A Combinatorial Approach To Study Cytochrome P450 Enzymes for

Subscriber access provided by UNIV OF NEW ENGLAND ARMIDALE

Article

A combinatorial approach to study cytochrome P450 enzymes for de novo production of steviol glucosides in baker’s yeast Nicholas Gold, Elena Fossati, Cecilie Cetti Hansen, Marcos Di Falco, Veronique Douchin, and Vincent J. J. Martin ACS Synth. Biol., Just Accepted Manuscript • DOI: 10.1021/acssynbio.8b00470 • Publication Date (Web): 26 Nov 2018 Downloaded from http://pubs.acs.org on November 26, 2018

Just Accepted “Just Accepted” manuscripts have been peer-reviewed and accepted for publication. They are posted online prior to technical editing, formatting for publication and author proofing. The American Chemical Society provides “Just Accepted” as a service to the research community to expedite the dissemination of scientific material as soon as possible after acceptance. “Just Accepted” manuscripts appear in full in PDF format accompanied by an HTML abstract. “Just Accepted” manuscripts have been fully peer reviewed, but should not be considered the official version of record. They are citable by the Digital Object Identifier (DOI®). “Just Accepted” is an optional service offered to authors. Therefore, the “Just Accepted” Web site may not include all articles that will be published in the journal. After a manuscript is technically edited and formatted, it will be removed from the “Just Accepted” Web site and published as an ASAP article. Note that technical editing may introduce minor changes to the manuscript text and/or graphics which could affect content, and all legal disclaimers and ethical guidelines that apply to the journal pertain. ACS cannot be held responsible for errors or consequences arising from the use of information contained in these “Just Accepted” manuscripts.

is published by the American Chemical Society. 1155 Sixteenth Street N.W., Washington, DC 20036 Published by American Chemical Society. Copyright © American Chemical Society. However, no copyright claim is made to original U.S. Government works, or works produced by employees of any Commonwealth realm Crown government in the course of their duties.

Page 1 of 40 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

ACS Synthetic Biology

A combinatorial approach to study cytochrome P450 enzymes for de novo production of steviol glucosides in baker’s yeast

Nicholas D. Golda,1, Elena Fossatia,1,2, Cecilie Cetti Hansen a,d,e, Marcos Di Falcob, Veronique Douchinf, Vincent J.J. Martina,b,c,*

a Centre

for Applied Synthetic Biology, Concordia University, Montréal, Québec, Canada, H4B

1R6 b Centre

for Structural and Functional Genomics, Concordia University, Montréal, Québec,

Canada, H4B 1R6 c

Department of Biology, Centre for Structural and Functional Genomic, Concordia University,

Montréal, Québec H4B 1R6, Canada d

Plant Biochemistry Laboratory, Department of Plant and Environmental Science, University of

Copenhagen, DK-1871 Frederiksberg C, Denmark e

Center for Synthetic Biology, University of Copenhagen, DK-1871 Frederiksberg C, Denmark

f

Evolva, Lersø Parkallé 42-44, DK-2100, Copenhagen Ø, Denmark

1

Authors have contributed equally to this work

2

Present address: Lallemand Inc, 6100 Royalmount Ave, Montréal, Québec, Canada, H4P 2R2

* Corresponding author: [email protected]

1

ACS Paragon Plus Environment

ACS Synthetic Biology 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Abstract Biosynthesis of steviol glycosides in planta proceeds via two cytochrome P450 enzymes (CYPs): kaurene oxidase (KO) and kaurenoic acid hydroxylase (KAH). KO and KAH function in succession with the support of a NADPH-dependent cytochrome P450 reductase (CPR) to convert kaurene to steviol. This work describes a platform for recombinant production of steviol glucosides (SGs) in Saccharomyces cerevisiae, demonstrating the full reconstituted pathway from the simple sugar glucose to the SG precursor steviol. With a focus on optimization of the KO-KAH activities, combinations of functional homologs were tested in batch growth. Among the CYPs, novel KO75 (CYP701) and novel KAH82 (CYP72) outperformed their respective functional homologs from Stevia rebaudiana, SrKO (CYP701A5) and SrKAH (CYP81), in assays where substrate was supplemented to culture broth. With kaurene produced from glucose in the cell, SrCPR1 from S. rebaudiana supported highest turnover for KO-KAH combinations, besting two other CPRs isolated from S. rebaudiana, the Arabidopsis thaliana ATR2, and a new class I CPR12. Some co-expressions of ATR2 with a second CPR were found to diminish KAH activity, showing that co-expression of CPRs can lead to competition for CYPs with possibly adverse effects on catalysis.

2


Page 2 of 40

Page 3 of 40 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Keywords Cytochrome P450 monooxygenase, cytochrome P450 reductase, steviol glucosides, diterpenoid biosynthesis

Abbreviations CYP, cytochrome P450. CPR, cytochrome P450 reductase. KO, kaurene oxidase. KAH, kaurenoic acid hydroxylase.

3



The identification of the genes responsible for production of the sweet diterpene steviol glycosides in Stevia rebaudiana has led to the generation of steviol glucosides (SGs) in recombinant hosts1-3. Using the GRAS approved synthetic biology chassis organism Saccharomyces cerevisiae, the sweetener stevia could soon be mass produced in bioreactors rather than extracted from agricultural crops. The stevia plant accumulates more than thirty different steviol glycosides, the majority being SGs, which are produced by the action of just four UDP glucose-dependent glucosyltransferases (UGTs) on the SG backbone steviol through a complex web of glucosylations4-6. Some of these SGs, like the major components stevioside and rebaudioside A (Reb A), are undesirable because of their bitter aftertaste7; while some minor SG components like Reb D and Reb M have shown promise as next generation sweeteners due to their sweetness and pleasant organoleptic properties8. Thus, customizing SG production by selective UGT deployment is a potential advantage for recombinant production. While the promiscuity of UGTs represents a challenging obstacle for recombinant SG production, Olsson et al. were able to tune the type and titer of SGs produced by generating UGT mutants selected for increased or specific accumulation of Reb D and Reb M in S. cerevisiae1. Generating SG precursors up to steviol from glucose has been a matter of coordinating known bioactivities. Increasing isoprenoid levels in the mevalonate pathway is well established both in Escherichia coli and in S. cerevisiae as seen in artemisinin work9, 10. Geranylgeranyl pyrophosphate (GGPP) is formed from the condensation of farnesyl pyrophosphate and isopentenyl pyrophosphate by GGPP synthase (GGPPS). Copalyl pyrophosphate synthase (CPPS) converts GGPP to copalyl pyrophosphate (CPP), which is in turn converted to kaurene by kaurene synthase (KS)11 (Fig. 1). Kaurene-to-steviol conversion requires the action of two cytochrome P450 enzymes (CYPs) in succession: kaurene oxidase

4


Page 4 of 40

Page 5 of 40 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


(KO) and kaurenoic acid hydroxylase (KAH). KO catalyzes three successive oxidations at the C19 of kaurene; first a hydroxylation to form kaurenol, followed by oxidation to kaurenal and then to kaurenoic acid. Subsequently, KAH hydroxylates the C13 position of kaurenoic acid, giving rise to steviol. Microsomal CYP monooxygenases are membrane-associated hemoproteins whose activity depend on the transfer of two electrons catalyzed by NADPH-dependent cytochrome P450 reductases (CPR), which are also membrane-bound12, 13. In the endoplasmic reticulum (ER) of plants, CYP and CPR function as a complex held together by protein-protein interactions, where the CPR is the node around which CYP subunits and other associated proteins organize themselves14-19. Optimization of engineered CYP activity for recombinant production of marketable bioproducts is notoriously difficult20. Benchmark work involving CYP optimization is demonstrated in the artemisinin work by Paddon et al.10. CYPs can also function in a system with microsomal cytochrome b5 (CB5) membrane-bound hemoproteins, which require a NADHdependent CB5 reductase (CBR) flavoprotein21, 22. The recent watershed work by Laursen et al. on the biosynthesis of the cyanogenic glucoside dhurrin in sorghum demonstrated co-purification of CYPs with CPR, but also CB5 and CBR were enriched in the purified sample15. Wang et al. recently produced SGs in E. coli, but reported a bottleneck at the KAH step, which they were able to improve upon using a KAH functional homolog from Arabidopsis thaliana rather than S. rebaudiana; however, kaurenoic acid was still found to accumulate2. The steviol precursors kaurenol and kaurenoic acid can also be glucosylated by UGTs, diverting intermediates from the production of steviol3, which is another reason for the need to maximize the efficiency of kaurene to steviol conversion. In engineering a recombinant pathway involving CYPs, choice of CPR for optimal CYP turnover, correct subcellular localization to the ER, and

