A Collagen-Binding Mimetic of Neural Cell Adhesion Molecule

Bioconjugate Chem. 2008, 19, 1119–1123

1119

A Collagen-Binding Mimetic of Neural Cell Adhesion Molecule Hiroko Miyazaki,† Koichi Kato,† Yuji Teramura,‡ and Hiroo Iwata*,† Department of Reparative Materials, Institute for Frontier Medical Sciences and Department of Polymer Chemistry, Graduate School of Engineering, Kyoto University, Kyoto, Japan. Received December 18, 2007; Revised Manuscript Received April 13, 2008

A chimeric protein consisting of a cell-adhesive peptide derived from a neural cell adhesion molecule and a collagen-binding domain was synthesized using recombinant DNA technology. Here, we demonstrate that the chimeric protein binds to type I collagen and promotes the adhesion and neurite extension of hippocampus neurons. These results suggest that the chimeric protein has potential to provide microenvironments for neurons to adhere and survive in collagen-based matrices for use in cell-based therapies for central nervous disorders.

INTRODUCTION Stem cell-based therapy is recognized as a potential therapeutic strategy for neurodegenerative diseases (1, 2). However, the low level of cell survival following transplantation is the major problem associated with current techniques (3). Cell death after transplantation is attributed in part to anoikis-induced apoptosis caused by the destruction of cell-substrate and cell-cell interactions upon cell preparation (4). Other factors include inflammatory reactions caused by activated microglia infiltrating into injection sites (5). To overcome these adverse effects, we are involved in the development of collagen-based biodegradable matrices that act as temporal barriers against the infiltration of inflammatory cells and, at the same time, initially provide substrates for neuronal cell adhesion mediated by cell adhesion molecules. To date, several research groups utilized collagen matrices (6–9) to provide favorable microenvironments for the proliferation and controlled differentiation of neural stem/progenitor cells. However, current technologies have simply used collagen matrices as physical carriers without expectation for adhesion signaling in neural cells. Our approach is to design collagen matrices containing a peptide sequence that facilitates neural cell adhesion molecule (NCAM)-mediated signaling in neurons. To efficiently incorporate the peptide into the collagen matrix, a chimeric protein consisting of a NCAM-related peptide and the A3 domain of the von Willebrand factor (vWF) was synthesized by means of recombinant DNA technology. Since the vWF A3 domain has an affinity for type I collagen (10), the chimeric protein is expected to specifically bind to collagen matrices, displaying the peptide toward neurons. As a NCAM-related peptide, we chose a 12 amino acid residue peptide (GRILARGEINFK), termed P2, derived from NCAM (11–13). NCAM is abundantly expressed on neurons and their progenitors, and plays a pivotal role in neuronal development, synaptic plasticity, and regeneration (14, 15). NCAM belongs to the immunoglobulin (Ig) superfamily, and its extracellular domain is composed of N-terminal five Ig-like modules with two consecutive fibronectin type III modules. The * Corresponding author. Hiroo Iwata, Department of Reparative Materials, Institute for Frontier Medical Sciences, Kyoto University, 53 Kawahara-cho, Shogoin, Sakyo-ku, Kyoto 606-8507, Japan; Phone +81-75-751-4119; Fax +81-75-751-4646; E-mail [email protected]. † Institute for Frontier Medical Sciences. ‡ Graduate School of Engineering.

double-reciprocal, homophilic interactions of NCAMs activate intracellular signaling pathways in neurons, leading to neurite outgrowth. The P2 peptide sequence contained in the second Ig (IgII) module was identified as a binding site for the first Ig (IgI) module and interestingly shown to act as an agonist for NCAM, promoting neuronal differentiation and survival (11–13). In this communication, we describe the preparation and characterization of a chimeric protein that consists of the P2 peptide and the collagen-binding A3 domain of vWF (P2vWFCBD). The affinity of P2-vWFCBD to type I collagen was studied by surface plasmon resonance (SPR) analysis. The feasibility of P2-vWFCBD for the promotion of neuronal adhesion and its outgrowth on collagen was examined using the primary culture of hippocampus neurons.

