 μM) for 48 h. Panel A shows the effects of rapamycin (500 nM) on the total protein/genomic DNA ratio by ALA. (B) Protein synthesis was determined with the SUnSET technique. Each sample was added to 10 μg/mL of puromycin in the culture medium at 30 min of each treatment. Puromycin was analyzed by Western blot. (C) For Western blot analysis, total protein was immunoblotted with mTOR, S6K1, and S6. β-Actin was utilized as a housekeeping gene control. Each experiment was conducted three times, with six repetitions each time. Data are presented as the mean ± SEM; ∗ represents P < 0.05 compared with the control.

Figure 5. AMPK activation was unable to block the effects of ALA on protein synthesis in C2C12 myotubes. At the end of C2C12 myotube differentiation, AMPK agonist AICAR (0.5 mM) was used alone or cotreated with ALA (25 μM) for 48 h. Panel A shows the effects of AICAR (0.5 mM) on the total protein/genomic DNA ratio by α-lipoic acid. (B) For Western blot analysis, total protein was immunoblotted with AMPK, mTOR, and S6. β-Actin was utilized as a housekeeping gene control. Each experiment was performed three times, with six repetitions each time. Data are presented as the mean ± SEM; ∗ represents P < 0.05 compared with the control, and # represents P < 0.05 compared with AICAR.

is a crucial upstream molecular to active mTOR. To determine the role of the Akt pathway in ALA-induced protein synthesis, the C2C12 myotubes were cotreated with 25 μM ALA and LY294002 (5 μM, PI3K inhibitor) for 48 h. LY294002 almost completely eliminated the increase in total protein content (Figure 6A) and puromycin incorporation in the C2C12 myotubes by ALA (Figure 6B). In addition, LY294002 completely blocked the effects of ALA on the activation of Akt, mTOR, and p70S6K phosphorylation (Figure 6C), which

was decreased by ALA and can be reversed to the basal level by the AMPK agonist (AICAR, 0.5 mM) (Figure 5B). However, AICAR in the ALA treated group failed to block the effects of ALA on protein content (Figure 5A) and the activation of mTOR and S6 (Figure 5B). These findings suggest that the effect of ALA on protein synthesis is independent of the AMPK signaling pathway in C2C12 myotubes. α-Lipoic Acid Promotes C2C12 Myotube Protein Synthesis via the Akt Signaling Pathway. The PI3K/Akt 1724

DOI: 10.1021/acs.jafc.5b05952 J. Agric. Food Chem. 2016, 64, 1720−1729

Article

Journal of Agricultural and Food Chemistry

Figure 6. PI3K/Akt inhibitor effectively abolished the effects of ALA on protein synthesis in C2C12 myotubes. At the end of C2C12 myotube differentiation, PI3K/Akt inhibitor LY294002 (5 μM) was used alone or cotreated with ALA (25 μM) for 48 h. Panel A shows the effects of LY294002 (5 μM) on the total protein/genomic DNA ratio by ALA. (B) Protein synthesis was determined with the SUnSET technique. Each sample was added to 10 μg/mL of puromycin in the culture medium at 30 min of each treatment. Puromycin was analyzed by Western blot. (C) For Western blot analysis, total protein was immunoblotted with Akt, mTOR, S6K1, and S6. β-Actin was utilized as a housekeeping gene control. Each experiment was performed three times, with six repetitions each time. Data are presented as the mean ± SEM; ∗ represents P < 0.05 compared with the control.

decreased Ikkα/β and JNK phosphorylations were reversed by TLR2 siRNA (Figure 8C). To explore the relationship between TLR and PI3K, we performed IP with an anti-MyD88 antibody and immunoblot. Equal amounts of total protein were mixed with a primary antibody and then incubated with protein-A and -G beads. The samples were analyzed by Western blot using antibodies against MyD88-Flag and PI3K. The results show that ALA enhanced the p85 subunit of PI3K binding to MyD88 (Figure 8D). These findings indicate that ALA induced protein synthesis and the PI3K/Akt signaling pathway activation was mediated by TLR2.

