24(S)-Saringosterol from Edible Marine Seaweed Sargassum

Jun 13, 2014 - *(Hongbing Liu) Phone: +86-532-82032030. ... including key players in reverse cholesterol transport in six cell lines. ... Hien Minh Ng...
0 downloads 0 Views 1MB Size
Download PDF
Article pubs.acs.org/JAFC

24(S)‑Saringosterol from Edible Marine Seaweed Sargassum fusiforme Is a Novel Selective LXRβ Agonist Zhen Chen,†,∥ Jiao Liu,§,∥ Zhifei Fu,† Cheng Ye,§ Renshuai Zhang,† Yiyun Song,§ Ying Zhang,§ Haihua Li,† Hao Ying,*,§ and Hongbing Liu*,† †

Key Laboratory of Marine Drugs, Chinese Ministry of Education, Institute of Marine Food and Drugs, School of Medicine and Pharmacy, Ocean University of China, Qingdao 266003, China § Key Laboratory of Nutrition and Metabolism, Institute for Nutritional Sciences, Shanghai Institutes for Biological Sciences, Graduate School of the Chinese Academy of Sciences, Chinese Academy of Sciences, Shanghai 200031, China ABSTRACT: Dietary phytosterols have been successfully used for lowering cholesterol levels, which correlates with the fact that some phytosterols are able to act as liver X receptor (LXR) agonists. Sargassum fusiforme is an edible marine seaweed well-known for its antiatherosclerotic function in traditional Chinese medicine. In this study, seven phytosterols including fucosterol (1), saringosterol (2), 24-hydroperoxy-24-vinyl-cholesterol (3), 29-hydroperoxy-stigmasta-5,24(28)-dien-3β-ol (4), 24-methylenecholesterol (5), 24-keto-cholesterol (6), and 5α,8α-epidioxyergosta-6,22-dien-3β-ol (7) were purified and evaluated for their actions on LXR-mediated transcription using a reporter assay. Among these phytosterols, 2 was the most potent compound in stimulating the transcriptional activities of LXRα by (3.81 ± 0.15)-fold and LXRβ by (14.40 ± 1.10)-fold, respectively. Two epimers of 2, 24(S)-saringosterol (2a) and 24(R)-saringosterol (2b), were subsequently separated by semipreparative highperformance liquid chromatography. Interestingly, 2a was more potent than 2b in LXRβ-mediated transactivation ((3.50 ± 0.17)-fold vs (1.63 ± 0.12)-fold) compared with control. Consistently, 2a induced higher expression levels of LXR target genes including key players in reverse cholesterol transport in six cell lines. These data along with molecular modeling suggested that 2a acts as a selective LXRβ agonist and is a potent natural cholesterol-lowering agent. This study also demonstrated that phytosterols in S. f usiforme contributed to the well-known antiatherosclerotic function. KEYWORDS: Sargassum fusiforme, phytosterols, 24(S)-saringosterol, selective LXRβ agonist, cholesterol metabolism

■

INTRODUCTION Sargassum fusiforme (Harvey) Setchell, a member of the genus Sargassum of the Sargassaceae family, is a common edible marine seaweed in China, Japan, and Korea.1−4 In China, the seaweed is called “Chang Shou Cai”, which is translated to “antiaging vegetable” in English.1 S. f usiforme has also been widely used in traditional Chinese medicine (TCM) for thousands of years for treating atherosclerosis, hyperlipidemia, hypertension, thyroid diseases, and cancer.1,3,5 In addition, several other species in Sargassum (S. pallidum, S. thunbergii, S. muticum, S. horneri, S. siliquastrum, S. hemiphyllum, S. vachellianum) are used as TCM for treating cardiovascular disease (CVD).3 The active components and the underlying molecular mechanism of the antiatherosclerotic function of Sargassum have not been systematically investigated. Polysaccharides, fatty acids, phytosterols, phlorotannins, and meroterpenoids were the major components previously described in Sargassum.1,3 Recent studies on the antiatherosclerotic constituents of S. f usiforme were focused on polysaccharides and their derivatives, whereas investigations on nonpolar components such as phytosterols have not been done.6,7 It is well-known that phytosterols, such as β-sitosterol, campesterol, and stigmasterol from terrestrial plants, are able to reduce plasma low-density lipoprotein (LDL) cholesterol levels and have been shown to be safe for half a century.8−13 Phytosterols are abundant in Sargassum; however, the functions of its phytosterols are barely reported.1,3,5 © XXXX American Chemical Society

