A Practical and High-Affinity Fluorescent Probe for Uridine

Article Cite This: J. Med. Chem. 2017, 60, 9664−9675

pubs.acs.org/jmc

A Practical and High-Affinity Fluorescent Probe for Uridine Diphosphate Glucuronosyltransferase 1A1: A Good Surrogate for Bilirubin Xia Lv,†,‡,§,○ Lei Feng,∥,⊥,○ Chun-Zhi Ai,§ Jie Hou,∥,⊥ Ping Wang,†,§ Li-Wei Zou,†,§ Jie Cheng,# Guang-Bo Ge,*,†,§ Jing-Nan Cui,⊥ and Ling Yang*,† †

Institute of Interdisciplinary Medicine, Shanghai University of Traditional Chinese Medicine, Shanghai 201203, China College of Life Science, Dalian Minzu University, Dalian 116600, China § Dalian Institute of Chemical Physics, Chinese Academy of Sciences, Dalian 116023, China ∥ Dalian Medical University, Dalian 116044, China ⊥ State Key Laboratory of Fine Chemicals, Dalian University of Technology, Dalian 116024, China # Center for Drug Evaluation and Research, Food and Drug Administration, Silver Spring, Maryland 20903, United States ‡

S Supporting Information *

ABSTRACT: This study aimed to develop a practical and high-affinity fluorescent probe for uridine diphosphate glucuronosyltransferase 1A1 (UGT1A1), a key conjugative enzyme responsible for the elimination and detoxification of many potentially harmful compounds. Several substrates derived from N-butyl-4-phenyl-1,8-naphthalimide were designed and synthesized on the basis of the substrate preference of UGT1A1 and the principle of photoinduced electron transfer (PET). Following the preliminary screening, substrate 2 was found with a high specificity and high affinity toward UGT1A1, while such biotransformation brought remarkable changes in fluorescence emission. Both inhibition kinetic analyses and molecular docking simulations demonstrated that 2 could bind on UGT1A1 at the same ligand-binding site as bilirubin. Furthermore, this newly developed probe was successfully used for sensing UGT1A1 activities and the high-throughput screening of UGT1A1 modulators in complex biological samples. In conclusion, a practical and high-affinity fluorescent probe for UGT1A1 was designed and well-characterized, which could serve as a good surrogate for bilirubin to investigate UGT1A1-ligand interactions.

■

INTRODUCTION The uridine diphosphate glucuronosyltransferases enzymes (UGTs) are a superfamily of endoplasmic reticulum-bound enzymes, which catalyze the conjugation of a glucuronic acid moiety from the donor uridine diphosphate-glucuronic acid (UDPGA) to a variety of compounds, thus forming watersoluble glucuronides that are more easily eliminated.1,2 In humans, more than 20 UGTs have been identified, and the majority of UGTs are located in the liver.2,3 Among them, UGT1A1 has drawn much attention from both industrial and academic scientists, due to its pivotal roles in the metabolic elimination and detoxification of a host of potentially harmful compounds (such as bilirubin) and clinical drugs (such as etoposide and SN-38, the active metabolite of CPT-11).2,4,5 Many previous studies have demonstrated that genetics and environmental factors could strongly affect the expression or function of UGT1A1, which may result in reduced expression/ activity of UGT1A1 and lead to an increased risk of bilirubin metabolism disorders, such as hyperbilirubinemia, jaundice, and liver damage.6,7 Furthermore, it has been reported that many clinical drugs or natural compounds in herbs or foods are © 2017 American Chemical Society

potent UGT1A1 inhibitors, which may affect the glucuronidation rate of bilirubin or UGT1A1 substrate drugs and thus lead to some undesirable effects.8−13 The large interindividual variability in both expression and function of UGT1A1 strongly affects the metabolic clearance of bilirubin and the treatment outcomes of UGT1A1 substrates.14 Therefore, the practical methods for the precise measurement of UGT1A1 activities in complex biological samples and for the screening of UGT1A1 modulators are always desirable. In the past decade, several methods, including antibodybased assays and mass spectrometry-based proteomic techniques, have been developed for UGT1A1 quantification.15−18 However, these techniques are usually time-consuming and require expensive instruments and highly trained personnel, which make these techniques unfeasible for high-throughput detection. Furthermore, these methods can only evaluate the protein level rather than the real activity of the target enzyme. In contrast to antibody-based and mass spectrometry-based Received: August 2, 2017 Published: November 10, 2017 9664