indicates that ALA induced the activation of mTOR and that protein synthesis was mediated by the PI3K/Akt signaling pathway. α-Lipoic Acid Attenuates the Inflammatory Pathways in C2C12 and Skeletal Muscles. Both Ikkβ and JNK are TLR downstream signaling pathways for inflammatory response. The C2C12 myotubes were exposed to ALA (25 μM) for 48 h. Cell lysate was used to Western blot. The results show that ALA decreased p-IRS, p-Ikkβ, and p-JNK (Figure 7A) and increased TLR2, MyD88, PTP1B, and SOCS3 expression (Figure 7B) in C2C12 myotubes. In mouse skeletal muscles, the in vivo data confirm that ALA decreased the phosphorylation of IRS and Ikkβ (Figure 7C), which means ALA reduced the inflammatory response in skeletal muscles. TLR2 Mediates the Effects of ALA on Protein Synthesis. To identify the role of TLR2 in ALA-induced protein synthesis, we knocked down TLR2 by three siRNAs in the C2C12 myotubes. The C2C12 myotubes were treated with 4 pmol of TLR2 siRNA or negative control siRNA and 2 μL of lipofectamine 2000 for 6 h. After differentiation for 6 days, cell lysate was harvested after treatment with ALA (25 μM) for 48 h. The samples were analyzed by Western blot or qPCR. The results show that, first, TLR2 siRNA decreased TLR2 mRNA expression by about 50% (Figure 8A). TLR2 siRNA almost completely eliminated the increase in total protein content and puromycin incorporation in C2C12 myotubes by ALA (Figure 8B). Second, TLR2 knock-down blocked the effects of ALA on the activation of Akt, mTOR, and S6 phosphorylation. The

■

DISCUSSION α-Lipoic acid (ALA) is recognized as a micronutrient that plays an important role in energy homeostasis12 and cell growth and apoptosis.13 However, the amount of lipoic acid present in dietary sources is very low. The basic human plasma levels of ALA and dihydrolipoic acid (DHLA) are 1−25 and 33−145 ng/ mL, respectively.12,20 The function of ALA in pharmacological dosage might differ from that in physiological dosage. For example, a low concentration of ALA (0.25 mmol/L) promotes cell proliferation, whereas a high concentration of ALA (1.0 mmol/L) inhibits cell proliferation dramatically.15 For skeletal muscle development, several previous studies have demonstrated that a high dose of ALA (approximately 1.0 mmol/L) can decrease muscle hypertrophy,21,22 increase fatty acid oxidation, and inhibit protein synthesis in C2C12 myotubes.23 We demonstrated that the physiological concentration range of α1725

DOI: 10.1021/acs.jafc.5b05952 J. Agric. Food Chem. 2016, 64, 1720−1729

Article

Journal of Agricultural and Food Chemistry

Figure 7. Effects of ALA on inflammatory pathways’ protein expression in C2C12 myotubes and skeletal muscles. (A) After C2C12 myotube treatment with ALA for 48 h, total protein was immunoblotted with IRS, Ikkβ, and JNK. (B) Protein turnover related gene expression was measured by real-time qRT-PCR in C2C12 myotubes. (C) Mice were intraperitoneally administered 50 mg/kg ALA for 3 h. Equal proteins from the muscle homogenates of LA-treated mice were analyzed by Western blot analysis for IRS, Ikkβ, and JNK proteins using their specific antibodies. β-Actin was used as a housekeeping gene control. Each experiment was performed three times, with six repetitions each time. Data are presented as the mean ± SEM; ∗ represents P < 0.05 compared with the control.

PI3K/Akt and AMPK signalings are the two main upstream pathways that regulate mTOR activity. AMPK activation directly affects translational initiation and protein synthesis through the mTOR signaling pathway in skeletal muscles.30 Many studies have shown that ALA affects the activation of AMPK.31,32 High concentrations of ALA can enhance cell metabolism (glucose tolerance, energy expenditure, etc.) by inhibiting the AMPK pathway.23 However, we found that activating the AMPK pathway by the specific agonist, AICAR, could not reverse the effect of ALA on total protein content and activation of mTOR signaling pathway in the C2C12 myotubes. Thus, the effects of physiological concentrations of ALA on protein synthesis might be mediated by other pathways. A number of studies have reported that activation of the PI3K/ Akt/mTOR signaling pathway is involved in regulating muscle hypertrophy and muscle atrophy.8,33 Activation of PI3K/Akt induces rapid skeletal muscle hypertrophy through the activation of the downstream mTOR pathway in vivo. 34 Recent investigations have reported that ALA improves the cardiac function by decreasing LPS-induced PI3K/Akt suppression.35 In