5



expression level or copy number modulation are important considerations10, 23. The present work demonstrates the full reconstituted biosynthetic pathway to produce the SG precursor steviol from the simple sugar glucose in a S. cerevisiae host, focusing on optimization of the KO-KAH activities by testing, in batch growth, combinations of plant homologs of two KOs, two KAHs and five CPR.

Results Optimizing CYP/CPR combinations Our goal was to maximize kaurene-to-steviol conversion and limit side product accumulation in S. cerevisiae by identifying optimal KO-KAH-CPR combinations from a small collection of functional homologs (Table 1). Our test proteins included two KOs, two KAHs, and five CPRs. Five sequences originated from S. rebaudiana: SrKO (CYP701A5), SrKAH (CYP81), SrCPR1, SrCPR7 and SrCPR8. Our study also included Arabidopsis thaliana CPR ATR2, as well as three sequences from a patent3 designated here as KO75 (CYP701), KAH82 (CYP72), and CPR12. To the end of discovering the best KO-KAH-CPR combinations, we first sought to identify the most favourable CPR partner for each CYP individually. Individual CYPCPR pairs were analyzed for in vivo activity in S. cerevisiae IS1, a wild-type haploid strain of baker’s yeast used in industrial applications. We also examined subcellular (co)localization by microscopy and protein production levels by immunoblot. These data informed our choices in creating productive KO-KAH-CPR combinations, which were assembled into host strains also expressing constructs enabling production of kaurene from glucose. Expression cassettes were integrated into S. cerevisiae IS1, either alone or as CYP-CPR pairs in every permutation (Table S1). In all strain combinations, the endogenous S. cerevisiae genes ERG5 and ERG11, encoding

6


Page 6 of 40

Page 7 of 40 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


CYPs involved in ergosterol biosynthesis were not deleted from the host strain; nor was the endogenous gene NCP1, encoding the CPR associated with the ergosterol pathway. In vivo activity of each CYP was tested with each heterologous CPR by growing strains to late stationary phase in medium supplemented at the point of inoculation with the appropriate substrate. Culture extracts were analyzed for KO activity by the production of kaurenoic acid from kaurene or for KAH activity by the production of steviol from kaurenoic acid. When no plant CPR was expressed, CYP activity was driven by electrons donated by Ncp1 only as a baseline case. For the KOs in general, the plant CPRs did not contribute to significantly better activity than the endogenous Ncp1 (Fig. 2 A). SrKO showed only slightly higher activity with SrCPR1 and SrCPR7 compared to Ncp1, while the other heterologous CPRs contributed to lower kaurenoic acid production. KO75 had highest activity with Ncp1, while second best production was provided by SrCPR8. Lowest KO75 activity was obtained when co-expressed with SrCPR1. Conversely, the KAHs were generally more productive with plant CPRs than with Ncp1 (Fig. 2 B). While all S. rebaudiana CPRs were equally productive with KAH82, SrCPR1 was clearly the best coupling partner for SrKAH (Fig. 2 B). Both KAHs performed poorly in the absence of a plant CPR but also in the presence of ATR2. The best of the KO75-plant CPR combinations marginally outperformed the best of the SrKO combinations (~10%). The best of the KAH82 combinations outperformed the best of the SrKAH combinations by around 30%. No significant differences in growth were observed between strains, and no significant toxicity effect was observed in wild-type cells when grown with 100 µM kaurene, kaurenoic acid or steviol. Strains co-expressing pairs of CYP-mCherry and CPR-GFP fusions were examined by fluorescence microscopy in early log phase growth to assess each protein’s subcellular localization. Fig. 3 A shows the red and green channels corresponding to signals from CYP-

7



mCherry and CPR-GFP fusions, respectively. Images for CYP-mCherry and CPR-GFP fusions expressed separately are shown in Fig. S1. Signals for all CYP-mCherry and CPR-GFP fusions were observed to delineate the perinuclear space, indicating protein localization to the ER (Fig. 3 A; white arrows show example). In some instances, signal for CYP fusions suggested protein aggregation in the cytoplasm (Fig. 3 A; yellow arrow shows example), which was not observed in the same area as the co-expressed CPR. The plant CPRs were easy to visualize. The S. rebaudiana CYPs provided fainter signals compared to KO75 and KAH82. No observations with respect to specific CYP-CPR combinations were noted. Generally, the predicted N-terminal transmembrane helices (TMH) on each of the native CYP and CPR sequences targeted their respective proteins to the ER, even though in some cases a fraction of CYP protein was observed outside of the ER where it did not co-localize with CPR. Protein production of CYPs and CPRs, alone or co-expressed, was assessed by immunoblotting. Fig. 3 B shows the highest MW band(s) that corresponded to the expected sizes of the full-length proteins. In the cases of the KAH variants, both variants consistently exhibited a double banding pattern, possibly due to glycosylation. Based on band intensity, all the CYPs were produced to more or less the same level and were present up to 72 h, regardless of whether they were expressed alone or with a CPR. This stability of CYPs was observed in spite of the fraction of CYP protein observed by fluorescence microscopy as possibly aggregated outside of the ER (Fig. 3 A). Only KAH82 in co-expression with SrCPR1 exhibited a marked decrease in band intensity after 24 h: at 24 h, the lower of the two closely spaced bands became more intense and at 48 and 72 h both bands were faint. The CPRs, when expressed alone, behaved differently. SrCPR1, CPR12 and ATR2 full-length protein bands were present up to 72 h; whereas the SrCPR7 and SrCPR8 bands were faint after 8 h. Protein production of SrCPR1 was marginally

8


Page 8 of 40

Page 9 of 40 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


lower in the presence of a KO. SrCPR7 band intensity improved somewhat in the presence of SrKO and more so in the presence of either KAH. SrCPR8 production only seemed to improve slightly in the presence of a KAH. CPR12 band intensity decreased when paired with a KO, but increased in the presence of a KAH. Finally, ATR2 band intensity was constant over time in the absence of a heterologous CYP and with SrKAH, but decreased at 24, 48 and 72 h when coexpressed with the other CYPs. Taken together, our CYP-CPR co-expression data suggests that co-expression of the two proteins will influence their stability, sometimes showing a stabilizing effect, as with SrCPR7 combined with SrKO or KAH, or a destabilizing effect such as with CPR12 combined with KOs.