DOI: 10.1021/acs.jmedchem.7b01097 J. Med. Chem. 2017, 60, 9664−9675

Journal of Medicinal Chemistry

Article

cellent specificity toward human UGT1A1 over other human UGT isoforms. 2 could be readily glucuronidated by UGT1A1 and form a stable glucuronide (5, NHPNG), which brought remarkable changes in fluorescence emission. These preliminary findings prompted us to fully characterize the performance and the applicability of 2 for highly selective sensing UGT1A1 activities, as well as for the high-throughput screening of UGT1A1 modulators in complex biological samples.

techniques, activity-based enzymatic sensors or substrates can selectively and directly measure the enzymatic activities of a target enzyme in complex biological samples and thus have attracted increasing attention in recent years.19−21 Although bilirubin and several therapeutic drugs (such as ethinyloestradiol and etoposide) could be served as probe substrates to measure the enzymatic activity of UGT1A1, some deficiencies of these known UGT1A1 substrates (e.g., poor chemical stability of bilirubin and bilirubin glucuronides, poor selectivity of some UGT1A1 probe substrates, and low-throughput detection for those nonfluorescent substrates) strongly limited their applications in UGT1A1 quantification in real samples.22 Thus, it is urgent to develop more practical probe substrates for the precise measurement of the real activities of UGT1A1 in complex biological samples. In contrast to traditional probe substrates, optical probe substrates have attracted increasing attention in the past decade, due to their inherent advantages including high sensitivity, easy management, and high-throughput detection.23−28 Unfortunately, the highly selective fluorescent probe substrates for UGT1A1 are rarely reported, due to the following challenges in the design and development of UGT1A1 fluorescent probes. First, the fluorescence properties of many fluorophores are often “turned-off” or “blue-shifted” following UGT1A1-mediated O-glucuronidation, which is unbeneficial for the precise measurement of the corresponding glucuronides in complex biological samples.29,30 Second, the members of the UGT1A subfamily have high amino acid sequence homology, and their substrate spectra are highly overlapped, which makes the development of the isoformspecific probe for a given UGT isoenzyme very challenging.6 Recently, a ratiometric fluorescent probe (1, NCHN) for UGT1A1 was developed by us, which provided a novel tool for rapid screening of UGT1A1 modulators using microplate reader-based assays.29 However, 1 displayed a very low affinity toward UGT1A1, while the inhibitory effects of some known UGT1A1 inhibitors on 1-O-glucuronidation was not highly consistent with that on bilirubin-glucuronidation.29,31 Recent investigations on inhibition kinetics clearly demonstrated that the binding site of 1 on UGT1A1 was distinct from the binding site of bilirubin, which was the most important physiological relevant and high-affinity substrate for UGT1A1.31 Taking into account that UGT1A1 has multiple ligand-binding sites,32,33 it is necessary to develop a novel fluorescent probe to replace bilirubin for highly selective sensing UGT1A1 activities and for the high-throughput screening and characterization of UGT1A1 modulators in complex biological samples. This study aimed to develop a novel fluorescent probe to replace bilirubin for the screening and characterization of UGT1A1 modulators and for highly selective and sensitive sensing the real activities of UGT1A1 in complex biological samples. Taking into account that UGT1A1 preferred to catalyze O-glucuronidation toward bulky polycyclic phenolic compounds, a bulky skeleton (N-butyl-4-phenyl-1,8-naphthalimide) was selected to construct potential“turn-on” fluorescent sensors for UGTs.34 In contrast to the first generation fluorescent probe for UGT1A1 (1), the π-conjugate resonance of N-butyl-4-phenyl-1,8-naphthalimide was elongated, while the substrate volume was expanded and the hydrophobicity was also improved. These features might be beneficial for improving the specificity and affinity toward UGT1A1. Following the preliminary screening, it was found that N-butyl-4-(4hydroxyphenyl)-1,8-naphthalimide (2, NHPN) displayed ex-

■

RESULTS AND DISCUSSION Synthesis and Screening of Potential Probes for UGT1A1. In order to get a good photoinduced electron transfer (PET)-type fluorescent sensor, three phenolic compounds deriving from N-butyl-4-phenyl-1,8-naphthalimide were synthesized and then screened using a panel of human UGTs (Scheme 1). Following the specificity screening by a Scheme 1. Synthetic Route of 2, 3, and 4