lipoic acids can increase protein synthesis in C2C12 myotubes. These data indicate that different concentrations of ALA may modulate protein turnover in skeletal muscles through different mechanisms. The mTOR signaling pathway plays an important role in regulating the rate of protein synthesis and subsequent hypertrophy.24,25 Several studies have shown that ALA can activate mTOR against apoptogenic and brain inflammatory factors in a neuronal model26 and reduce fat in obese rats.21 In the current study, ALA increased the activity of mTOR and its downstream targets, S6 and eIF2α, in C2C12 myotubes and skeletal muscles. However, 4E-BP1 phosphorylation was unaltered after ALA treatment. During protein synthesis, 4EBP1 phosphorylation reduced the competition with eIF4G for binding eIF4E to initiate mRNA translation27,28 and reduced eIF2α phosphorylation to catalyze the formation of 80S preinitiation complexes to increase protein translation.29 Our data suggest that ALA might also increase the initial complex formation by activating eIF2α. 1726

DOI: 10.1021/acs.jafc.5b05952 J. Agric. Food Chem. 2016, 64, 1720−1729

Article

Journal of Agricultural and Food Chemistry

Figure 8. TLR2 was involved in ALA-induced protein synthesis in C2C12 myotubes. C2C12 myotubes were transfected with vector or siTLR2 and lipofectamine 2000 for 6 h in transfection media. Subsequently, the C2C12 myotubes were differentiated for 6 days and then treated with 25 μM ALA for 48 h. Panel A shows TLR2 interference efficiency of verification. Gene expression was measured by real-time qRT-PCR. Panel B shows the effects of siTLR2 on the total protein/genomic DNA ratio and puromycin incorporation in C2C12 myotubes. Puromycin was analyzed by Western blot. (C) For Western blot analysis, total protein was immunoblotted with Ikkβ, JNK, Akt, mTOR, and S6. (D) C2C12 cells were transfected by lipofectamine 2000 (Invitrogen) with 5 μg of MyD88-flag plasmid for 6 h. Cell lysate was harvested after treatment with ALA (25 μM) for 48 h. Equal amounts of total protein were mixed with a primary antibody and then incubated with protein-A and -G beads. The resulting immunoprecipitation and input samples were analyzed by Western blot using antibodies against MyD88-Flag and PI3K. β-Actin was used as a housekeeping gene control. Each experiment was conducted three times, with six repetitions each time. Data are presented as the mean ± SEM; ∗ represents P < 0.05 compared with the control.

tion.18,39 Low-grade inflammation is closely related with insulin resistance and obesity.40 Several studies have shown that PTP1B and SOCS3 are two key proteins that mediate the effect of JNK and NF-κB pathways to suppress the activation of IRS and therefore decrease insulin sensitivity.41,42 However, our data indicate that ALA increased the mRNA expression of PTP1B and SOCS3 even though the phosphorylations of Ikkα/β and JNK were decreased. Generally, PTP1B and SOCS3 are activated in response to inflammation. However, several growth factors can also modulate the transcription of PTP1B and SOCS3. For example, leptin induces the JAK/STAT3 signaling pathway, which activates PTP1B and SOCS3 and therefore reduces the sensitivity of the leptin receptor.43,44 Many studies have recently reported that the Akt/mTORC1 and JAK/STAT pathways have

addition, ALA mediates its anti-apoptotic action via the activation of the insulin receptor/PI3-kinase/Akt pathway in rats.36 In this study, we found that ALA significantly increased the phosphorylation level of Akt. The PI3K/Akt inhibitor, LY294002, completely eliminated the effects of ALA on total protein content as well as on mTOR and S6 phosphorylation. These data show that the role of α-lipoic acid in skeletal muscle protein synthesis is dependent on the PI3K/Akt signaling pathway. ALA has also been reported as an important anti-inflammatory agent. NF-κB and c-jun N-terminal kinase (JNK) are two main downstream molecules of TLR that mediate inflammatory responses.37,38 ALA reduced inflammatory cytokine activation by suppressing NF-κB DNA binding activity and JNK activa1727