KAH82-CPR activity over time tested by staggered substrate supplementation In light of our CYP-CPR activity and production data we postulated that protein stability would affect CYP activity over an extended steviol production period. To test this postulate, kaurenoic acid was added at different times to cultures of strains expressing KAH82 with SrCPR1, SrCPR7, CPR12, or no plant CPR, and steviol production was analyzed after 6 days (Fig. 4 A). KAH82 paired with SrCPR1 or SrCPR7 produced high steviol amounts when substrate was provided at the time of inoculation, but production was highest when it was added to the culture broth at mid-log growth (14 h). Addition of kaurenoic acid at 24 h produced 4050% less steviol, and additions at later time points produced ~90% less. KAH82-CPR12, on the other hand, at best produced only about 60% compared to the SrCPR1 and SrCPR7 pairings, but that production was consistent whether the substrate was added at 0, 14 or 24 h. Even when kaurenoic acid was added at 48 h, KAH82-CPR12 still produced around 50% of its 0-24 h outputs, thereby doubling that of the SrCPR1 or SrCPR7 pairings. These activity patterns agree

9



with the activity and immunoblot data (Fig. 2 B and 3 B) for SrCPR1 and CPR12. The KAH82SrCPR1 pair is highly active but activity is reduced after 24 h possibly due to degradation of the CYP protein. In the case of the KAH82-CPR12 pair, CYP activity is lower but sustained for a longer period possibly due to a more stable CYP. Conversely, the staggered substrate assay results did not agree with our activity and immunoblot data (Fig. 2 B and 3 B) for SrCPR7 and no CPR. With these two CPRs the KAH82 appears to be stable up to 72 h even though activity is reduced after 24 h.

KAH82-CPR pairs co-expressed with ATR2 Because NCP1 was not deleted from any of our test strains, the results from the initial activity assay suggested that in the presence of two different CPRs, the activity of a CYP is determined by one CPR more than the other. For example, the co-expression of each of SrKO, KO75 and SrKAH with ATR2 led to lower product yields than in the presence of the only native CPR Ncp1. In the case of KAH82, co-expression of ATR2 resulted in higher steviol yield than with the native Ncp1 only, but still lower steviol yield than with any of the other heterologous CPRs (Fig. 2 B). To further explore this phenomenon, a copy of ATR2 was added at the Fgf20 XVI site of strains expressing KAH82-CPR pairs (Table S1). ATR2 was chosen because it had produced the least amount of steviol of any CPR when paired with KAH82. These strains were grown alongside the original KAH82-CPR strains and tested as before with 150 µM kaurenoic acid as substrate (Fig. 3 B). As before, KAH82-ATR2 produced the least steviol compared to pairings with the other CPRs. In the case of both SrCPR1 and SrCPR7, the additional presence of ATR2 negatively affected steviol production, resulting in a steviol yield equal to or lower than that of KAH82-ATR2. KAH82-SrCPR8 with ATR2 produced the same activity as KAH82-

10


Page 10 of 40

Page 11 of 40 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


CPR8. Finally, the presence of ATR2 did not change the apparent activity of KAH82-CPR12; however, KAH82-CPR12 activity was comparable to KAH82-ATR2 control to begin with.

Co-expression of KOs, KAHs and CPRs in a kaurene-producing cell Even though the KOs were most productive with the endogenous yeast CPR in the substrate supplementation assays (Fig. 2 A), any KO-KAH combination would require coexpression with a heterologous plant CPR since KAH activity was non-optimal with Ncp1 alone (Fig. 2 B). To identify the best CYPs-CPR combination, permutations of one KO, one KAH, and one CPR were tested for production of steviol in a kaurene producing host. Every permutation of KO-KAH was combined with SrCPR1 or SrCPR7 (Table S2). SrCPR8 and CPR12, however, were only paired with combinations involving KAH82 because they ranked poorly when combined with SrKAH in kaurenoic acid supplementation assays (Fig. 2 B). In addition, ATR2 was not included due to its poor performance when tested with the KAHs. All strains grew to similar OD660 resulting in an identical steviol production ranking when concentrations were normalized per cell density. The host strain expressing only the kaurene pathway produced 602 µM kaurene and served as baseline for evaluating strain to strain differences in the generation of kaurene equivalents, which we define as total µM of carbon in the form of kaurene, kaurenoic acid, and steviol (but not kaurenal since it was not quantified using a standard). We use the concept of kaurene equivalents as a means of estimating pathway flux, assuming the unquantified species constitute only a minor molar fraction of the total carbon at the engineered metabolic branch. The four strains with SrCPR1 combinations produced the most steviol, as we also observed in the individual testing by substrate supplementation; and among them the combinations with

11



SrKAH outperformed those with KAH82, even though KAH82 was more active than SrKAH in kaurenoic acid supplementation assays (Fig 2 B). With the kaurene pathway co-expressed, the strains with SrKAH-SrCPR1 and KO75 or SrKO formed the top tier for steviol production both producing ~115 µM steviol (Fig 5 A). The second best strains, KO75 and SrKO in combination with KAH82-SrCPR1, yielded 77 and 64 µM, respectively. Three of the next four best strains were combinations with SrCPR7: KO75-KAH82 produced 61 µM steviol, SrKO-SrKAH 53 µM, and KO75-SrKAH 43 µM. KO75-KAH82-SrCPR8 produced 49 µM. CPR12 combinations produced very little steviol (50% from 48 h onwards. Kaurenoic acid percent yield from kaurene equivalents was ~40% for SrKO-SrCPR1 from 72 h onwards, but with KAH82 added this dropped to 23-29%.

Discussion Our work demonstrates de novo production of the SG precursor steviol from glucose by expression of a recombinant pathway in yeast. Using a combinatorial approach to test functional homologs from our collection of KO, KAH and CPR enzymes, we achieved optimization of kaurene to steviol conversion by the consecutive CYP activities in the SG pathway. The individual testing of CYP-CPR pairs was an imperfect predictor of KO-KAH-CPR behavior because it did not take into account the changes in CYP-substrate affinity24, 25 and CYPCPR affinity26, 27 that can occur when multiple CYPs and CPR form a complex in the membrane. The 4 d substrate supplementation assays on individual CYP-CPR pairs correctly identified SrCPR1 as the best coupling partner for most CYP-catalyzed reactions in this study. CPR12 was also correctly identified as a non-optimal partner. However, both SrCPR7 and SrCPR8 appeared to couple well with KAH82 activity, but the produced steviol only reached average levels when co-expressed with KAH82 in the presence of a KO. A multi-CYP complex is not quite the sum of its individual parts. The complexity of a multi-CYP complex where substrate binding, channelling and overall flux depend on relative expression levels of each component and protein-

15



protein interactions between them (not to mention the membrane itself) makes predicting activity very difficult from the individual parts. Our test system did not take into account possible effects of endogenous yeast Erg5, Erg11 and Ncp1, which may have played a role in competing for and with the heterologous enzymes28. The phenomenon of competition between two CYPs for a single CPR has been studied in vitro27, 29, but the present work may represent the first documented competition of CPRs for a single CYP in vivo. Co-expression of CPRs with ATR2 in the presence of KAH82 created an apparent competition with sometimes adverse effects on CYP activity. The KAH82-CPR plus ATR2 data imply varying levels of interaction between KAH82 and each CPR. In the case of SrCPR1 or SrCPR7 with ATR2, we can speculate that the affinity of KAH82 for ATR2 was greater than it was for either SrCPR1 or SrCPR7 since the observed KAH activity with either one combined with ATR2 was equal to or lower than that of KAH82-ATR2 control. Likewise, in the case of SrCPR8 (and possibly CPR12), its interaction with KAH82 appears to have been strong enough that it was not disrupted by the co-expression of ATR2. These results caution against pathway engineering strategies that co-express multiple CPRs if one has a strong affinity for a CYP but provides poor electron transfer and hence activity. CYP-CPR complexes are known to function at CYP:CPR ratios ranging from 5:1 to 20:1 in the ER15, 19, 30, 31. Our copy number modulation test with KO75, KAH82 and SrCPR1 showed that two copies of KO75 was a requirement for an increase in steviol production pointing to a limitation at the KO step. However, addition of a copy of KO (KO:KAH:CPR ratio of 2:1:1) did not require addition of an extra copy of SrCPR1 to yield higher steviol than a 1:1:1 ratio, suggesting that the KO:CPR ratio is suboptimal at 1:1. In contrast, addition of an extra copy of KAH, at a KO:KAH:CPR ratio of 1:2:1 or 2:2:1, produced more steviol only when an extra copy