panel of human UGTs, we found that 2 could be selectively metabolized by UGT1A1 and one stable monoglucuronide was detected (Figures S1−S3 and Table S1). In contrast, the isoform selectivity of other derivatives including N-butyl-4-(3hydroxyphenyl)-1,8-naphthalimide (3) and N-butyl-4-(2-hydroxyphenyl)-1,8-naphthalimide (4) was more than 10-fold lower than that of compound 2, suggesting that the position of the phenolic group was a key factor affecting the enzyme specificity. Under experimental conditions (pH value close to 7.1 at 37 °C), the fluorescence of 2 was extremely low, but its metabolite (5) exhibited very strong fluorescent signals. This finding suggested that 2 may be a PET-type sensor and that the PET effects could be blocked following O-glucuronidation, which would trigger remarkable changes on fluorescence emission. Further investigations demonstrated that the fluorescence intensity of 2 was very sensitive to pH values, and the fluorescence intensity of 2 was extremely low when the pH values were over 6.0 (Figure S4). By contrast, the fluorescence intensity of the glucuronide (5) was relatively stable over the pH ranges of 1.5−11.5 (Figure S4). The effects of solvent viscosity on the fluorescence intensity of 2 was also investigated, and the result showed that the fluorescence signals of 2 was insensitive to solvent viscosity (Figure S5). All of these findings suggested that 2 was a classic PET-type fluorescent sensor. Such properties made 2 to serve as a “turn-on” fluorescent probe substrate for UGT1A1 on the basis of the PET mechanism. The fluorescence off-on switch could be triggered by UGT1A1-mediated O-glucuronidation of 2 in the presence of UDPGA (Scheme 2). Specificity of 2 toward UGT1A1. Specificity was one of the most important properties affecting the performance and 9665



Article

Scheme 2. Structure of 2 and the Proposed Mechanism for Sensing UGT1A1 Activity

Figure 1. Specificity of 2-O-glucuronidation. (a) The formation rates of 2-O-glucuronide in various human UGT isoforms (0.06 mg/mL). (b) The inhibitory effects of selective UGTs inhibitors PPT (100 μM), NP (10 μM), fluconazole (500 μM), magnolol (1 μM), hecogenin (10 μM), and GA (20 μM) on 2-O-glucuronidation in pooled human liver microsomes (HLMs).

utilization of a fluorescent probe in complex biological systems. To evaluate the specificity of 2 toward UGT1A1, a panel of human UGT isoforms was used in parallel under the same conditions. The reaction phenotyping assays demonstrated that UGT1A1 was the only UGT isoform that participated in 2-Oglucuronidation, while other UGTs trigger negligible changes in fluorescence intensity (Figure 1a). In addition, 2-O-glucuronidation could be strongly inhibited (approximately 90% loss of the control) by two known UGT1A1 inhibitors including 20(S)-protopanaxatriol (PPT, a potent inhibitor of UGT1A1 and UGT2B7 with the Ki value of 8.8 and 2.2 μM for UGT1A1 and UGT2B7, respectively) and nilotinib (NP, a potent and selective inhibitor of UGT1A1 with the Ki value of 0.53 μM).35,36 In contrast, the chemical inhibitors for other UGTs, including magnolol (a potent and selective inhibitor of UGT1A9 with the Ki value of 45 nM),37 fluconazole (a potent and selective inhibitor of UGT2B7 with the Ki value of 529 μM),38 hecogenin (a potent and selective inhibitor of UGT1A4 with the IC50 value of 1.5 μM),39 and glycyrrhetinic acid (GA, a potent and selective inhibitor of UGT1A3 and UGT2B7 with the Ki values of 0.2 and 1.7 μM, respectively),40 exhibited minor inhibitory effects on this glucuronidation reaction (Figure 1b). Moreover, the fluorescence performance of 2 toward UGT1A1 was hardly influenced by common biological metallic ions or amino acids in human tissues or fluids (Figure S6). All of these findings clearly demonstrated that 2 displayed excellent specificity for UGT1A1 over other human UGTs and thus held great promise for the highly selective sensing of UGT1A1 activities in complex biological samples.

Identification of the Ligand Binding Site(s) of 2 on UGT1A1. Many previous studies have revealed that UGT1A1 contains at least two ligand-binding sites.32,33,41 However, the binding site(s) of various probe substrates on UGT1A1 has rarely been reported. Herein, the inhibition kinetic analyses were performed to investigate the binding site(s) of 2 on UGT1A1. As shown in Figure 2 and Table 1, UGT1A1mediated 2-O-glucuronidation could be competitively inhibited by bilirubin, with the Ki value of 2.20 μM. In contrast, UGT1A1-mediated 1-O-glucuronidation (a ratiometric probe for UGT1A1) could be noncompetitively inhibited by bilirubin, with the Ki value of 2.08 μM. Meanwhile, we also found that 2 functioned as a noncompetitive inhibitor against UGT1A1mediated 1-O-glucuronidation, with the Ki value of 5.02 μM.29 These findings clearly demonstrated that 2 and bilirubin could bind on UGT1A1 at the same ligand-binding site, while 1 could bind on another ligand-binding site of UGT1A1. In addition, 1 and 2 could be used as two different site maker substrates for UGT1A1, which bound on UGT1A1 at two different ligandbinding sites. Taking into account that the inherent advantages of fluorescence assays (such as high sensitivity, easy management, and high-throughput detection), these two fluorescent probe substrates made the investigations on UGT1A1-ligand interactions to be more efficient and less time consuming. Sensing Ability of 2 toward UGT1A1. The absorption and fluorescence emission spectra of 2 with or without UGT1A1 were investigated first. As shown in Figure S7, 2 and its metabolite 5 shared the same absorption spectra, while 2 itself exhibited very weak fluorescence emission under the 9666