EXPERIMENTAL PROCEDURES Chimeric Gene Construct. The cDNA (cDNA) encoding the human vWF A3 domain [189 amino acids (aa)] (10) was generated by polymerase chain reaction (PCR) using human pancreas cDNA library as a template. The PCR primers were designed to introduce an EcoR I restriction site at the 5′ end (CGAATTCGACTGCAGCCAGCCCCTGGAC) and an Xho I restriction site at the 3′ end (for P2-containing protein: GCTCGAGCTTGAAGTTGATTTCCCCGCGGGCCAGGATCCTGCCAGAGCACAGTTTGTGGAGGAAGG; for control protein: GCTCGAGAGAGCACAGTTTGTGGAGGAAGG). The underlined sequences encode P2 peptide. The chimeric cDNA was digested with EcoR I and Xho I and ligated to pET32a (Novagen) that had been linearized by digestion with the same enzymes. As shown in Figure 1, the EcoR I-Xho I site in pET32a was located downstream of hydrophilic thioredoxin tag (Trx-tag; 105 aa), N-terminal hexahistidine tag (Histag), and S-peptide tag (S-tag; 15 aa); and upstream of C-terminal His-tag. A thrombin cleavage site (LVPAGS) was inserted between the N-terminal His-tag and S-tag. The plasmids, pET32-P2-vWFCBD and pET32-vWFCBD, were amplified in E. coli strain DH5R. The correctness of the plasmids was verified by sequencing. Protein Expression and Purification. E. coli strain BL21(DE3)pLysS (Novagen) was transformed with pET32-P2vWFCBD and pET32-vWFCBD. Chimeric and control proteins were expressed using the Overnight Express Autoinduction System (Novagen). Proteins expressed as soluble forms were purified over His Trap HP column (Amersham). The proteins were then digested with thrombin (50 unit per mg protein) to remove the Trx-tag and N-terminal His-tag followed by

10.1021/bc700470v CCC: $40.75  2008 American Chemical Society Published on Web 05/14/2008

1120 Bioconjugate Chem., Vol. 19, No. 6, 2008

Figure 1. (A) A construct for the expression of P2-vWFCBD. The construct of control vWFCBD had a similar structure but was deficient in the oligonucleotide sequence for P2. (B) Domain structure of P2vWFCBD and vWFCBD obtained by digesting the expressed proteins with thrombin.

purification using S-tag Purification Kit (Novagen). The purity and molecular size of the proteins were analyzed by sodium dodecylsulfate-polyacrylamide gel electrophoresis (SDSPAGE). Protein identity was assessed by Western blot using antibody against hexahistidine tag (Abcam Ltd., Cambridge, UK) and horseradish peroxidase-linked secondary antibody against mouse immunoglobulin G (GE Healthcare UK Ltd., Buckinghamshire, UK). SPR Analysis. The self-assembled monolayer of 11-mercaptoundecanoic acid was formed on the glass plate having a 49-nm-thick gold layer, as reported before (16). The glass plate was mounted to an SPR sensor equipped with a flow cell (16). The light reflectance was continuously monitored at a constant incident angle 0.5° smaller than the angle for the occurrence of SPR during the following procedures. Type I collagen (Sigma) was dissolved in 0.1 M acetic acid buffer (pH 4.6) to a

Communications

concentration of 0.1 mg/mL, and the solution was circulated to adsorb collagen onto the monolayer. After washing with acetic acid buffer and phosphate buffered saline (PBS), PBS containing 1 mg/mL bovine serum albumin (BSA; Sigma) was circulated to block the nonspecific adsorption of proteins. Then, the solution of P2-vWFCBD or vWFCBD in PBS (20 µg/mL) was circulated to bind these proteins to collagen. Finally, the light reflectance was converted to the resonance angular shift. All measurements were carried out at 37 °C. Circular Dichroism (CD) Spectroscopy. CD spectra of P2vWFCBD and vWFCBD were recorded using JASCO J-805 spectropolarimeter. P2-vWFCBD and vWFCBD were dissolved in Dulbecco’s PBS (pH 7.4) to a mean residue concentration of 757 and 930 µM, respectively. Spectra were acquired in a 0.5 cm path length cell at a response time of 0.5 s, a bandwidth of 1 nm, a scan speed of 100 nm/min, and 20 °C with an accumulation of eight scans. Cell Isolation. The hippocampus was isolated from fetus of Wistar rats (E18) and dissociated into single neurons by trypsin digestion (17). Animal experiments were conducted according to the guidelines of the Animal Experimentation Committee of the Institute. Neurons were suspended in Neurobasal medium (Gibco) containing 2% B27 supplement (Gibco), 100 U/mL penicillin, and 100 µg/mL streptomycin, and used immediately for cell culture assays. Cell Culture. A two-well culture slide coated with type I collagen (BioCoat, BD Biosciences) was blocked with BSA. Then, the solution of P2-vWFCBD and vWFCBD (3.0 µM) were added to the wells and incubated at 37 °C for 3 h to allow the binding of these proteins to collagen. After washing the slide with PBS, hippocampus neurons were seeded at a density of 10 000 cells/cm2 and incubated at 37 °C under 5% CO2 atmosphere. In some wells, a synthetic peptide GRILARGEINFK (Invitrogen) was added to a final concentration of 7.2 µM. After 3-day culture, cells were fixed with paraformaldehyde, and cell membranes were permeabilized with TritonX100. Then, cells were immunocytochemically stained using an