16


Page 16 of 40

Page 17 of 40 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


of SrCPR1 was added. This could be due to limited coupling of SrCPR1 with KAH82 in the presence of KO75. The three-step oxidation carried out by KO resembles that of CYP71AV1 in amorphadiene to artemisinic acid conversion. Paddon et al. discovered and implemented Artemisia annua alcohol dehydrogenase ADH1 and artemisinic aldehyde dehydrogenase ALDH1 along with CYP71AV1 to improve the last two oxidation steps10. While we never detected kaurenol, the accumulation of kaurenal was observed in some of the glucose to steviol strains. Identifying S. rebaudiana ADH and ALDH enzymes and their expression in yeast could potentially compensate for a rate-limiting KO. The level of steviol production achieved by our best strains (115-123 µM steviol from glucose; Fig. 5) compares favourably with other studies that have engineered de novo heterologous diterpenoid production in S. cerevisiae. Ignea et al. achieved production of ~54 µM of carnosic acid32, improving upon titers realized by other studies on the ferruginol pathway33, 34. Pateraki et al. recently engineered production of ~100 µM of forskolin from glucose, which required a pathway involving 3 CYPs, a CPR and an acetyl transferase from Coleus forskohlii35. In our best steviol producing strains, 300-650 µM of total kaurenoic acid and kaurene remained in culture supernatants, which indicates that secretion of pathway intermediate likely limits steviol yields. The secretion of intermediates exacerbated the slow production of steviol, which was found to accumulate gradually over 7 d, but the extent of the equilibrium and diffusion resulted from the inefficiency of the KO-KAH activities, which failed to channel intermediates effectively to minimize escape of intermediates, be it by free diffusion or secretion, and maximize product. Laursen et al. observed that the presence of UGT85B1, the last enzyme in dhurrin biosynthesis, stimulated channelling between the two CYPs in the dhurrin metabolon15.

17



We can only speculate that addition of an UGT might improve channeling of intermediates between the CYPs in the biosynthesis of SGs. A pathway optimization strategy likely to lead to an improvement in steviol production is the co-expression of cytochrome b5, instances of which have been shown to influence CYP catalytic activity depending on its expression level relative to CPR, on the presence of CYP substrate and on CYP-CPR-cytochrome b5 protein-protein interactions21, 22, 36, 37. Improvements on the order of 1.5- to 8-fold have been reported by studies co-expressing heterologous CYP-CPR systems with cytochrome b5 in S. cerevisiae10, 32, 38. In summary, here we demonstrate production of steviol from a simple carbon substrate using engineered S. cerevisiae. Product yield was increased by exploring a library of CYP and CPR homologs and by modulating gene copy number. These results provide a step towards commercial production of next generation sweeteners.

Materials and Methods Strains and genetic materials An industrial haploid strain of wild-type S. cerevisiae (MATα HOΔ ura3Δ his3Δ leu2Δ), designated here as IS1, was used as the host for all gene integrations unless otherwise specified39. Escherichia coli DH5α [F– Φ80lacZΔM15 Δ(lacZYA-argF) U169 recA1 endA1 hsdR17 (rK–, mK+) phoA supE44 λ– thi-1 gyrA96 relA1] was used for plasmid maintenance and storage. The heterologous genes used in this work are listed in Table 1. All nucleotide sequences were codon optimized for expression in S. cerevisiae. Kaurene production constructs used have previously been described in Kishore et al.40 and Houghton-Larsen et al.41. The test CYPs included two KOs and two KAHs, namely SrKO from S. rebaudiana (accession no. AAQ63464) as well as KO75, SrKAH and KAH82, described as polypeptide sequence no. 75, SrKAHe1 and polypeptide

18


Page 18 of 40

Page 19 of 40 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


sequence no. 82, respectively, in Robertsen et al.3. CPRs included SrCPR1 (accession no. ABB88839) and ATR2 from Arabidopsis thaliana (accession no. CAA46815), as well as SrCPR7, SrCPR8 and CPR12 from Robertsen et al.3.

Sequence analysis Phylogenetic analyses of CYPs and CPRs were done using MEGA7: protein sequences were aligned using MUSCLE (default settings) and the consensus trees were built using Neighbor-Joining Tree (default settings) with 1000 bootstrap replicates42. The resulting phylogenetic trees are reported in Fig. S3. Phylogenetic analysis of the KO75 sequence suggests that it belongs to the CYP701 family whereas SrKAH is likely a CYP81 member and KAH82 clusters with members of the CYP72 family (Fig. S3 A). The S. rebaudiana CPRs and ATR2 cluster with class II CPRs, while CPR12 clusters with class I CPRs and among rosid sequences (Fig. S3 B). Prediction of transmembrane helices (TMHs) was performed using TMHMM Server v. 2.043. All the CYP and CPR sequences have a predicted N-terminal TMH.

Cloning and integration of pathway in S. cerevisiae CYP and CPR genes were amplified using Phusion DNA polymerase (ThermoFisher) and cloned via restriction enzymes SapI (type IIs) and KasI into pBOT expression plasmids44, all under constitutive S. cerevisiae promoters (Table 1). CYPs were tagged at their C-terminus with sequences for either mCherry or Myc epitope. CPRs were tagged at their C-terminus with sequences for either GFP or HA epitope. All start codons were preceded directly by Kozak sequence AAAACA and all constructs were verified by Sanger sequencing. Assembled expression cassettes were amplified by PCR from pBOT plasmids to generate DNA for

19



homology directed repair (HDR) of double strand breaks in the chromosome of IS1 wild-type using CRISPR-Cas9. Integration cassettes for HDR were amplified with Phusion DNA polymerase (ThermoFisher) with primers containing 60 bp of homology to either the targeted chromosomal locus and/or to adjacent cassettes being assembled and integrated simultaneously. Primers used to generate repair DNA for integrations are listed in Tables S4 and S5. Gene cassettes were integrated into chromosome XII or XVI, at sites respectively corresponding to USER site XII-1 from Mikkelsen et al.45 and site 20 from Flagfeldt et al.46. We refer to these sites as USER XII-1 and Fgf20 XVI, respectively. A 20-nt PAM sequence for each locus was cloned separately into a modified p426 gRNA plasmid, which had a kanMX selection marker in place of the URA3 cassette47: GTTGGGAAGAGCCGCGAGTA for USER XII-1 or TCTTGGAATCAGTACATAGC for Fgf20 XVI. For a CRISPR genome editing experiment, host cells were pre-transformed with a modified p414 Cas9 plasmid, which had hphNT1 and URA3 cassettes in place of the TRP1 marker47. Competent cells were grown in the presence of 200 mg/L hygromycin. The gRNA plasmid (1.7-4.2 µg/mL) and each linear repair DNA component for HDR (as non-purified PCR product, estimated at 2.8-5.6 µg/mL) were cotransformed by the Gietz method48. Integration transformants were selected on solid standard yeast peptone dextrose (YPD) supplemented with 200 mg/L hygromycin and 200 mg/L G418. Integrants were screened by colony PCR using Phire DNA polymerase (ThermoFisher) to amplify entire integration cassettes (up to >9 kb). PCR products of positive integrants were further confirmed by Sanger sequencing. Positive integrant strains were cured of the Cas9 plasmid and their growth was tested using a Tecan Sunrise 96-well plate reader to measure cell density at 595 nm and 20-min intervals over a 48 h period, with continuous shaking at 30 ºC in between readings.