Article

Figure 2. Inhibition kinetic type and parameters (Ki) of bilirubin against the UGT1A1-catalyzed 2-O-glucuronidation reaction and UGT1A1catalyzed 1-O-glucuronidation reaction and 2 against the UGT1A1-catalyzed 1-O-glucuronidation reaction. (a, c, e) Lineweaver−Burk plot. (b, d, f) Second plot using the slope obtained from the Lineweaver−Burk plot toward the concentrations of inhibitors.

μg/mL. The detection limit (3σ/slope) of 2 for UGT1A1 was also estimated as 0.48 μg/mL. Such sensitivity is high enough to determine UGT1A1 in HLMs or cell preparations of human hepatocytes. The fluorescence quantum yields of both 2 and 5 were also determined in Tris−HCl−acetonitrile (v/v = 1:1, pH 7.4 at room temperature). As shown in Table S2, the fluorescence quantum yield of 2 was extremely low (Φ = 0.006), but its glucuronide 5 displayed remarkably high fluorescence quantum yields (Φ = 0.492). Moreover, the chemical stability of 2 was also investigated. It was noteworthy that the substrate (2) was very stable at room temperature unprotected from light (Table S3). These findings demonstrated that 2 could be used as a practical “turn on” fluorescent probe for UGT1A1 and could work properly. Enzymatic Kinetics of UGT1A1-Mediated 2-O-Glucuronidation. It is well-known that the enzymatic kinetic parameters are very essential for deep understanding of the ligand−enzyme interactions and for the screening and characterization of inhibitors against the target enzyme.42−45 Herein, the enzymatic kinetics of UGT1A1-mediated 2-Oglucuronidation were characterized in both recombinant human UGT1A1 and HLM. As depicted in Table 2, 2-O-

Table 1. Inhibition Kinetic Parameters of 2 and Bilirubin against UGT1A1 no.

substrate

inhibitor

IC50 (μM)

Ki (μM)

inhibition type

1 2 3

2 1 1

bilirubin bilirubin 2

1.39 1.17 1.33

2.20 2.08 5.02

competitive noncompetitive noncompetitive

experimental conditions (pH value close to 7.1 at 37 °C) without UGT1A1 or UDPGA. In sharp contrast, upon addition of UGT1A1 and the cofactor UDPGA, a significant increase in fluorescence signals around 520 nm was detected. The fluorescence signals around 520 nm are time and UGT1A1 dependent (Figure 3). Following coincubation of 2 with UGT1A1 and UDPGA, a more than 20-fold enhancement in the fluorescence intensity was observed, suggesting that 2 could serve as a “turn-on” fluorescent probe substrate for UGT1A1. Moreover, the linear fluorescence response of 2 toward the target enzyme was also investigated. As shown in Figure 3, the formation rates of 5 in UGT1A1 were linear with the incubation time up to 130 min, while the fluorescence intensity (I520 nm) exhibited a good linearity (R2 = 0.99) to the increasing concentrations of UGT1A1 within the range 0−100 9667



Article

Figure 3. Time and concentration dependent responses of 2 (5 μM) toward UGT1A1. (a) Fluorescence spectra recorded following coincubation of 2 with UGT1A1 (0.07 mg/mL) at different time points. (b) The plot of fluorescence intensity at 520 nm versus reaction time. (c) Fluorescence spectra recorded following coincubation of 2 with different concentrations of UGT1A1 for 60 min. (d) The plot of fluorescence intensity at 520 nm versus UGT1A1 concentration. The excitation wavelength was 370 nm.