Phytosterols are structurally related to cholesterol. They cannot be synthesized by humans and, therefore, are always obtained from diet. β-Sitosterol, campesterol, and stigmasterol account for >95% of phytosterol dietary intake,9 and are known as “terrestrial lipid-rich food”. Dietary phytosterols decrease intestinal cholesterol absorption, resulting in a reduction of both LDL and total cholesterol concentrations in plasma.9 It has been shown recently that some phytosterols may regulate gene expressions in the cholesterol metabolism pathway through liver X receptor (LXR) activation.14,15 LXRs are ligand-dependent nuclear receptors that play critical roles in cholesterol homeostasis, inflammation, and lipogenesis. Their putative association with human diseases makes them promising pharmacological targets.16,17 Functioning as chief regulators of cholesterol homeostasis, LXRs, the sterol-responsive transcription factors, control cholesterol influx, transport, and efflux. Studies have shown that local activation of LXRs have beneficial effects on atherosclerosis.18 LXRs have two isoforms (LXRα and LXRβ) with distinct tissue distributions.17,19 It has been suggested that hepatic lipogenesis is mainly mediated through LXRα and that LXRβ mediates the antiatherogenic effects. Received: January 6, 2014 Revised: June 8, 2014 Accepted: June 13, 2014

A

dx.doi.org/10.1021/jf500083r | J. Agric. Food Chem. XXXX, XXX, XXX−XXX

Journal of Agricultural and Food Chemistry

Article

Figure 1. Marine phytosterols isolated and identified from Sargassum f usiforme. Three common terrestrial plant sterols are shown together.

Table 1. APCI-MS Data for Phytosterols 1−7

Endogenous LXR ligands are oxysterols.15,20 Phytosterols found in Sargassum possess similar structures.1,3,5 Could these analogues of oxysterols activate LXRs and be responsible for the observed antiatherosclerotic effects? Little evidence has

been afforded until now except for fucosterol, which inhibits cholesterol absorption in rats and activates LXRs.21 In the current study, seven phytosterols from S. f usiforme were purified and characterized by NMR and MS. These compounds B

dx.doi.org/10.1021/jf500083r | J. Agric. Food Chem. XXXX, XXX, XXX−XXX

Journal of Agricultural and Food Chemistry

Article

Table 2. 1H NMR (600 MHz, δ, J in Hz) Data for 1−4 in CDCl3 position 3 6 18 19 21 26 27 28 29

1 3.53 5.35 0.69 1.01 0.99 0.98 0.98 5.18 1.57

m d (5.2) s s d (7.0) d (6.8) d (6.8) q (6.8) d (6.6)

2 3.52 5.35 0.67 1.00

m m s s

0.87 d (7.0) 0.89 m 5.76−5.84 m 5.16−5.21 m 5.11−5.15 m

2a 3.521 5.347 0.668 1.001 0.915 0.868 0.895 5.793 5.181 5.129

2b

m br d s s d (6.5) d (7.0) d (6.9) dd (17.2, 10.9) d (17.2) dd (10.9, 1.2)

3

m br d s s d (6.3) d (6.8) d (6.7) dd (17.3, 10.8) d (17.3) dd (10.8, 1.2)

3.53 5.35 0.68 1.01 0.96 0.86 0.88 5.75 5.28 5.16

m br d (5.0) s s d (6.6) d (7.0) d (6.7) dd (17.4, 11.4) dd (11.4, 1.2) dd (18.0, 1.2)

4 3.53 5.36 0.68 1.01 0.99 1.03 1.03 5.31 4.55

m br d (3.5) s s d (6.4) d (6.9) d (6.9) t (7.1) d (7.02)