20


Page 20 of 40

Page 21 of 40 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Kaurene production constructs were cloned by the USER method49 into pX-XII integration vectors from Mikkelsen et al.45 (Table 1). For integration of these constructs, the resulting vectors were linearized by digestion with Not I restriction enzyme, purified and then transformed into IS1 as above. Constructs expressing the kaurene pathway were co-transformed, and double integration events were selected by growth on YPD with 200 mg/L hygromycin and 200 mg/L G418. Positive integrants were confirmed by colony PCR as above, and growth was also tested over 48 h.

Growth conditions Cells were grown in liquid batch cultures in YPD for all experiments unless otherwise specified. Antibiotic G418 at a concentration of 200 mg/L was added to YPD for activity and immunoblot experiments. All liquid cultures were seeded to a starting OD660 of 0.1 from overnight culture, and then grown at 30 ºC with 200 rpm shaking. For activity tests in which substrate needed to be supplemented to the medium, cultures were grown in a volume of 0.6 mL in a 10-mL glass tube with either kaurene or kaurenoic acid added to a concentration of 100 or 150 µM. For activity tests in which kaurene was produced from glucose, cultures were grown in a volume of 5 mL in a 25-mL glass tube. Kaurene was a gift from Evolva. Kaurenoic acid and steviol were obtained from Sigma-Aldrich (Oakville, Canada).

Kaurene, kaurenal, kaurenoic acid, steviol and steviol glucoside analysis For analysis of kaurenoic acid and steviol, 30 µL of cell broth (or supernatant) was sampled and extracted with 120 µL of acetonitrile (MeCN) into a polypropylene V-bottom 96well plate sealed with an aluminum adhesive seal. After shaking the plate at 800 rpm and room

21



temperature for 15 min, extracts were centrifuged at 2,400 x g for 5 min. The MeCN extracts were removed to a clean plate and diluted 1/5 or more if necessary to fall within the linear range of the standard curve for either analyte (0.625-40 µM). Samples were analyzed using an Agilent (IM)Q-TOF 6560 MS equipped with a 1290 Infinity II LC system or a Thermo Finnigan LTQ FT MS equipped with a Perkin Elmer Series 200 LC. Five µL of sample were separated over a Waters Acquity UPLC BEH C18 column (130 Å, 1.7 µm, 2.1 mm x 50 mm) at a flow rate of 0.2 mL/min, using a mobile phase gradient as follows: 0-3 min 65-85% MeCN in water with 0.1% (v/v) formic acid, then hold at 85% for 2 min. MS data was acquired in negative mode, scanning from 100-1000 m/z. Steviol and kaurenoic acid were quantified as the abundances of the 317.2139 m/z ion eluting at 1.705 ± 0.2 min and the 302.2170 m/z ion eluting at 4.494 ± 0.2 min, respectively, using external mixed standard curves run after every 48 injections. For analysis of kaurene and kaurenal, 30 µL of cell broth (or supernatant) was combined to 120 µL of ethyl acetate (EtOAc) in 1.7-mL polypropylene tubes and vortexed vigorously 3 x 30 s. Tubes were then centrifuged at 21,000 x g for 3 min and the EtOAc extracts were transferred to glass vials for analysis by GC-MS using an Agilent 6890N-5975C. Samples were analyzed as 1/4 dilutions. One-µL splitless injections were separated by temperature gradient (80 ºC hold 2 min, 80-170 ºC at 30 ºC/min, 170 ºC hold 3 min, 170-300 ºC at 30 ºC/min, 300 ºC hold 8 min) over a Supelco SLB-5ms column (30 m x 0.25 mm x 0.25 µm), using hydrogen/nitrogen as carrier/makeup gases at a flow rate of 1.2 mL/min. The MS scan range was 50-550 m/z with threshold set at 150 ion counts and an 8-min solvent delay. Kaurene was quantified as the abundance of 91.1 m/z ion (molecular ion 272.3) eluting at 10.9 ± 0.1 min, using second order polynomial or quadratic fit to external standard curves (6.25-400 µM) run at least every 40 injections. An unknown peak eluting at 11.8 min presented a nearly identical mass spectrum to

22


Page 22 of 40

Page 23 of 40 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


that of kaurene, but with a molecular ion (M+•) of 286.3 (Fig. S4). We inferred the identity of this peak to be kaurenal which has a molecular weight of 286.46 g/mol. Kaurenal was quantified as the abundance of the 91.1 m/z ion of the peak eluting at 11.8 min, reported in peak area. Cell density measurements were made at each sampling in order to normalize metabolite concentrations. Metabolite values are averaged from three clonal biological replicates, with uncertainties expressed as 95% confidence intervals. Percent product yields were calculated based on molar amounts, where a given product or reactant includes its quantified downstream products, the sum of which are referred to here as equivalents of that intermediate. Kaurene equivalents were thus calculated as the molar sum of kaurene, kaurenoic acid and steviol; and kaurenoic acid equivalents as the molar sum of kaurenoic acid and steviol. Steviol percent yield was determined from kaurene equivalents and from kaurenoic acid equivalents, and kaurenoic acid percent yield was calculated from kaurene equivalents (see Supporting Information for details).

Microscopy imaging To visualize the expression of tagged fluorescent proteins, cells from overnight YPD cultures were inoculated into fresh YPD medium at an OD660 of 0.4 and incubated at 30 ºC with 200 rpm shaking for 4-6 h (approximately two doublings). Cells were washed with SC medium, mounted unfixed on microscope slides and images were captured using a Nikon Ti microscope with a 100x PlanAPO lens (NA 1.49). Cells were illuminated using high inclination laminated optical sheet TIRF illumination with either 488 nm (GFP) or 568 nm (mCherry) lasers, and their respective filter cubes (Chroma, USA). Images are of single planes. Image processing was done using FIJI (NIH, USA).

23



Immunoblotting Strains expressing Myc-tagged CYPs and/or HA-tagged CPRs were grown in 5-mL batch cultures and sampled for analysis by immunoblot over a 72-h period. To have sufficient cells for analysis at 8 h, a separate 40-mL culture was seeded. A cell equivalent of 1 mL of broth at an OD660 of 4 was collected for all samples. Cell pellets were washed in 0.1 mL of water, then collected by centrifugation 21,000 x g for 1 min and suspended in 0.15 mL of lysis buffer (1 tablet of Roche cOmplete Mini Protease Inhibitor Cocktail dissolved in 10 mL of 50 mM TrisHCl pH 7.5, 2 mM MgCl2, 150 mM NaCl, NP40 0.1% (v/v)) and 50 µL of Li-COR 928-40004 loading dye. Samples were denatured at 95 ºC for 5 min centrifuged and supernatants were divided in three aliquots of 90, 90 and 20 µL and snap-frozen in liquid nitrogen. The total protein per sample was quantified using the Pierce 660 nm protein assay reagent (Thermo Scientific 22660) with the ionic detergent compatibility reagent (Thermo Scientific 22663) and BSA as standard. Five μg of total protein per sample, unless otherwise specified, were resolved by SDSPAGE and transferred to a nitrocellulose membrane for detection of the specific epitopes. Fifteen μg instead of 5 μg were loaded in the case of the 8 h samples. The anti-HA (Abcam 18181) and the loading control anti-PSTAIR (Abcam 10345) primary antibodies are both mouse IgG monoclonal and are recognized by the same secondary antibody (IRDye 800CW donkey antimouse IgG polyclonal; LI-COR 926-32212), while the anti-Myc (Abcam 9106) is a rabbit IgG polyclonal that can be probed with IRDye 680RD goat anti-rabbit IgG polyclonal (LI-COR 92668071). Each blot was first probed for Myc and HA, their secondary antibodies visualized on different channels using the Odyssey infrared imaging system (LI-COR Biosciences), allowing for individual or simultaneous visualization of expression of the CYP and the CPR. The

24


Page 24 of 40

Page 25 of 40 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


membrane was then stripped using the NewBlot nitrocellulose stripping buffer (Li-COR 92840030) and probed for the loading control.