Figure 2. The result of (A) SDS-PAGE and (B) Western blot. (A) Proteins were electrophoresed in 12.5% polyacrylamide gel and visualized by Coomassie brilliant blue staining. (B) Proteins were blotted to PVDF membranes and probed using primary antibody against His-tag and horseradish peroxidase-linked secondary antibody against immunoglobulin G. Protein bands were visualized using Immunostaining HRP1000 (Konica Minolta MG, Tokyo, Japan). Arrows and arrowheads indicate bands for, respectively, vWFCBD-containing polypeptides and Trx-tag containing fragments. TM: thrombin.

Communications

Figure 3. Far-UV CD spectra of (solid line) P2-vWFCBD and (dashed line) vWFCBD at 20 °C. Mean residue molar ellipticity [θ] is shown as a function of wavelength.

antibody to class III β-tubulin (Covance, NJ) and a fluorescently labeled secondary antibody. Cells were observed with an Olympus IX71 fluorescent microscope. The number of adhered cells was determined on four different fluorescent images and averaged.

RESULTS Characterization of Proteins. As shown in Figure 2A, single bands were visualized by the SDS-PAGE analysis of proteins expressed in E. coli and purified by nickel chelate chromatography before thrombin digestion (Trx-P2-vWFCBD and TrxvWFCBD). These bands split into two bands 26-27 kDa and 13 kDa by thrombin digestion. The former bands correspond to P2-vWFCBD and vWFCBD, whereas the latter to the segments containing the Trx-tag and the N-terminal His-tag. Further purification using the S-tag resulted in single bands corresponding to P2-vWFCBD and vWFCBD. Molecular weights estimated from the mobility of these bands are 27 kDa for P2-vWFCBD and 26 kDa for vWFCBD, in accordance with those expected from amino acid compositions. Figure 2B shows the results of Western blotting performed for Trx-P2-vWFCBD and Trx-vWFCBD after digestion with thrombin. In both cases, two protein bands were visualized at the positions of 26-27 kDa and 13 kDa, similar to the results of SDS-PAGE for corresponding samples (Figure 2A). As shown in Figure 3, the CD spectra of P2-vWFCBD and vWFCBD are characteristic of R-helical and β-sheet secondary