than a 9-fold variation in the UGT1A1 activity (8.2−74.0 pmol/min/mg total protein in 14 individual HLMs) was observed among different individuals, which agreed well with the previously reported high variability of the UGT1A1 activity among individual HLMs.47 In order to validate the reliability of the 2-based assays, two currently used probe substrates for UGT1A1 including ethinyloestradiol (EE) and bilirubin were used to probe the UGT1A1 activities in these individual HLMs.48,49 As shown in Figure 4b,c, strong correlations between the formation rates of the 5 and that of EE-3-Oglucuronidation or bilirubin-O-glucuronidation among different individual HLMs were observed, with the Pearson correlation coefficient (R2) of 0.96 and 0.93, respectively. Moreover, a correlation study between the absolute protein levels of UGT1A1 and UGT1A1 activities among 14 individual HLMs was also performed. As expected, a strong correlation (R2 = 0.92) between the formation rates of the 5 and UGT1A1 absolute protein levels in 14 individual HLMs was observed among different individual HLMs (Figure 4d). These findings demonstrated that 2 could be used to accurately measure the real activities of UGT1A1 in complex biological systems. High-Throughput Screening of UGT1A1 Inhibitors. It is well-known that the UGT1A1 inhibitors may slow down the glucuronidation rates of bilirubin and UGT1A1 substrate drugs in vivo and thus bring risks of hyperbilirubinemia, adverse drug−drug interactions (DDI), and drug-induced liver injury.8 As a good surrogate for bilirubin, the 2-based assay has provided a promising tool for the high-throughput screening UGT1A1 inhibitors. Herein, a 2-based high-throughput screening method was constructed for rapid screening of UGT1A1 inhibitors, by using HLM as the enzyme source. 2-OGlucuronidation was used as the probe reaction for UGT1A1 to determine the residual activities of UGT1A1 upon the

Table 2. Kinetic Parameters for 2-O-Glucuronidation in HLM and UGT1A1 enzyme

S50 (μM)

Vmax (pmol/min/mg total protein)

n

CLint (μL/ min/mg total protein)

UGT1A1 HLM

0.7 4.3

561 557

2.3 2.4

393 65.7

glucuronidation in both HLM and UGT1A1 displayed identical kinetic behaviors (sigmoidal) and similar Vmax values (561 pmol/min/mg total protein in UGT1A1 and 557 pmol/min/ mg total protein in HLM). The K m value for 2-Oglucuronidation in UGT1A1 was calculated as 0.7 μM, which was much lower than the reported values for other UGT1A1 probe substrates, such as 1 (126.7 μM) and etoposide (285 μM).29,46 These findings strongly suggested that 2 was a highaffinity substrate for UGT1A1, and it displayed good reactivity in both UGT1A1 and HLM. A summary of currently used probes for UGT1A1 was presented in Table S4; it was evident from this table that both bilirubin and 2 were high-affinity substrates for UGT1A1. However, the poor chemical stability of bilirubin and bilirubin glucuronides, the commercial unavailability of bilirubin glucuronides, and the low-throughput detection strongly limited the wide applications of bilirubin in the screening of UGT1A1 inhibitors and UGT1A1-ligand interactions. In sharp contrast, 2 displayed an excellent specificity and high-affinity toward UGT1A1, good stability, and sensitivity, which made it a good surrogate for bilirubin. Quantification of UGT1A1 in Biological Samples. Encouraged by the above-mentioned results, we subsequently employed 2-O-glucuronidation as the probe reaction to quantify UGT1A1 in complex biological samples. Figure 4a depicted the UGT1A1 activities in 14 HLM samples from different individuals. It was evident from Figure 4a that more 9668



Article

Figure 4. (a) UGT1A1 activity in 14 individual HLMs probed with 2-O-glucuronidation. (b) Correlation analysis between the rate of 2-Oglucuronidation and that of bilirubin-O-glucuronidation and (c) that of EE-3-O-glucuronidation in 14 individual HLMs. (d) Correlation analysis between the rate of 2-O-glucuronidation and the absolute protein level of UGT1A1 in 14 individual HLMs.

Figure 5. Dose-dependent inhibition curves of PPT (a) and NP (b) on O-glucuronidation of 2 in both HLM and recombinant UGT1A1.

Figure 6. (a) mRNA expression of UGT1A1 and (b) 2-O-glucuronidation activities in cell homogenates prepared from HepG2 cells pretreated with chrysin (0, 25, 50 μM).

showed that HLM could be used as the enzyme source instead of expensive recombinant UGT1A1 for the screening of UGT1A1 inhibitors, which was very helpful for cost reduction in the discovery of UGT1A1 inhibitors. Furthermore, the

addition of various compounds, including UGT1A1 substrates and therapeutic drugs. As depicted in Figure 5, the inhibitory tendency and the IC50 values of PPT (a) and NP (b) in both HLM and UGT1A1 were very similar. These results clearly 9669



Article

Figure 7. A stereo view of the binding conformations of bilirubin, 1, and 2 in the active cavity of UGT1A1. The carbon atoms in the three molecules (bilirubin, 1, and 2) were colored in magenta, cyan, and white, respectively. UDPGA was shown in ball and stick type. (a) A stereo view and (b) a detailed view of the crystal structure of modeling UGT1A1 and the stereo diagram of bilirubin, 1, and 2 aligned in its corresponding ligand-binding site.