Acknowledgements The authors acknowledge the Centre for Microscopy and Cell Imaging funded by Concordia University and the Canada Foundation for Innovation. This study was financially supported by Evolva. VJJM is supported by a Concordia University Research Chair.

Supporting Information 

Table S1. List of CYP/CPR constructs integrated in IS1wild-type at USER site XII-1



Table S2. List of KO-KAH-CPR constructs integrated into kaurene producing IS1



Table S3. List of KO75-KAH82-SrCPR1 copy number modulation constructs integrated into kaurene producing IS1



Percent product yield calculations



Table S4. Primers used to amplify CYP and CPR expression cassettes for integrations



Table S5. Sequences of primers used to amplify CYP and CPR expression cassettes



Figure S1. Fluorescence microscopy imaging of S. cerevisiae IS1 strains expressing CYP-mCherry fusions or CPR-GFP fusions



Figure S2. Percent yields for strains producing steviol de novo



Figure S3. Neighbour-joining phylogenetic trees showing the relationship between test CYPs and CPRs and sequences from different plants



Figure S4. EI-MS spectra for kaurene and an unknown (kaurenal)

25



Author contributions N.D.G., E.F., C.C.H. and V.J.J.M. wrote the manuscript. N.D.G., E.F., V.D. and V.J.J.M. conceived of the experimental design and strategy. N.D.G., E.F., C.C.H. performed strain engineering. N.D.G. performed GC-MS analysis of kaurene. N.D.G., E.F., D.R., and M. Di F. performed LC-MS experiments for analysis of steviol and kaurenoic acid. E.F. performed immunoblotting. C.C.H. carried out phylogenetic analysis. Microscopy imaging was performed as a service by the Centre for Microscopy and Cell Imaging of Concordia University.

References 1. Olsson, K., Carlsen, S., Semmler, A., Simon, E., Mikkelsen, M. D., and Moller, B. L. (2016) Microbial production of next-generation stevia sweeteners. Microb. Cell Fact. 15. 2. Wang, J. F., Li, S. Y., Xiong, Z. Q., and Wang, Y. (2016) Pathway mining-based integration of critical enzyme parts for de novo biosynthesis of steviolglycosides sweetener in Escherichia coli. Cell Res. 26, 258-261. 3. Robertsen, H. L., Andersen, I. N., Takos, A. M., Hallwyl, S. C. L., Ambri, F., Asensio, M. Q., Mikkelsen, M. D., Houghton-Larsen, J., Douchin, V., and Dyekjaer, J. D. Production of steviol glycosides in recombinant hosts. PCT/EP20 15/070620, 2016. 4. Ceunen, S., and Geuns, J. M. C. (2013) Steviol glycosides: chemical diversity, metabolism, and function. J. Nat. Prod. 76, 1201-1228. 5. Espinoza, M. I., Vincken, J. P., Sanders, M., Castro, C., Stieger, M., and Agosin, E. (2014) Identification, quantification, and sensory characterization of steviol glycosides from differently processed Stevia rebaudiana commercial extracts. J. Agr. Food Chem. 62, 11797-11804. 6. Richman, A., Swanson, A., Humphrey, T., Chapman, R., McGarvey, B., Pocs, R., and Brandle, J. (2005) Functional genomics uncovers three glucosyltransferases involved in the synthesis of the major sweet glucosides of Stevia rebaudiana. Plant J. 41, 56-67. 7. Hellfritsch, C., Brockhoff, A., Stahler, F., Meyerhof, W., and Hofmnann, T. (2012) Human psychometric and taste receptor responses to steviol glycosides. J. Agr. Food Chem. 60, 67826793.

26


Page 26 of 40

Page 27 of 40 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


8. Prakash, I., Markosyan, A., and Bunders, C. (2014) Development of next generation stevia sweetener: rebaudioside M. Foods 3, 162-175. 9. Martin, V. J., Pitera, D. J., Withers, S. T., Newman, J. D., and Keasling, J. D. (2003) Engineering a mevalonate pathway in Escherichia coli for production of terpenoids. Nat. Biotechnol. 21, 796-802. 10. Paddon, C. J., Westfall, P. J., Pitera, D. J., Benjamin, K., Fisher, K., McPhee, D., Leavell, M. D., Tai, A., Main, A., Eng, D., Polichuk, D. R., Teoh, K. H., Reed, D. W., Treynor, T., Lenihan, J., Fleck, M., Bajad, S., Dang, G., Dengrove, D., Diola, D., Dorin, G., Ellens, K. W., Fickes, S., Galazzo, J., Gaucher, S. P., Geistlinger, T., Henry, R., Hepp, M., Horning, T., Iqbal, T., Jiang, H., Kizer, L., Lieu, B., Melis, D., Moss, N., Regentin, R., Secrest, S., Tsuruta, H., Vazquez, R., Westblade, L. F., Xu, L., Yu, M., Zhang, Y., Zhao, L., Lievense, J., Covello, P. S., Keasling, J. D., Reiling, K. K., Renninger, N. S., and Newman, J. D. (2013) High-level semi-synthetic production of the potent antimalarial artemisinin. Nature 496, 528-+. 11. Humphrey, T. V., Richman, A. S., Menassa, R., and Brandle, J. E. (2006) Spatial organisation of four enzymes from Stevia rebaudiana that are involved in steviol glycoside synthesis. Plant Mol. Biol. 61, 47-62. 12. Meunier, B., de Visser, S. P., and Shaik, S. (2004) Mechanism of oxidation reactions catalyzed by cytochrome P450 enzymes. Chem. Rev. 104, 3947-3980. 13. Nelson, D., and Werck-Reichhart, D. (2011) A P450-centric view of plant evolution. Plant J. 66, 194-211. 14. Bassard, J. E., Moller, B. L., and Laursen, T. (2017) Assembly of dynamic P450-mediated metabolons-order versus chaos. Curr. Mol. Biol. Rep. 3, 37-51. 15. Laursen, T., Borch, J., Knudsen, C., Bavishi, K., Torta, F., Martens, H. J., Silvestro, D., Hatzakis, N. S., Wenk, M. R., Dafforn, T. R., Olsen, C. E., Motawia, M. S., Hamberger, B., Moller, B. L., and Bassard, J. E. (2016) Characterization of a dynamic metabolon producing the defense compound dhurrin in sorghum. Science 354, 890-893. 16. Backes, W. L., and Kelley, R. W. (2003) Organization of multiple cytochrome P450s with NADPH-cytochrome P450 reductase in membranes. Pharmacol. Therapeut. 98, 221-233. 17. Kenaan, C., Zhang, H. M., Shea, E. V., and Hollenberg, P. F. (2011) Uncovering the role of hydrophobic residues in cytochrome P450-cytochrome P450 reductase interactions. Biochemistry 50, 3957-3967. 18. Shimada, T., Mernaugh, R. L., and Guengerich, F. P. (2005) Interactions of mammalian cytochrome P450, NADPH-cytochrome P450 reductase, and cytochrome b(5) enzymes. Arch. Biochem. Biophys. 435, 207-216.