petroleum/acetone (20:1 to 8:1) to achieve five subfractions. Compounds 1 (119 mg), 2 (60 mg), and 3 (7.6 mg) were crystallized as colorless needles from subfractions 1, 3, and 4, respectively. Subfraction 2 was further purified by semipreparative HPLC (MeOH/ H2O, 85:15) to afford compound 7 (3 mg). Subfraction 5 was further purified by semipreparative HPLC with MeOH/H2O (85:15) to yield compounds 4 (4.1 mg), 5 (5 mg), and 6 (5.6 mg). The epimeric mixture 2 was separated into 2a (2.4 mg) and 2b (4.9 mg) by semipreparative HPLC (MeOH/acetonitrile/H2O, 95:1:4). Characterization of Purified Compounds. Fucosterol (1): colorless needles; APCI-MS data, see Table 1; 1H NMR data, see Table 2. Saringosterol (2): colorless needles; APCI-MS data, see Table 1; 1H NMR data, see Table 2. 24(S)-Saringosterol (2a): colorless needles; APCI-MS data, see Table 1; 1H NMR data, see Table 2. 24(R)-Saringosterol (2b): colorless needles; APCI-MS data, see Table 1; 1H NMR data, see Table 2. 24-Hydroperoxy-24-vinyl-cholesterol (3): colorless needles; APCIMS data, see Table 1; 1H NMR data, see Table 2. 29-Hydroperoxy-stigmasta-5,24(28)-dien-3β-ol (4): colorless needles; APCI-MS data, see Table 1; 1H NMR data, see Table 2. 24-Methylene-cholesterol (5): colorless needles; APCI-MS data, see Table 1; 1H NMR (600 MHz, CDCl3) δ 5.35 (1H, br d, J = 5.2 Hz, H6), 4.71 (1H, br s, H-28), 4.65 (1H, br s, H-28), 3.52 (1H, m, H-3), 1.02 (6H, d, J = 6.8 Hz, H-26 and H-27), 1.00 (3H, s, H-19), 0.95 (3H, d, J = 6.6 Hz, H-21), 0.68 (3H, s, H-18). 24-Keto-cholesterol (6): colorless needles; APCI-MS data, see Table 1; 1H NMR (600 MHz, CDCl3) δ 5.35 (1H, br d, J = 3.5 Hz, H6), 3.52 (1H, m, H-3), 2.61 (1H, m, H-25), 1.09 (6H, d, J = 6.9 Hz, H26 and H-27), 1.00 (3H, s, H-19), 0.91 (3H, d, J = 6.5 Hz, H-21), 0.67 (3H, s, H-18). 5α,8α-Epidioxyergosta-6,22-dien-3β-ol (7): APCI-MS data, see Table 1; 1H NMR (600 MHz, CDCl3) δ 6.51 (1H, d, J = 8.6 Hz, H-6), 6.25 (1H, d, J = 8.5 Hz, H-7), 5.22 (1H, dd, J = 15.2, 7.7 Hz, H22), 5.14 (1H, dd, J = 15.4, 8.6 Hz, H-23), 3.97 (3H, m, H-3), 1.00 (3H, d, J = 6.6 Hz, H-28), 0.88 (3H, s, H-19), 0.83 (3H, d, J = 6.8 Hz, H-27), 0.82 (3H, d, J = 6.7 Hz, H-26), 0.82 (3H, s, H-18). Cell Culture. HEK293T, THP-1, HepG2, and Caco-2 cells were from ATCC. HEK293T and HepG2 cells were maintained in DMEM containing 10% heat-inactivated FBS and 1% PES. THP-1 cells were maintained in RPMI-1640 medium supplemented with 10% FBS and 1% PES. THP-1 cells were differentiated in the presence of PMA (50 ng/mL) for 72 h prior to treatment and RNA extraction. Caco-2 cells were maintained in MEM supplemented with 20% FBS and 1% PES. All cell lines were grown in 5% CO2 at 37 °C. As for phytosterol treatment, cells were preincubated in a complete growth medium for 24 h and then were incubated for an additional 24 h in 2 mL of medium containing phytosterols (30 μM), T0901317 (20 μM), ethanol, or DMSO. Stock solutions of phytosterols were prepared in ethanol, whereas a stock solution of T0901317 (0.1 mM) was prepared in DMSO. Control cells were treated with the corresponding amount of ethanol (1%). Experiment was carried out in at least triplicate.

were then evaluated for their effects on LXR-mediated transactivation and target gene expression in six cell lines. Indeed, 24(S)-saringosterol, an analogue of oxysterols, acted as a selective LXRβ agonist. This study also demonstrated that phytosterols in S. f usiforme contributed to the well-known antiatherosclerotic function.