inhibitory effects of more compounds on UGT1A1 were rapidly assayed, and the data were listed in Table S5. The results were similar to the previously reported data using 4-MU as the UGT1A1 substrate and using UGT1A1 as the enzyme source.9,35,36,50,51 All of these data clearly showed that 2 could serve as a practical probe for UGT1A1 for the high-throughput screening of UGT1A1 inhibitors, by using tissue preparation as an enzyme source. Screening of UGT1A1 Inducers. Since UGT1A1 is a key enzyme responsible for the detoxification of xenobiotics and endogenous compounds, UGT1A1 induction may be beneficial for the treatment of UGT1A1 deficiencies (such as neonatal jaundice) and for the prevention of severe toxicity of some therapy drugs (such as the toxicity of irinotecan).52 In this study, to demonstrate the practicability of 2 to screen UGT1A1 inducers, HepG2 cells are selected as the model cells due to their relatively high expression of UGT1A1, while chrysin is used as the positive inducer of UGT1A1.53,54 Notably, the PET effect can be blocked due to the fact that the phenol group of the probe can not become a phenoxy anion at the low pH value of some subcellular organelles in living cells; therefore, the probe itself could exhibit relatively strong fluorescence signals, making it difficult to precisely quantify the levels of UGT1A1 in living cells. In these cases, homogenates from HepG2 cells with or without chrysin were collected, and then the mRNA levels and the catalytic activities of UGT1A1 were assayed. As shown in Figure 6, the mRNA levels and catalytic activities of UGT1A1 could be simultaneous induced by chrysin via a dosedependent manner. These results demonstrated that 2 could be used as a practical tool for rapid screening of UGT1A1 inducers and determining the changes in real activities of UGT1A1 in cell preparations. Molecular Docking Simulations. In order to gain a deep insight into the interactions between UGT1A1 and 2 and to explore the potential ligand-binding site of 2 on human UGT1A1, molecular docking simulations were performed using a homology model of human UGT1A1. 2 and two other UGT1A1 probe substrates including bilirubin and 1 were docked into the cavity of UGT1A1 using Surflex-Dock. As shown in Figure 7, bilirubin, 1, and 2 could be well-docked into the catalytic cavity of UGT1A1, while the binding areas of bilirubin and 2 on UGT1A1 are highly overlapped (ligandbinding site I, surrounded by His38, Leu95, His173, Ala174, Leu175, Try192, Leu255, Phe256, Ser375, His376, Asp396, Gln397, Asp399, etc.). In contrast, 1 could occupy another

ligand-binding site of UGT1A1 (ligand-binding site II, surrounded by Glu289, Phe290, Trp354, Asp359, Ser309, Gln357, Asn358, Asp359, etc.). This finding was consistent with the inhibition kinetics that bilirubin functioned as a strong competitive inhibitor against UGT1A1-mediated 2-O-glucuronidation. The experimental results combined with the molecular docking evidence suggested that the ligand-binding site of 2 on UGT1A1 was identical to that of bilirubin. These findings strongly suggested that 2 could be used as a good surrogate for bilirubin in the investigations on the interactions between UGT1A1 and its ligands. In addition, 1 and 2 could be used as a couple of site-specific markers of UGT1A1 for future investigations on UGT1A1-ligand interactions, owing to these two optical probe substrates that could bind on UGT1A1 at two different ligand-binding sites. All of these findings laid a solid foundation for identification and characterization of the ligand-binding sites of UGT1A1 substrates or inhibitors, which were very helpful for a deep understanding of UGT1A1mediated DDI.

■

EXPERIMENTAL SECTION

Reagents and Materials. 2 and its glucuronidation product 2glucuronide (5) were synthesized by the author Lei Feng and Xia Lv, respectively. Brij58, MgCl2, UDPGA, and fluconazole were purchased from Sigma-Aldrich (St. Louis, MO, USA). Bilirubin, ethinyloestradiol, and nilotinib were obtained from Alfa Aesar (Shanghai, China). Protopanaxatriol, chrysin magnolol, hecogenin, and glycyrrhetinic acid were purchased from Chengdu Pufei De Biotech Co., Ltd. (Chengdu, Sichuan, China). All compounds had ≥95% purity using the LC methods described in the Supporting Information. The 12 recombinant human UGT isoforms (UGT1A1, UGT1A3, UGT1A4, UGT1A6, UGT1A7, UGT1A8, UGT1A9, UGT1A10, UGT2B4, UGT2B7, UGT2B15, and UGT2B17) were expressed in baculovirus-infected insect cells and purchased from BD Biosciences (Woburn, MA, USA). HLMs from 50 donors were obtained from Celsis Inc. (Baltimore, USA), and 14 individual HLMs with diverse UGT activities were ordered from the Research Institute for Liver Diseases (RILD, Shanghai, China). HepG2 cells (human hepatocellular liver carcinoma cell line) were purchased from the Committee on Type Culture Collection of Chinese Academy of Sciences (Shanghai, China). RNAiso Plus reagent kit, PrimeScript RT Master Mix reagent kit, and SYBR Premix Ex TaqII reagent kit were purchased from Takara Bio (Shiga, Japan). Primers (UGT1A1 forward primer, CCTTGCCTCAGAATTCCTTC; UGT1A1 reverse primer, ATTGATCCCAAAGAGAAAACCAC; GAPDH forward primer, C C AG G G C T G C T T T T A A C T ; GAPDH r everse primer, GCTCCCCCCTGCAAATGA) were commercially synthesized at Takara Bio (Shiga, Japan). UGT1A1 Elisa kit was purchased from 9670