DOI: 10.1021/acs.jafc.5b05952 J. Agric. Food Chem. 2016, 64, 1720−1729

Article

Journal of Agricultural and Food Chemistry close crosstalk and directly affect each other.45,46 mTOR can activate STAT3 transcription and promote the expression of SOCS3 while inhibiting Ikk activity.47 Thus, ALA may increase the mRNA expression of PTP1B and SOCS3 through the Akt/ mTORC1 and JAK/STAT pathways. These data indicate that these two proteins may not be involved in ALA-induced inhibition of inflammation. Several other studies have also reported that TLR2 could recruit the p85 or p110 subunit of PI3K by regulating MAL or MyD88.48,49 We demonstrated the effects of ALA on inflammation (Ikkα/β and JNK). The insulin signaling pathways (Akt, mTOR, and S6) were fully abolished by TLR2 knock-down with siRNA. Our immunoprecipitation data also show that ALA treatment enhanced the binding of MyD88 and p85 PI3K. Altogether, our data reveal that the effects of ALA on PI3K/Akt signaling are mediated by the TLR2-associated inflammation pathway. Therefore, ALA increases protein synthesis in C2C12 myotubes through the TLR2/PI3K signaling pathway.

■

encoding elongation factors and ribosomal proteins. Proc. Natl. Acad. Sci. U. S. A. 1994, 91, 11477−11481. (10) Rhoads, R. E. Signal transduction pathways that regulate eukaryotic protein synthesis. J. Biol. Chem. 1999, 274, 30337−30340. (11) Packer, L.; Kraemer, K.; Rimbach, G. Molecular aspects of lipoic acid in the prevention of diabetes complications. Nutrition 2001, 17, 888−895. (12) Gorąca, A.; Huk-Kolega, H.; Piechota, A.; Kleniewska, P.; Ciejka, E.; Skibska, B. Lipoic acid − biological activity and therapeutic potential. Pharmacol. Rep. 2011, 63, 849−859. (13) Suzuki, Y. J.; Shi, S. S.; Day, R. M.; Blumberg, J. B. Differential regulation of MAP kinase signaling by pro- and antioxidant biothiols. Ann. N. Y. Acad. Sci. 2000, 899, 159−167. (14) Xie, R.; Li, X.; Ling, Y.; Shen, C.; Wu, X.; Xu, W.; Gao, X. Alphalipoic acid pre- and post-treatments provide protection against in vitro ischemia-reperfusion injury in cerebral endothelial cells via Akt/mTOR signaling. Brain Res. 2012, 1482, 81−90. (15) Lv, C.; Wu, C.; Zhou, Y. H.; Shao, Y.; Wang, G.; Wang, Q. Y. Alpha lipoic acid modulated high glucose-induced rat mesangial cell dysfunction via mTOR/p70S6K/4E-BP1 pathway. Int. J. Endocrinol. 