■

3.521 5.346 0.666 1.000 0.920 0.867 0.887 5.807 5.187 5.135

MATERIALS AND METHODS

Chemicals. Spectral grade solvents for spectroscopic measurements were obtained from Sigma-Aldrich. HPLC grade solvents were obtained from Merck Inc. (Merck KgaA, Darmstadt, Germany). All other solvents were of analytical grade (Yuwang Reagent Co., Shandong, China). Cell culture materials such as Dulbecco’s modified Eagle medium (DMEM), modified Eagle medium (MEM), fetal bovine serum (FBS), trypsin, glutamine, and penicillin/streptomycin (PES) were obtained from Gibco. Phorbol myristate acetate (PMA) and T0901317 were obtained from Sigma-Aldrich. Lipofectamine 2000 transfection reagent was obtained from Invitrogen. Dual-GloLuciferase Assay System was purchased from Promega. For RNA isolation, TRIzol reagent and MMLV reverse transcriptase were obtained from Invitrogen. Regular PCR was performed with the TaKaRa Taq Kit (Takara). Power SYBR Green PCR Master Mix was purchased from Applied Biosystems. General Experimental Procedures. NMR spectra were recorded on JEOL JNM-ECP 600 NMR spectrometers, using TMS as internal standard, and chemical shifts were recorded as δ values. APCI-MS analysis was performed on a Bruker amaZon SL mass spectrometer. High-performance liquid chromatography (HPLC) analysis was performed on an Agilent 1100 HPLC system coupled to a photodiode array detector with routine detection at 210 nm. The separation column (250 × 4.6 mm i.d., 5 μm) was prefilled with YMC ODS PackA, and a linear gradient of MeOH and H2O was used. Semipreparative HPLC was performed on a Shimadzu LC-6AD using a C-18 column (YMC ODS Pack-A, 250 × 10 mm i.d., 5 μm; flow rate = 4.0 mL/min, UV detection at 210 nm). Silica gel (100−200 and 200−300 mesh; Qingdao Haiyang Chemical Co., Ltd., Qingdao, China), Sephadex LH20 (GE Healthcare Bio-Sciences AB, Uppsala, Sweden) were used for column chromatography. Thin layer chromatography (TLC) silica gel GF254 plates (Yantai Zi Fu Chemical Co., Ltd., Yantai, China) were used for TLC analysis. Plant Material. Fronds of S. f usiforme (Harvey) Setchell were collected from the Dongtou area in Zhejiang Provinice, China, in May 2012. The original seaweed was identified by Dr. Tao Liu (College of Marine Life Science, Ocean University of China), and a voucher specimen has been deposited at the School of Medicine and Pharmacy, Ocean University of China. Isolation and Identification. Air-dried fronds of S. f usiforme (200 g) were powdered and repeatedly extracted with dichloromethane/ methanol (1:2) three times to give a crude extract (12.4 g), which was fractionated by vacuum liquid chromatography over silica gel by gradient elution using dichloromethane/methanol to yield six fractions. The fourth fraction (CH2Cl2/MeOH 98:2, 1450 mg) was subsequently separated over Sephadex LH-20 with CH2Cl2/MeOH (1:1) followed by flash silica gel column chromatography with light C

dx.doi.org/10.1021/jf500083r | J. Agric. Food Chem. XXXX, XXX, XXX−XXX

Journal of Agricultural and Food Chemistry

Article

Figure 2. Effects of different phytosterols on LXR transcriptional activity. Luciferase assay was performed to compare the effects of phytosterols 1-7 (a and b), 2a and 2b (c and d), on LXR-mediated transcription. HEK-293T cells were transfected with expression plasmids pGal4-LXRα-LBD (a and c) or pGal4-LXRβ-LBD (b and d), together with reporter plasmid pTATA-LUC. Twelve hours after transfection, the cells were exposed to phytosterols 1−7 (30 μM), 2a and 2b (10 μM), or ethanol for 12 h. Data represent the means ± SEM (n ≥ 3). (∗) P < 0.05, (∗∗) P < 0.01, and (∗∗∗) P < 0.001 versus control. with the Tripos force field. The crystal structure of LXRβ with 24,25epoxy-cholesterol (PDB ID 1P8D)23 as ligand was used for docking study. Before docking, ligand and waters in the complex were removed, and the protein structure was standardized with the protein preparation processes in SYBYL-X.