27



19. Peterson, J. A., Ebel, R. E., O'Keeffe, D. H., Matsubara, T., and Estabrook, R. W. (1976) Temperature dependence of cytochrome P-450 reduction. A model for NADPH-cytochrome P450 reductase:cytochrome P-450 interaction. J. Biol. Chem. 251, 4010-4016. 20. Renault, H., Bassard, J. E., Hamberger, B., and Werck-Reichhart, D. (2014) Cytochrome P450-mediated metabolic engineering: current progress and future challenges. Curr. Opin. Plant Biol. 19, 27-34. 21. Elahian, F., Sepehrizadeh, Z., Moghimi, B., and Mirzaei, S. A. (2014) Human cytochrome b5 reductase: structure, function, and potential applications. Crit. Rev. Biotechnol. 34, 134-143. 22. Porter, T. D. (2002) The roles of cytochrome b(5) in cytochrome P450 reactions. J. Biochem. Mol. Toxic. 16, 311-316. 23. Trenchard, I. J., and Smolke, C. D. (2015) Engineering strategies for the fermentative production of plant alkaloids in yeast. Metab. Eng. 30, 96-104. 24. Cawley, G. F., Batie, C. J., and Backes, W. L. (1995) Substrate-dependent competition of different P450 isozymes for limiting NADPH-cytochrome P450 reductase. Biochemistry 34, 1244-1247. 25. Kenaan, C., Shea, E. V., Lin, H. L., Zhang, H. M., Pratt-Hyatt, M. J., and Hollenberg, P. F. (2013) Interactions between CYP2E1 and CYP2B4: effects on affinity for NADPH-cytochrome P450 reductase and substrate metabolism. Drug. Metab. Dispos. 41, 101-110. 26. Connick, J. P., Reed, J. R., and Backes, W. L. (2017) Physical complexes formed by CYP1A2 and CYP2B4 are associated with altered P450 activity. FASEB J. 31, 669.668. 27. Davydov, D. R., Davydova, N. Y., Sineva, E. V., and Halpert, J. R. (2015) Interactions among cytochromes P450 in microsomal membranes: Oligomerization of cytochromes P450 3A4, 3A5, and 2E1 and its functional consequence. J. Biol. Chem. 290, 3850-3864. 28. Dragan, C. A., Blank, L. M., and Bureik, M. (2006) Increased TCA cycle activity and reduced oxygen consumption during cytochrome P450-dependent biotransformation in fission yeast. Yeast 23, 779-794. 29. Kenaan, C., Shea, E. V., Zhang, H. M., Pratt-Hyatt, M., and Hollenberg, P. F. (2011) CYP2E1 competes with CYP2B4 for limited NADPH-cytochrome P450 reductase. FASEB J. 25. 30. Estabrook, R. W., Franklin, M. R., Cohen, B., Shigamatzu, A., and Hildebrandt, A. G. (1971) Biochemical and genetic factors influencing drug metabolism. Influence of hepatic microsomal mixed function oxidation reactions on cellular metabolic control. Metabolism 20, 187-199. 31. Shephard, E. A., Phillips, I. R., Bayney, R. M., Pike, S. F., and Rabin, B. R. (1983) Quantification of NADPH: cytochrome P-450 reductase in liver microsomes by a specific radioimmunoassay technique. Biochem. J. 211, 333-340.

28


Page 28 of 40

Page 29 of 40 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


32. Ignea, C., Athanasakoglou, A., Andreadelli, A., Apostolaki, M., Iakovides, M., Stephanou, E. G., Makris, A. M., and Kampranis, S. C. (2017) Overcoming the plasticity of plant specialized metabolism for selective diterpene production in yeast. Sci. Rep. 7. 33. Guo, J., Zhou, Y. J., Hillwig, M. L., Shen, Y., Yang, L., Wang, Y., Zhang, X., Liu, W., Peters, R. J., Chen, X., Zhao, Z. K., and Huang, L. (2013) CYP76AH1 catalyzes turnover of miltiradiene in tanshinones biosynthesis and enables heterologous production of ferruginol in yeasts. Proc. Natl. Acad. Sci. 110, 12108-12113. 34. Scheler, U., Brandt, W., Porzel, A., Rothe, K., Manzano, D., Bozic, D., Papaefthimiou, D., Balcke, G. U., Henning, A., Lohse, S., Marillonnet, S., Kanellis, A. K., Ferrer, A., and Tissier, A. (2016) Elucidation of the biosynthesis of carnosic acid and its reconstitution in yeast. Nat. Commun. 7, 12942. 35. Pateraki, I., Andersen-Ranberg, J., Jensen, N. B., Wubshet, S. G., Heskes, A. M., Forman, V., Hallstrom, B., Hamberger, B., Motawia, M. S., Olsen, C. E., Staerk, D., Hansen, J., Moller, B. L., and Hamberger, B. (2017) Total biosynthesis of the cyclic AMP booster forskolin from Coleus forskohlii. Elife 6. 36. Zhang, M., Le Clair, S. V., Huang, R., Ahuja, S., Im, S. C., Waskell, L., and Ramamoorthy, A. (2015) Insights into the role of substrates on the interaction between cytochrome b(5) and cytochrome P450 2B4 by NMR. Sci. Rep. 5. 37. Im, S. C., and Waskell, L. (2011) The interaction of microsomal cytochrome P450 2B4 with its redox partners, cytochrome P450 reductase and cytochrome b(5). Arch. Biochem. Biophys. 507, 144-153. 38. Li, M. J., Schneider, K., Kristensen, M., Borodina, I., and Nielsen, J. (2016) Engineering yeast for high-level production of stilbenoid antioxidants. Sci. Rep. 6. 39. Mikkelsen, M. D., Hansen, J., Simon, E., Brianza, F., Semmler, A., Olsson, K., Carlsen, S., Düring, L., Ouspenski, A., and Hicks, P. Methods for improved production of rebaudioside D and rebaudioside M. US 14/761,629, 2016. 40. Kishore, G. M., Motion, M., Hicks, P. M., Hansen, J., Houghton-Larsen, J., Hansen, E. H., Mikkelsen, M. D., Tavares, S., and Blom, C. Recombinant production of steviol glycosides. PCT/US2011/038967, 2011. 41. Houghton-Larsen, J., Hicks, P. M., Naesby, M., Ostergaard, T. T., Hansen, J., Dalgaard, M. M., Halkjaer, H. E., and Simon, E. Recombinant production of steviol glycosides. PCT/US2012/050021, 2012. 42. Kumar, S., Stecher, G., and Tamura, K. (2016) MEGA7: molecular evolutionary genetics analysis version 7.0 for bigger datasets. Mol. Biol. Evol. 33, 1870-1874.

29



43. Krogh, A., Larsson, B., von Heijne, G., and Sonnhammer, E. L. (2001) Predicting transmembrane protein topology with a hidden Markov model: application to complete genomes. J. Mol. Biol. 305, 567-580. 44. Pyne, M. E., Narcross, L., Fossati, E., Bourgeois, L., Burton, E., Gold, N. D., and Martin, V. J. J. (2016) Reconstituting plant secondary metabolism in Saccharomyces cerevisiae for production of high-value benzylisoquinoline alkaloids. Methods Enzymol. 575, 195-224. 45. Mikkelsen, M. D., Buron, L. D., Salomonsen, B., Olsen, C. E., Hansen, B. G., Mortensen, U. H., and Halkier, B. A. (2012) Microbial production of indolylglucosinolate through engineering of a multi-gene pathway in a versatile yeast expression platform. Metab. Eng. 14, 104-111. 46. Flagfeldt, D. B., Siewers, V., Huang, L., and Nielsen, J. (2009) Characterization of chromosomal integration sites for heterologous gene expression in Saccharomyces cerevisiae. Yeast 26, 545-551. 47. DiCarlo, J. E., Norville, J. E., Mali, P., Rios, X., Aach, J., and Church, G. M. (2013) Genome engineering in Saccharomyces cerevisiae using CRISPR-Cas systems. Nucleic Acids Res. 41, 4336-4343. 48. Gietz, R. D., and Schiestl, R. H. (2007) High-efficiency yeast transformation using the LiAc/SS carrier DNA/PEG method. Nat. Protoc. 2, 31-34. 49. Geu-Flores, F., Nour-Eldin, H. H., Nielsen, M. T., and Halkier, B. A. (2007) USER fusion: a rapid and efficient method for simultaneous fusion and cloning of multiple PCR products. Nucleic Acids Res. 35.