2014, 10, 589−658. (16) Ko, H. S.; Lee, H. J.; Kim, S. H.; Lee, E. O. Piceatannol suppresses breast cancer cell invasion through the inhibition of MMP-9: involvement of PI3K/AKT and NF-kappaB pathways. J. Agric. Food Chem. 2012, 60, 4083−4089. (17) Shay, K. P.; Moreau, R. F.; Smith, E. J.; Smith, A. R.; Hagen, T. M. Alpha-lipoic acid as a dietary supplement: molecular mechanisms and therapeutic potential. Biochim. Biophys. Acta, Gen. Subj. 2009, 1790, 1149−1160. (18) Kim, H. S.; Kim, H. J.; Park, K. G.; Kim, Y. N.; Kwon, T. K.; Park, J. Y.; Lee, K. U.; Kim, J. G.; Lee, I. K. α-Lipoic acid inhibits matrix metalloproteinase-9 expression by inhibiting NF-κB transcriptional activity. Exp. Mol. Med. 2007, 39, 106−113. (19) Schmidt, E. K.; Clavarino, G.; Ceppi, M.; Pierre, P. SUnSET, a nonradioactive method to monitor protein synthesis. Nat. Methods 2009, 6, 275−277. (20) Breithaupt-Grögler, K.; Niebch, G.; Schneider, E.; Erb, K.; Hermann, R.; Blume, H. H.; Schug, B. S.; Belz, G. G. Doseproportionality of oral thioctic acid  coincidence of assessments via pooled plasma and individual data. Eur. J. Pharm. Sci. 1999, 8, 57−65. (21) Li, Z.; Dungan, C. M.; Carrier, B.; Rideout, T. C.; Williamson, D. L. Alpha-lipoic acid supplementation reduces mTORC1 signaling in skeletal muscle from high fat fed, obese Zucker rats. Lipids 2014, 49, 1193−1201. (22) Zou, J.; Gan, X.; Zhou, H.; Chen, X.; Guo, Y.; Chen, J.; Yang, X.; Lei, J. Alpha-lipoic acid attenuates cardiac hypertrophy via inhibition of C/EBPβ activation. Mol. Cell. Endocrinol. 2015, 399, 321−329. (23) Wang, Y.; Li, X.; Guo, Y.; Chan, L.; Guan, X. Alpha-Lipoic acid increases energy expenditure by enhancing adenosine monophosphateactivated protein kinase-peroxisome proliferator-activated receptorgamma coactivator-1alpha signaling in the skeletal muscle of aged mice. Metab., Clin. Exp. 2010, 59, 967−976. (24) Shioi, T.; McMullen, J. R.; Tarnavski, O.; Converso, K.; Sherwood, M. C.; Manning, W. J.; Izumo, S. Rapamycin attenuates load-induced cardiac hypertrophy in mice. Circulation 2003, 107, 1664− 1670. (25) Anthony, J. C.; Yoshizawa, F.; Anthony, T. G.; Vary, T. C.; Jefferson, L. S.; Kimball, S. R. Leucine stimulates translation initiation in skeletal muscle of postabsorptive rats via a rapamycin-sensitive pathway. J. Nutr. 2000, 130, 2013−2419. (26) Kamarudin, M. N.; Mohd Raflee, N. A.; Hussein, S. S.; Lo, J. Y.; Supriady, H.; Abdul Kadir, H. (R)-(+)-alpha-lipoic acid protected NG108-15 cells against H2O2-induced cell death through PI3K-Akt/ GSK-3beta pathway and suppression of NF-kappabeta-cytokines. Drug Des., Dev. Ther. 2014, 8, 1765−1780. (27) Gautsch, T. A.; Anthony, J. C.; Kimball, S. R.; Paul, G. L.; Layman, D. K.; Jefferson, L. S. Availability of eIF4E regulates skeletal muscle protein synthesis during recovery from exercise. Am. J. Physiol. 1988, 98, C407−C414.