Transfection and Luciferase Assay. A dual-luciferase reporter assay system was utilized to examine the effect of phytosterols on the transactivation of LXRα/β. The vectors used in luciferase assays in the Gal4-LXR system include pGal4-LXRα/β-LBD (LBD, ligand-binding domain; amino acids 137−102 for LXRα and amino acids 209−468 for LXRβ, respectively), pTATA-LUC containing UAS element, and pRL-TK as control. A modified assay method was used in this study.22 Briefly, HEK293T cells (1 × 105/mL) were plated in 48-well culture plates and then incubated in DMEM containing 10% FBS without antibiotics. After 24 h, cells were cotransfected with 0.075 μg/well of plasmid below: 0.05 μg of pTATA-luc, 0.005 μg of pRL-TK, and 0.02 μg of either pGal4-LXRα-LBD or pGal4-LXRβ-LBD, using Lipofectamine 2000 transfection reagent. Cells were cultured for 24 h posttransfection and then treated with phytosterols, T0901317, ethanol, or DMSO for an additional 12 h. After that, cells were lysed in 1× passive lysis buffer. The supernatant was assayed for Firefly luciferase activity and Renilla luciferase activity. Values were reported as relative Firefly luciferase to Renilla luciferase activity. Quantitative RT-PCR. Total RNA was extracted with TRIzol reagent from THP-1, Caco-2, RAW264.7, HEK293T, and HepG2 cells, after treatment for 24 h with T0901317 and phytosterol or vehicle. After reverse transcription by M-MLV reverse transcriptase, regular PCR was performed with the TaKaRa Taq Kit. Quantitative real-time PCR was conducted with an ABI Prism 7500 sequence detection system, using Power SYBR Green PCR Master Mix according to the manufacturer’s recommendations. Expression levels were normalized to those of glyceraldehyde 3-phosphate dehydrogenase or β-actin by the normalized expression (CT) method, according to the manufacturer’s guidelines. The oligonucleotide primers for each target gene examined are as follows: h-ABCA1-F, ACCCACCCTATGAACAACATGA; h-ABCA1-R, GAGTCGGGTAACGGAAACAGG; h-ABCG1-F, ATTCAGGGACCTTTCCTATTCGG; hABCG1-R, CTCACCACTATTGAACTTCCCG; h-SREBF1-F, ACAGTGACTTCCCTGGCCTAT; h-SREBF1-R, GCATGGACGGGTACATCTTCAA. Statistical Analysis. GraphPad Prism 5.0 was used for statistical analysis. All data are presented as the mean ± standard error of the mean (SEM). Statistical analysis was conducted using an unpaired two-tailed t test. P < 0.05 was considered to be statistically significant. Molecular Modeling. Molecular docking analysis and visualization including other related work were performed with SYBYL-X 2.0 (Tripos Inc., St. Louis, MO, USA) running on Microsoft Windows 7. All of the ligand structures were drawn using the sketch tool in SYBYL-X with the default parameters. Then Gasteiger−Huckel charges were calculated and their geometric conformations minimized

■

RESULTS Identification of Compounds. Phytosterols were isolated from the extract of S. f usiforme. On the basis of spectroscopic methods combined with comparison with the data of authentic compounds, they were identified as fucosterol (1), 24 saringosterol (2, as 1:1 mixture of epimers),24 24-hydroperoxy-24-vinyl-cholesterol (3),25 29-hydroperoxy-stigmasta5,24(28)-dien-3β-ol (4),25 24-methylene-cholesterol (5),25 24keto-cholesterol (6),26 and 5α,8α-epidioxyergosta-6,22-dien3β-ol (7).27 Further separation of 2 offered 24(S)-saringosterol (2a)28 and 24(R)-saringosterol (2b)28 (Figure 1). Compounds 5−7 were isolated from S. f usiforme for the first time. Effects of Compounds 1−7 on LXR Transcriptional Activity. Dual-luciferase reporter assay was utilized to investigate the effects of compounds 1−7 on LXR-mediated transcription. Consistent with a recent report by Dr. Hoang,29 fucosterol (1) increased the transactional activity of both LXRα and LXRβ. Saringosterol (2) showed the strongest ability to activate LXRs compared with other active compounds 1, 4, and 6, whereas 3, 5, and 7 exhibited little effects (Figure 2A). Our data demonstrated that various oxidized phytosterols had different abilities to activate LXRs, which was in agreement with the review on oxidized phytosterols by Hovenkamp.20 Saringosterol (2) at 30 μM increased the transcriptional activity of LXRα by (3.81 ± 0.15)-fold and that of LXRβ by (14.40 ± 1.10)-fold, indicating that 2 had a selective effect. Because 2 was a mixture of stereoisomers, 24(S)-saringosterol (2a) and 24(R)-saringosterol (2b) were separated and tested individually to clarify the influence of the orientation of 24-OH group on the LXR activation. With regard to the transcriptional activity of LXRα and LXRβ, 2a was more potent than 2b for LXRβ-mediated transactivation ((3.50 ± 0.17)-fold vs (1.63 ± 0.12)-fold) at 10 μM (Figure 2B). These results hinted that 2a was a stronger LXR agonist than 2b. D