Bioconjugate Chem., Vol. 19, No. 6, 2008 1121

structure with minima at 208 and 222 nm both for R-helix and at 216 nm for β-sheet, although signal-to-noise ratios are small due to the relatively low concentration of proteins. Binding to Collagen. The affinity of P2-vWFCBD and vWFCBD for collagen was studied by SPR analysis. As shown in Figure 4, the sensorgrams indicate the adsorption of collagen onto the carboxylic acid-terminated alkanethiol monolayer and also BSA to the surface with preadsorbed collagen. The subsequent circulation of P2-vWFCBD (Figure 4A) or vWFCBD (Figure 4B) resulted in the shift of the resonance angle, indicating the binding of these proteins. The presence of polypeptide segments containing the Trx-tag and N-terminal Histag (proteins before thrombin digestion) hindered the binding of these proteins to collagen, even though CD spectra for these proteins obviously exhibited R-helical and β-sheet secondary structure (data not shown). The surface density of P2-vWFCBD and vWFCBD was estimated to be approximately 0.1 µg/cm2 when adsorbed from 20 µg/mL solution, under the assumption that no replacement takes place with preadsorbed BSA and the unit angle shift corresponds to 0.5 µg/cm2 (18). It was found that SPR sensorgrams decayed with time in washout phases of collagen, BSA, and fusion proteins. The gradual decrease in the resonance angles may be attributed to the intermolecular association of collagen initiated in neutral buffer solution at 37 °C. This makes it impossible to precisely determine the affinity constants for the binding of P2-vWFCBD and vWFCBD with collagen. Adhesion of Neurons and Neurite Outgrowth. P2-vWFCBD and vWFCBD were bound to collagen-coated glass substrates. Hippocampus neurons were cultured on these surfaces for 3 days. It is obvious that cells adhered to and extended neurites on the collagen-coated surface with P2vWFCBD (Figure 5A). In marked contrast, a small number of neurons were adhered to the collagen with vWFCBD during the entire culture periods, with poor neurite outgrowth (Figure 5B). This result is similar to our observation on untreated collagen (data not shown). These results suggest that the surfacebound P2 peptide has promotive effects on the adhesion of neurons and neurite outgrowth. The addition of soluble P2 peptide to the medium resulted in the inhibition of cell adhesion and neurite outgrowth on the surface with P2-vWFCBD (Figure 5C), indicating that the promotive effects of P2-vWFCBD involve the interaction of surface-bound P2 peptide with cell surface NCAM. The removal of the Trx-tag and the N-terminal His-tag by thrombin digestion was crucial for the adhesion of neurons and neurite outgrowth (data not shown), presumably due to the effect that the bulky segments hindered the binding

Figure 4. Representative SPR sensorgram recorded for the sequential adsorption of collagen and BSA onto the glass surface with a self-assembled monolayer of COOH-terminated alkanethiol, and the subsequent binding of (A) P2-vWFCBD and (B) vWFCBD. Proteins and buffers circulated: (a) PBS (pH 7.4), (b) sodium acetate buffer (pH 4.6), (c) 0.1 mg/mL collagen in sodium acetate buffer (pH 4.6), (d) sodium acetate buffer (pH 4.6), (e) PBS (pH 7.4), (f) 1 mg/mL BSA in PBS (pH 7.4), (g) PBS (pH 7.4), (h) 20 µg/mL P2-vWFCBD or vWFCBD in PBS (pH 7.4), and (i) PBS (pH 7.4). Measurements were carried out at 37 °C.

1122 Bioconjugate Chem., Vol. 19, No. 6, 2008

Communications

Figure 6. The number of neurons adhered to the collagen-coated glass surface with P2-vWFCBD and vWFCBD. The data are also shown for cells cultured on collagen with P2-vWFCBD in the presence of soluble P2 peptide. Cell numbers were determined 3 day after seeding. Error bars represent standard error of the mean (n ) 4). *Statistically significant compared to the other two conditions (p < 0.05, Student’s t test).

Figure 5. Fluorescent microphotographs of hippocampus neurons cultured for 3 days on the collagen-coated glass surface with (A) P2vWFCBD and (B) vWFCBD. (C) Neurons were cultured on the collagen-coated surface with P2-vWFCBD in the presence of soluble P2 peptide. Cells were visualized by immunofluorescent staining using antibody against class III β-tubulin. Scale bar: 200 µm.

of vWFCBD to collagen and/or P2 to NCAM. Figure 6 shows the quantitative data obtained from the adhesion assay. It is seen that the number of adhered cells was much larger on the collagen-coated surface with P2-vWFCBD than on that with vWFCBD. In addition, soluble P2 significantly reduces the number of cells adhering to the collagen-coated surface with P2-vWFCBD.