AUTHOR INFORMATION

Corresponding Author

*(G.S.) Phone: +86 20 85284901. Fax: +86 20 85284901. Email: [email protected]. Author Contributions ∥

Y.J. and X.C. contributed equally to this work.

Funding

This study was supported by National Basic Research Program of China (2013CB127306 and 2012CB124701). Notes

The authors declare no competing financial interest.

■ ■

ACKNOWLEDGMENTS We are grateful to the principal investigator (Ruslan Medzhitov) at Addgene for providing plasmids. REFERENCES

(1) Lynch, G. S.; Schertzer, J. D.; Ryall, J. G. Therapeutic approaches for muscle wasting disorders. Pharmacol. Ther. 2007, 113, 461−487. (2) Saini, A.; Faulkner, S.; Al-Shanti, N.; Stewart, C. Powerful signals for weak muscles. Ageing Res. Rev. 2009, 8, 251−267. (3) Williams, J. P.; Phillips, B. E.; Smith, K.; Atherton, P. J.; Rankin, D.; Selby, A. L.; Liptrot, S.; Lund, J.; Larvin, M.; Rennie, M. J. Effect of tumor burden and subsequent surgical resection on skeletal muscle mass and protein turnover in colorectal cancer patients. Am. J. Clin. Nutr. 2012, 96, 1064−1070. (4) Phillips, S. M.; Glover, E. I.; Rennie, M. J. Alterations of protein turnover underlying disuse atrophy in human skeletal muscle. J. Appl. Physiol. 2009, 107, 645−654. (5) Frost, R. A.; Lang, C. H. Protein kinase B/Akt: a nexus of growth factor and cytokine signaling in determining muscle mass. J. Appl. Physiol. 2007, 103, 378−387. (6) Glass, D. J. Signalling pathways that mediate skeletal muscle hypertrophy and atrophy. Nat. Cell Biol. 2003, 5, 87−90. (7) Rommel, C.; Bodine, S. C.; Clarke, B. A.; Rossman, R.; Nunez, L.; Stitt, T. N.; Yancopoulos, G. D.; Glass, D. J. Mediation of IGF-1-induced skeletal myotube hypertrophy by PI(3)K/Akt/mTOR and PI(3)K/ Akt/GSK3 pathways. Nat. Cell Biol. 2001, 3, 1009−1013. (8) Bodine, S. C.; Stitt, T. N.; Gonzalez, M.; Kline, W. O.; Stover, G. L.; Bauerlein, R.; Zlotchenko, E.; Scrimgeour, A.; Lawrence, J. C.; Glass, D. J.; Yancopoulos, G. D. Akt/mTOR pathway is a crucial regulator of skeletal muscle hypertrophy and can prevent muscle atrophy in vivo. Nat. Cell Biol. 2001, 3, 1014−1019. (9) Terada, N.; Patel, H. R.; Takase, K.; Kohno, K.; Nairn, A. C.; Gelfand, E. W. Rapamycin selectively inhibits translation of mRNAs 1728

DOI: 10.1021/acs.jafc.5b05952 J. Agric. Food Chem. 2016, 64, 1720−1729

Article

Journal of Agricultural and Food Chemistry

anti-inflammatory signaling pathways in macrophages. J. Immunol. 2015, 194, 584−594. (48) Nguyen, T. T.; Kim, Y. M.; Kim, T. D.; Le, O. T.; Kim, J. J.; Kang, H. C.; Hasegawa, H.; Kanaho, Y.; Jou, I.; Lee, S. Y. Phosphatidylinositol 4-phosphate 5-kinase alpha facilitates Toll-like receptor 4-mediated microglial inflammation through regulation of the Toll/interleukin-1 receptor domain-containing adaptor protein (TIRAP) location. J. Biol. Chem. 2013, 288, 5645−5659. (49) Toubiana, J.; Rossi, A. L.; Belaidouni, N.; Grimaldi, D.; Pene, F.; Chafey, P.; Comba, B.; Camoin, L.; Bismuth, G.; Claessens, Y. E.; Mira, J. P.; Chiche, J. D. Src-family-tyrosine kinase Lyn is critical for TLR2mediated NF-kappaB activation through the PI 3-kinase signaling pathway. Innate Immun. 2015, 10, 685−697.