dx.doi.org/10.1021/jf500083r | J. Agric. Food Chem. XXXX, XXX, XXX−XXX

Journal of Agricultural and Food Chemistry

Article

Figure 3. Effects of saringosterol (2) on LXR target genes expression in multiple cell types. The HEK293T (A), HepG2 (B), THP-1 monocytes (C), THP-1-derived macrophages (D), RAW264.7 (E), and intestinal Caco-2 (F) cells were cultured and then treated with 2 (30 μM), T0901317 (20 μM), or vehicle (DMSO, or ethanol) for 12 h. Total RNA was extracted and mRNA expression of ABCA1, ABCG1, and SREBP-1c was measured by qPCR. Data represent the means ± SEM (n ≥ 3). (∗) P < 0.05, (∗∗) P < 0.01, and (∗∗∗) P < 0.001 versus control.

Figure 4. Induction of LXR-responsive genes by saringosterol isomers 2a and 2b in multiple cell types. The HEK293T (A), HepG2 (B), THP-1 monocytes (C), RAW264.7 (E), and intestinal Caco-2 (E) cells were treated with 2a and 2b (10 μM) or vehicle (ethanol) for 12 h. Total RNA was extracted, and mRNA expression of ABCA1, ABCG1, and SREBP-1c was measured by qPCR. Data represent the means ± SEM (n ≥ 3). (∗) P < 0.05, (∗∗) P < 0.01, and (∗∗∗) P < 0.001 versus control.

Effects of 2, 2a, and 2b on LXR Target Gene Expression in Multiple Cells Types. The regulation of

LXR target genes by the epimer mixture 2 in different cell lines was examined subsequently. The LXR target gene expression in E

dx.doi.org/10.1021/jf500083r | J. Agric. Food Chem. XXXX, XXX, XXX−XXX

Journal of Agricultural and Food Chemistry

Article

(Figure 5). These results clearly indicated that 2a was a selective agonist for LXRβ. A molecular docking approach was used to explore the interaction modes between the compounds and LXRβ. After an energy minimization process, the lowest energy conformations of 2a and 2b were obtained, respectively (Figure 6). Both of the side chains of 2a and 2b were buried into the pocket, and the steroid nuclei were pushed outward. For 2a, with a relatively higher docking scores, the hydroxyl group in C-3 position formed three hydrogen bonds with amino acid residues ARG319 and PHE329, which granted 2a the binding affinity with LXRβ. The equivalent hydroxyl group of 2b formed only one hydrogen bond with amino acid residue GLU281. We inferred that the different docking modes of 2a and 2b were caused by the conformational difference in steroid nuclei Aring, which showed an obvious difference after energy minimization. This result suggested that specific chirality is required in forming hydrogen bond indirectly. This observation agreed with the result of the luciferase assay and likely explained why 2a showed better agonist activity than 2b.