DISCUSSION The incorporation of protein-based components or the related small peptides have potential for designing collagen-based biomaterials capable of directly regulating neuronal adhesion and neurite outgrowth. Our previous study (19) revealed that the vWFCBD-containing chimeric protein enables us to densely

display the functional fusion partner on collagen fibrils. This strategy based on specific molecular recognition is also adapted in the present study. The chimeric protein containing a terminal anchoring domain can be immobilized onto substrates in the proper orientation by simple procedures under physiological conditions (20). These features form a marked contrast to covalent immobilization achieved by chemical reactions. It was reported that the A3 domain of vWF has an affinity for type I collagen (10) with an association constant of the order of 108 M-1 (21). It was revealed from our SPR analysis that P2-vWFCBD and vWFCBD bind to collagen, suggesting the minor effect of additional sequences such as N-terminal S-tag and C-terminal His-tag. Furthermore, the binding is not affected by fusing the 12-aa residue P2 peptide at the C-terminus. In addition, the CD spectra shown in Figure 3 are in accordance with that previously reported for the recombinant A3 domain (22), suggesting the high conformational integrity of our proteins. To improve much more the structural stability of chimeric proteins, it is interesting to use collagen-binding peptides of shorter length, for instance, a 10-aa sequence within the D2 domain of vWF (23) and a 35-aa sequence in bone sialoprotein (24). The results of cell culture demonstrate that the adhesion of neurons was promoted because of the P2 peptide displayed on the collagen substrate that is originally inert for neurons. It is known that the double-reciprocal binding of IgI and IgII modules of NCAMs promotes cell-cell adhesion and activates intracellular signaling pathways (15). Therefore, we expect that the P2vWFCBD/collagen composite mimics the surface of neurons interacting with adjacent cells through NCAM-NCAM homophilic binding. P2 is a small peptide contained as a consecutive sequence of the FG loop in the NCAM IgII module (13). Our data suggest that the fusion with vWFCBD and the His-tag has minor effects on the function of the small P2 peptide. In summary, we have reported here the synthesis of the collagen binding mimetic of NCAM, P2-vWFCBD, that mediates adhesion of neurons to a collagen matrix. The experimental data indicate that the P2-vWFCBD binds to collagen through vWFCBD, while the P2 peptide facilitates adhesion of neurons through interaction with NCAM. These findings suggest that P2-vWFCBD has the potential to provide favorable microenvironments for neurons to adhere and survive in collagen-based

Communications

matrices. Although this paper focuses on the utilization of the chimeric protein for controlling neuronal behaviors, the CBDmediated modification of collagen will find a broad range of applications by appropriately selecting fusion partners.

ACKNOWLEDGMENT This work was supported by Kobe Cluster, the KnowledgeBased Cluster Creation Project, and Grants-in-Aid for Scientific Research (No. 19659364), MEXT.

LITERATURE CITED (1) Bjo¨rklund, A., and Lindvall, O. (2000) Cell replacement therapies for central nervous system disorders. Nat. Neurosci. 3, 537–544. (2) Goldman, S. (2005) Stem and progenitor cell-based therapy of the human central nervous system. Nat. Biotechnol. 23, 862– 871. (3) Takahashi, J. (2007) Stem cell therapy for Parkinson’s disease. Expert ReV. Neurother. 7, 667–675. (4) Marchionini, D. M., Collier, T. J., Camargo, M., McGuire, S., Pitzer, M., and Sortwell, C. E. (2003) Interference with anoikisinduced cell death of dopamine neurons: implications for augmenting embryonic graft survival in a rat model of Parkinson’s disease. J. Comp. Neurol. 464, 172–179. (5) Tambur, A. R. (2004) Transplantation immunology and the central nervous system. Neurol. Res. 26, 243–255. (6) O’Connor, S. M., Stenger, D. A., Shaffer, K. M., Maric, D., Barker, J. L., and Ma, W. (2000) Primary neural precursor cell expansion, differentiation and cytosolic Ca2+ response in threedimensional collagen gel. J. Neurosci. Methods 102, 187–195. (7) Chen, S. S., Revoltella, R. P., Papini, S., Michelini, M., Fitzgerald, W., Zimmerberg, J., and Margolis, L. (2003) Multilineage differentiation of rhesus monkey embryonic stem cells in three-dimensional culture systems. Stem Cells 21, 281–295. (8) Itoh, T., Satou, T., Dote, K., Hashimoto, S., and Ito, H. (2005) Effect of basic fibroblast growth factor on cultured rat neural stem cell in three-dimensional collagen gel. Neurol. Res. 27, 429– 432. (9) Brannvall, K., Bergman, K., Wallenquist, U., Svahn, S., Bowden, T., Hilborn, J., and Forsberg-Nilsson, K. (2007) Enhanced neuronal differentiation in a three-dimensional collagen-hyaluronan matrix. J. Neurosci. Res. 85, 2138–2146. (10) Huizinga, E. G., Martijn van der Plas, R., Kroon, J., Sixma, J. J., and Gros, P. (1997) Crystal structure of the A3 domain of human von Willebrand factor: implications for collagen binding. Structure 5, 1147–1156. (11) Li, S., Kolkova, K., Rudenko, O., Soroka, V., Poulsen, F. M., Bock, E., and Berezin, V. (2005) Triple effect of mimetic peptides interfering with neural cell adhesion molecule homophilic cis interactions. Biochemistry 44, 5034–5040.