30


Page 30 of 40

Page 31 of 40 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Table 1. Heterologous genes used in this study Gene GGPPS7 tCPPS5 AtKS5 55-CPPS-KS-6 SrKO (CYP701A5) KO75 (CYP701) SrKAH (CYP81) KAH82 (CYP72) SrCPR1 SrCPR7 SrCPR8 CPR12 ATR2

Function or activity Geranylgeranyl pyrophosphate synthase Truncated copalyl pyrophosphate synthase Kaurene synthase CPPS-KS bifunctional Kaurene oxidase Kaurene oxidase Kaurenoic acid hydroxylase Kaurenoic acid hydroxylase Cytochrome P450 reductase Cytochrome P450 reductase Cytochrome P450 reductase Cytochrome P450 reductase Cytochrome P450 reductase

31


Promoter/terminator pALD4 pTEF1 pPGK1 pHXT7 pTEF1/tPGI1 pTEF1/tPGI1 pFBA1/tADH1 pFBA1/tADH1 pPMA1/tTPI1 pPMA1/tTPI1 pPMA1/tTPI1 pPMA1/tTPI1 pPMA1/tTPI1


Figure Legends Figure 1. (A) Reaction scheme for conversion of the tetracyclic diterpene kaurene to steviol by two cytochrome P450 enzymes in succession. Kaurene oxidase (KO) hydroxylates the C19 position of kaurene, forming kaurenol, which it then further oxidizes to kaurenal and then to kaurenoic acid. Kaurenoic acid hydroxylase (KAH) then hydroxylates the C13 position of kaurenoic acid, giving rise to steviol. KO and KAH require the support of a NADPH-dependent cytochrome P450 reductase (CPR) to provide electrons for fixation of molecular oxygen. The affected carbon at each step is highlighted in blue. (B) Recombinant steviol glucoside pathway in Saccharomyces cerevisiae. Mevalonate pathway products farnesyl pyrophosphate (FPP) and isopentenyl pyrophosphate (IPP) are condensed by geranylgeranyl pyrophosphate synthase (GGPPS) to form GGPP. GGPP is then converted to copalyl pyrophosphate (CPP) by CPP synthase (CPPS), and then to kaurene by kaurene synthase (KS). Kaurene-to-steviol conversion by KO and KAH is supported by a NADPH-dependent cytochrome P450 reductase (CPR). KO, KAH and CPR are bound to the endoplasmic reticulum. Steviol can then be decorated by various UDP glucose-dependent glucosyltransferases (UGTs) to form steviol glucosides. Other abbreviations: Acetyl-CoA, acetyl coenzyme A; DMAPP, dimethylallyl pyrophosphate; GPP, geranyl pyrophosphate; NADPH, nicotinamide adenine dinucleotide phosphate. Figure 2. In vivo activity of individual CYP-CPR combinations by substrate supplementation at the time of inoculation. CYP or CYP-CPR combinations were expressed in S. cerevisiae IS1 wild type. Strains were grown for 4 days in the presence of the appropriate substrate. Concentration values for the product (right y-axis) are averaged from clonal biological replicates (n=3), with error bars representing ±95% confidence intervals. Percent yield values (left y-axis) were calculated as 100% x product concentration / substrate concentration. The endogenous yeast CPR Ncp1 was present in all strain iterations. (A) Strains expressing a KO alone or with a heterologous CPR were grown in the presence of 100 µM kaurene as substrate. Kaurenoic acid (KA) is the product of KO activity. (B) Strains expressing a KO alone or with a heterologous CPR were grown in the presence of 150 µM kaurenoic acid as substrate. Steviol is the product of KAH activity. Figure 3. Evaluation of CYPs and CPRs co-expressed in S. cerevisiae IS1 wild type. (A) Subcellular (co)localization of CYP-mCherry fusions and CPR-GFP fusions in early log phase by fluorescence microscopy. For each CYP-CPR combination, the red (mCh) and green (GFP) channels are shown as grayscale images for the CYP and CPR fusions, respectively. Scale bar is 5 µm. White arrows indicate an example of the perinuclear space for the SrKO-SrCPR7 strains. A yellow arrow shows an example of a fraction of SrKO that did not coincide with SrCPR7 signal. (B) Protein expression and presence up to 3 days by immunoblot. Highest MW band(s) corresponding to the expected size for each full-length protein is shown over 4 time points: 8, 24, 48 and 72 h. Anti-PSTAIR for cyclin-dependent kinases was used as loading control (ctrl). Grey boxes indicate immunoblots collected in a separate experiment under identical conditions. Figure 4. KAH82 substrate supplementation assays. Concentration values are averaged from clonal biological replicates (n=3), with errors expressed as 95% confidence intervals. (A) KAH82-CPR stability by activity test with staggered addition of substrate. KAH82 paired with SrCPR1, SrCPR7, CPR12, or no CPR (native yeast CPR Ncp1) was grown in batch YPD.

32


Page 32 of 40

Page 33 of 40 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Substrate (100 µM kaurenoic acid) was added at either time 0, 14, 24, 41, or 48 h. Cultures were sampled at 6 days and analyzed for steviol production. (B) CPR competition for KAH82 at 4 days. Substrate (150 µM kaurenoic acid) was added at time of inoculation. The steviol production of strains coexpressing KAH82 and SrCPR1, SrCPR7, SrCPR8 or CPR12 was compared without and with a copy of ATR2 added. KAH82-ATR2 was included as control. Strains were grown as batch YPD cultures and sampled at 4 days. Figure 5. Optimization strategies of KO-KAH-CPR combinations in S. cerevisiae strains producing kaurene in vivo. Strains were grown as YPD batch cultures and sampled at 7 days for production of steviol (red), kaurenoic acid (KA; yellow), kaurenal (green), and kaurene (blue). Values are averaged from clonal biological replicates (n=3), with error bars representing ±95% confidence intervals. Red brackets show significant differences in steviol (p < 0.05) between adjacent columns. (A) KO-KAH-CPR strains in ascending order of steviol output, left to right. Combinations including SrKAH-SrCPR1 were significantly better than any other. (B) Modulation of gene copy number for the KO75-KAH82-SrCPR1 combination. Strains in ascending order of steviol output, left to right. Figure 6. Time course data for kaurene producing IS1 alone or expressing SrKO-SrCPR1 or SrKO-KAH82-SrCPR1. Fraction of kaurene (blue), kaurenal (green), kaurenoic acid (yellow), or steviol (red) detected in supernatant (light color) versus whole cell broth (dark color).

33



Fig 1. Reaction scheme for conversion of the tetracyclic diterpene kaurene to steviol by two cytochrome P450 enzymes in succession 175x145mm (300 x 300 DPI)


Page 34 of 40

Page 35 of 40 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Fig 2.In vivo activity of individual CYP-CPR combinations by substrate supplementation at the time of inoculation 58x74mm (300 x 300 DPI)



Fig 3. Evaluation of CYPs and CPRs co-expressed in S. cerevisiae IS1 wild type 177x232mm (300 x 300 DPI)


Page 36 of 40

Page 37 of 40 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Fig 4. KAH82 substrate supplementation assays 75x82mm (300 x 300 DPI)



Fig 5. Optimization strategies of KO-KAH-CPR combinations in S. cerevisiae strains producing kaurene in vivo 95x100mm (300 x 300 DPI)


Page 38 of 40

Page 39 of 40 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Fig 6. Time course data for kaurene producing IS1 alone or expressing SrKO-SrCPR1 or SrKO-KAH82SrCPR1 101x77mm (300 x 300 DPI)



Graphic ToC


Page 40 of 40

A Combinatorial Approach To Study Cytochrome P450 Enzymes for

Recommend Documents