(28) Sikalidis, A. K.; Mazor, K. M.; Kang, M.; Liu, H.; Stipanuk, M. H. Total 4EBP1 is elevated in liver of rats in response to low sulfur amino acid intake. J. Amino Acids 2013, 10, 864757. (29) Gordon, B. S.; Kelleher, A. R.; Kimball, S. R. Regulation of muscle protein synthesis and the effects of catabolic states. Int. J. Biochem. Cell Biol. 2013, 45, 2147−2157. (30) Bolster, D. R.; Crozier, S. J.; Kimball, S. R.; Jefferson, L. S. AMPactivated protein kinase suppresses protein synthesis in rat skeletal muscle through down-regulated mammalian target of rapamycin (mTOR) signaling. J. Biol. Chem. 2002, 277, 23977−80. (31) Kim, H.; Park, M.; Lee, S. K.; Jeong, J.; Namkoong, K.; Cho, H. S.; Park, J. Y.; Lee, B. I.; Kim, E. Phosphorylation of hypothalamic AMPK on serine(485/491) related to sustained weight loss by alpha-lipoic acid in mice treated with olanzapine. Phys. Plasmas 2014, 231, 4059−4069. (32) Hahm, J. R.; Noh, H. S.; Ha, J. H.; Roh, G. S.; Kim, D. R. Alphalipoic acid attenuates adipocyte differentiation and lipid accumulation in 3T3-L1 cells via AMPK-dependent autophagy. Life Sci. 2014, 100, 125− 132. (33) Sasai, N.; Agata, N.; Inoue-Miyazu, M.; Kawakami, K.; Kobayashi, K.; Sokabe, M.; Hayakawa, K. Involvement of PI3K/Akt/TOR pathway in stretch-induced hypertrophy of myotubes. Muscle Nerve 2010, 41, 100−106. (34) Lai, K. M.; Gonzalez, M.; Poueymirou, W. T.; Kline, W. O.; Na, E.; Zlotchenko, E.; Stitt, T. N.; Economides, A. N.; Yancopoulos, G. D.; Glass, D. J. Conditional activation of akt in adult skeletal muscle induces rapid hypertrophy. Mol. Cell. Biochem. 2004, 24, 9295−9304. (35) Jiang, S.; Zhu, W.; Li, C.; Zhang, X.; Lu, T.; Ding, Z.; Cao, K.; Liu, L. alpha-Lipoic acid attenuates LPS-induced cardiac dysfunction through a PI3K/Akt-dependent mechanism. Int. Immunopharmacol. 2013, 16, 100−107. (36) Diesel, B.; Kulhanek-Heinze, S.; Höltje, M.; Brandt, B.; Höltje, H. D.; Vollmar, A. M.; Kiemer, A. K. Alpha-lipoic acid as a directly binding activator of the insulin receptor protection from hepatocyte apoptosis. Biochemistry 2007, 46, 2146−2155. (37) Brown, J.; Wang, H.; Hajishengallis, G. N.; Martin, M. TLRsignaling networks: an integration of adaptor molecules, kinases, and cross-talk. J. Dent. Res. 2011, 90, 417−427. (38) Lee, J. H.; Won, J. H.; Choi, J. M.; Cha, H. H.; Jang, Y. J.; Park, S.; Kim, H. G.; Kim, H. C.; Kim, D. K. Protective effect of ellagic acid on concanavalin A-induced hepatitis via toll-like receptor and mitogenactivated protein kinase/nuclear factor kappaB signaling pathways. J. Agric. Food Chem. 2014, 62, 10110−10117. (39) Byun, C. H.; Koh, J. M.; Kim, D. K.; Park, S. I.; Lee, K. U.; Kim, G. S. Alpha-lipoic acid inhibits TNF-alpha-induced apoptosis in human bone marrow stromal cells. J. Bone Miner. Res. 2005, 20, 1125−1135. (40) Pereira, S. S.; Alvarez-Leite, J. I. Low-grade inflammation, obesity, and diabetes. Curr. Obesity Rep. 2014, 3, 422−431. (41) MohammadTaghvaei, N.; Taheripak, G.; Taghikhani, M.; Meshkani, R. Palmitate-induced PTP1B expression is mediated by ceramide-JNK and nuclear factor kappaB (NF-kappaB) activation. Cell. Signalling 2012, 24, 1964−1970. (42) Chhabra, J. K.; Chattopadhyay, B.; Paul, B. N. SOCS3 dictates the transition of divergent time-phased events in granulocyte TNF-alpha signaling. Cell. Mol. Immunol. 2014, 11, 105−106. (43) Rui, D. L.; M, a. L. Recent advances in understanding leptin signaling and leptin resistance. Am. J. Physiol Endocrinol. Metab. 2009, 10, 1247−1259. (44) Sahu, A. Intracellular leptin-signaling pathways in hypothalamic neurons: the emerging role of phosphatidylinositol-3 kinase-phosphodiesterase-3B-cAMP pathway. Neuroendocrinology 2011, 93, 201−210. (45) Gray, G. K.; McFarland, B. C.; Nozell, S. E.; Benveniste, E. N. NFkappaB and STAT3 in glioblastoma: therapeutic targets coming of age. Expert Rev. Neurother. 2014, 14, 1293−1306. (46) Van Grol, J.; Subauste, C.; Andrade, R. M.; Fujinaga, K.; Nelson, J.; Subauste, C. S. HIV-1 inhibits autophagy in bystander macrophage/ monocytic cells through Src-Akt and STAT3. PLoS One 2010, 5, e11733. (47) Zhu, Y. P.; Brown, J. R.; Sag, D.; Zhang, L.; Suttles, J. Adenosine 5′-monophosphate-activated protein kinase regulates IL-10-mediated 1729

DOI: 10.1021/acs.jafc.5b05952 J. Agric. Food Chem. 2016, 64, 1720−1729