Article

(m, 2H), 1.37 (dd, J = 14.9, 7.4 Hz, 2H), 0.94 (t, J = 7.4 Hz, 3H); 13C NMR (125 MHz, DMSO) δ 163.48, 163.30, 154.94, 144.47, 133.15, 131.12, 130.53, 130.36, 129.94, 129.90, 128.51, 127.53, 126.79, 125.28, 122.22, 121.03, 119.00, 115.93, 39.51, 29.66, 19.76, 13.70; HRMS calcd for C22H18NO3− [M − H]− 344.1292, found 344.1282. N-Butyl-4-(2-hydroxyphenyl)-1,8-naphthalimide (4). A mixture of N-(n-butyl)-4-bromide-1,8-naphthalimide (1 mmol), 3-hydroxy phenylboronic acid (1.5 mmol), Pd(OAc)2 (0.005 mol), K2CO3 (2 mmol), distilled water (5 mL), and iPrOH (5 mL) was stirred at 50 °C for 1 h. The mixture was added to brine (30 mL) and extracted four times with ethyl acetate (4 × 30 mL). The solvent was concentrated under a vacuum, and the product was purified by chromatography (silica gel, EtOAc−hexane as an eluent, 1:5, v/v) to afford 163 mg of 4 as a yellow solid with the yield of 47.2%. The structure of 4 was confirmed by 1H NMR, 13C NMR, and HRMS, and the data are as follows: 1H NMR (500 MHz, DMSO) δ 9.76 (s, 1H), 8.59−8.45 (m, 2H), 8.29 (d, J = 8.5 Hz, 1H), 7.85 (t, J = 7.9 Hz, 1H), 7.77 (d, J = 7.5 Hz, 1H), 7.39 (t, J = 7.8 Hz, 1H), 7.03−6.89 (m, 3H), 4.07 (t, J = 7.3 Hz, 2H), 1.74−1.54 (m, 2H), 1.37 (dd, J = 14.9, 7.4 Hz, 2H), 0.94 (t, J = 7.4 Hz, 3H); 13C NMR (125 MHz, DMSO) δ 163.41, 163.18, 157.51, 146.14, 139.48, 132.20, 130.73, 130.36, 129.83, 129.26, 127.89, 127.69, 127.37, 122.42, 121.20, 120.43, 116.54, 115.47, 39.51, 29.62, 19.76, 13.69; HRMS calcd for C22H18NO3− [M − H]− 344.1292, found 344.1280. Reaction Phenotyping Assays and Chemical Inhibition Assays. The selectivity of 2 toward UGT1A1 was first evaluated by the isoform selectivity assay, in which 12 recombinant human UGT isoforms were used. In brief, a total volume of 100 μL incubations contained 50 mM Tris-HCl buffer (pH 7.4 at room temperature), 5 mM MgCl2, 4 mM UDPGA, 2 (10 μM and 100 μM), and different recombinant human UGT isoforms (0.06 mg/mL). After 3 min of preincubation at 37 °C, the reaction was initiated by the addition of 10 μL of UDPGA. After incubation at 37 °C for 60 min, the reactions were then terminated by the addition of 100 μL of ice-cold acetonitrile followed by centrifugation at 20 000 × g for 20 min. The aliquots of supernatant were then taken for fluorescence measurements. For chemical inhibition assay, a series of UGT isoforms inhibitors including protopanaxatriol (PPT, 100 μM) and nilotinib (NB, 10 μM), glycyrrhetinic acid (20 μM), hecogenin (10 μM), magnolol (1 μM), and fluconazole (200 μM) were selected as positive controls for UGT1A1, UGT1A3, UGT1A4, UGT1A9, and UGT2B7, respectively.35−40 The incubation system was the same as the isoform selectivity assay except that HLM (0.1 mg/mL) was used as the enzyme source and that each inhibitor was added. Inhibition percentage was calculated by dividing the fluorescence intensity of the metabolite formed in the positive controls (incubation containing inhibitor) by that of the negative control (incubation without inhibitor). The IC50 (concentration of tested compounds causing 50% reduction in activity relative to the control) value of PPT and NB for UGT1A1 was also determined in both recombinant human UGTA1 (0.06 mg/mL) and HLM (0.1 mg/mL) using various concentrations of PPT and NB. Enzyme Kinetic Analysis. Kinetic analysis was performed in both human recombinant UGT1A1 and HLM. 2 (0.25−20 μM) was incubated with recombinant UGT1A1 (0.02 mg/mL) or HLM (0.1 mg/mL) at 37 °C for 50 min. The relationship between the concentrations of S and V was plotted, and the kinetic data was fitted to the substrate inhibition (eq 1) or Hill kinetic (eq 2). V is the reaction rate. Vmax is the maximum reaction rate. S is the substrate concentration. Km is the substrate affinity constant. Ksi is the substrate inhibition constant. S50 is the substrate concentration resulting in 50% of Vmax, and n is the Hill coefficient. The apparent kinetic parameters were evaluated by a nonlinear regression using GraphPad Prism 6.0 (San Diego, CA, USA) and expressed as mean ± SD of triplicate samples.