Bioconjugate Chem., Vol. 19, No. 6, 2008 1123 (12) Pedersen, M. V., Køhler, L. B., Ditlevsen, D. K., Li, S., Berezin, V., and Bock, E. (2004) Neuritogenic and survivalpromoting effects of the P2 peptide derived from a homophilic binding site in the neural cell adhesion molecule. J. Neurosci. Res. 75, 55–65. (13) Soroka, V, Kiryushko, D., Novitskaya, V., Rønn, L. C. B., Poulsen, F. M., Holm, A., Bock, E., and Berezin, V. (2002) Induction of neuronal differentiation by a peptide corresponding to the homophilic binding site of the second Ig module of the neural cell adhesion molecule. J. Biol. Chem. 277, 24676–24683. (14) Jørgensen, O. S., and Bock, E. (1974) Brain specific synaptosomal membrane proteins demonstrated by crossed immunoelectrophoresis. J. Neurochem. 23, 879–880. (15) Kiselyov, V. V., Soroka, V., Berezin, V., and Bock, E. (2005) Structural biology of NCAM homophilic binding and activation of FGFR. J. Neurochem. 94, 1169–1179. (16) Hirata, I., Hioki, Y., Toda, M., Kitazawa, T., Murakami, Y., Kitano, E., Kitamura, H., Ikada, Y., and Iwata, H. (2003) Deposition of complement protein C3b on mixed self-assembled monolayers carrying surface hydroxyl and methyl groups studied by surface plasmon resonance. J. Biomed. Mater. Res., Part A 66, 669–676. (17) Kudoh, S. N., Kiyosue, K., and Taguchi, T. (2002) A synaptic potentiation by a protein factor distinct from those induced by neurotrophins. Int. J. DeV. Neurosci. 20, 55–62. (18) Knoll, W. (1991) Polymer thin films and interfaces characterized with evanescent light. Makromol. Chem. 192, 2827–2856. (19) Kato, K., Sato, H., and Iwata, H. (2007) Ultrastructural study on the specific binding of genetically engineered epidermal growth factor to type I collagen fibrils. Bioconjugate Chem. 18, 2137–2143. (20) Nakaji-Hirabayashi, T., Kato, K., Arima, Y., and Iwata, H. (2007) Oriented immobilization of epidermal growth factor onto culture substrates for the selective expansion of neural stem cells. Biomaterials 28, 3517–3529. (21) Romijn, R. A., Westein, E., Bouma, B., Schiphorst, M. E., Sixma, J. J., Lenting, P. J., and Huizinga, E. G. (2003) Mapping the collagen-binding site in the von Willebrand factor-A3 domain. J. Biol. Chem. 278, 15035–15039. (22) Auton, M., Cruz, M. A., and Moake, J. (2007) Conformational stability and domain unfolding of the von Willebrand factor A domains. J. Mol. Biol. 366, 986–1000. (23) Tuan, T. L., Cheung, D. T., Wu, L. T., Yee, A., Gabriel, S., Han, B., Morton, L., Nimni, M. E., and Hall, F. L. (1996) Engineering, expression and renaturation of targeted TGF-beta fusion proteins. Connect. Tiss. Res. 34, 1–9. (24) Tye, C. E., Hunter, G. K., and Goldberg, H. A. (2005) Identification of the type I collagen-binding domain of bone sialoprotein and characterization of the mechanism of interaction. J. Biol. Chem. 280, 13487–13492. BC700470V