HEK293T cells was examined with real-time qRT-PCR. The mRNA expressions of two LXR target genes, ATP-binding cassette family transporter A1 (ABCA1) and ATP-binding cassette family transporter G1 (ABCG1),17 were significantly increased by treatment with 2 (Figure 3A) as expected. The effects of 2 in HepG2 were also tested. The epimeric mixture 2 increased mRNA expression of ABCG1 and another LXR target gene, sterol regulatory element-binding protein-1c (SREBP-1c) (Figure 3B). In addition, 2 significantly enhanced the mRNA expression of ABCA1 and ABCG1 in THP-1 monocytes (Figure 3C), THP-1 derived macrophages (Figure 3D), RAW264.7 macrophages (Figure 3E), and Caco-2 cells (Figure 3F). Increased expression of SREBP-1c by 2 in THP-1, RAW264.7, Caco-2, and HepG2 cells was very limited compared to that of ABCA1 and ABCG1, but the increase was statistically significant (Figure 3B−F). The abilities of compounds 2a and 2b to modulate LXR target gene expression in various cell lines were then compared. Consistent with the results obtained from luciferase assay, the induction fold of ABCA1 and ABCG1 by 2a was greater than that of 2b in HEK-293T cells (Figure 4A). Similarly, 2a increased the mRNA expression of ABCG1 and SREBP-1c in HepG2 cells (Figure 4B). In agreement with the finding in luciferase assay, the mRNA expression of ABCA1 and ABCG1 was more sensitive to 2a treatment as compared with 2b in THP-1 monocytes and RAW264.7 macrophages (Figure 4C,D). A similar result was obtained in intestinal Caco-2 cells (Figure 4E). Consistent with the activity of 2, the induction of SREBP-1c by 2a was relatively small (Figure 4B−E). Thus, 24(S)-saringosterol (2a) was the major active component to stimulate LXR target gene expression. 24(S)-Saringosterol Acting As a Selective LXRβ Agonist. Highest induction by the epimer mixture 2 was observed in the presence of LXRβ (Figure 2A). This observation prompted us to test whether 24(S)-saringosterol (2a) was a selective LXRβ agonist. To this end, dual luciferase assay using different doses of 2a was performed. As shown in Figure 5, when the highest concentration of 2a (40 μM) was

■

DISCUSSION Phytosterols purified from S. f usiforme had more oxygencontaining groups than terrestrial plant phytosterols, especially on their side chain (Figure 1). Thus, marine phytosterols resembled the oxysterols, which are native LXR ligands, more than terrestrial plant phytosterols did. On the basis of this structural characteristic, we hypothesized that the marine phytosterols from Sargassum might be an excellent source for novel LXR agonist screening. As expected, phytosterols 2, 4, and 6 acted as LXR agonists, which could be correlated with their oxysterol-like structures, with 3 as an exception. Meanwhile, a peroxide bridge in steroid nucleus, such as in compound 7, did not contribute to their effect on LXRmediated transcription activation. Most importantly, our results indicated that 24(S)-saringosterol might be a selective LXRβ agonist. Specific chiral configuration of C-24 position was a pivotal factor responsible for the activity, which was also supported by the molecular docking results. Further research is needed on the structure−activity relationship of Sargassum phytosterols, including natural or their synthetic analogues. LXRα is highly expressed in the liver, adrenal gland, intestine, adipose tissue, macrophages, lung, and kidney, whereas LXRβ is ubiquitously expressed.29 LXR agonists stimulate reverse cholesterol transport and cholesterol excretion in the bile, but they can also activate lipogenesis at the same time. Lipogenesis could lead to hypertriglyceridemia and liver steatosis, which casts a shadow on the development of drugs based on LXR agonists.30−32 Some studies have shown that it is the highly specific expression of LXRα in liver that causes hypertriglyceridemia.29,31 Hence, selective LXRβ activation could be a promising treatment for hypercholesteremia without side effects. Because natural selective LXRβ agonists are rare, LXRαnull animals were usually used to test nonselective LXRs agonists on LXRβ activation.30,33 Thus, 24(S)-saringosterol would be a valuable agent to test if selective LXRβ activation could be a promising way to treat hypercholesteremia. ABCA1 and ABCG1 play important roles in atherosclerosis. Recent studies demonstrated that in humans, ABCA1 mutations can cause a severe HDL deficiency syndrome characterized by cholesterol deposition in tissue macrophages and prevalent atherosclerosis.34 Similarly, ABCG1 has also been shown to have antiatherosclerotic activity in mice.35 Here, our

Figure 5. 24(S)-Saringosterol (2a) acts as a selective LXRβ agonist. Luciferase assay were performed to compare the effect of compound 2a on LXRα- and LXRβ-mediated transcription. Compound 2a at different concentrations was used as indicated.

used, the LXRβ-mediated transactivation increased 5-fold, whereas a