Cloud-Clone Corp. (Houston, TX, USA). All other reagents were of the highest commercially available grade. Instruments. 1H NMR (400 MHz) and 13C NMR (100 MHz) spectra of all newly synthesized derivatives were recorded on a Bruker ARX 400 spectrometer using dimethyl sulfoxide-d6 (DMSO-d6) as a solvent, and tetramethylsilane (TMS) was chosen as an internal standard. 1H NMR (500 MHz) and 13C NMR (150 MHz) spectra of 5 were recorded on a Bruker ARX 500 spectrometer. The highresolution mass spectra (HRMS) were recorded on a Hybrid Ion Trap-Orbitrap mass spectrometer (LTQ Orbitrap XL, Thermo). Elemental analyses were carried out by a Vario ELIII analyzer. Ultrafast liquid chromatography−ultraviolet spectrometry (UFLC) was performed using a UFLC system (Shimadzu, Kyoto, Japan), which was equipped with two LC-20AD pumps, a SIL-20ACHT autosampler, a DGU-20A3 vacuum degasser, a CTO-20AC column oven, a CBM-20A communications bus module, an SPD-M 20A diode array detector, a mass detector (2010EV) with an electrospray ionization (ESI) interface, and a computer equipped with UFLC-MS solution software (version 3.41; Shimadzu). All pH measurements were carried out with a SE20K pH meter (Mettler-Toledo, Switzerland) with a combined glass-calomel electrode. The fluorescence intensity, fluorescence spectra, and absorption spectra were measured with a Synergy H1 Hybrid Multi-Mode Microplate Reader (Bio Tek, USA). Synthesis and Structural Characterization of 2 and Its Analogues. In order to find a highly selective probe for UGT1A1 and to explore the potential structure UGT selectivity relationship, three phenolic compounds deriving from N-butyl-4-phenyl-1,8-naphthalimide were deliberately designed and subsequently synthesized by elongating the π-conjugate resonance of the 1,8-naphthalimide rings. The synthetic route and structural characterization of these newly synthesized derivatives are depicted as follows. The chemical structures of these compounds were fully characterized by 1H NMR, 13 C NMR, high-resolution mass spectrometry, and elemental analysis. The spectroscopic data of these compounds were added in the Supporting Information (Figure S8−16). N-Butyl-4-(4-hydroxyphenyl)-1,8-naphthalimide (2). A mixture of N-(n-butyl)-4-bromide-1,8-naphthalimide (1 mmol), 4-hydroxy phenylboronic acid (1.5 mmol), Pd(OAc)2 (0.005 mol), K2CO3 (2 mmol), distilled water (5 mL), and iPrOH (5 mL) was stirred at 50 °C for 1 h. The mixture was added to brine (30 mL) and extracted four times with ethyl acetate (4 × 30 mL). The solvent was concentrated under a vacuum, and the product was purified by chromatography (silica gel, EtOAc−hexane as an eluent, 1:5, v/v) to afford 158 mg of 2 as a yellow solid with the yield of 48.5%. The structure of 2 was confirmed by 1H NMR, 13C NMR, HRMS, and elemental analysis, and the data are as follows: 1H (400 MHz, DMSO) δ 9.84 (1 H, s), 8.52 (2 H, t, J = 6.9), 8.32 (1 H, d, J = 7.8), 7.84 (1 H, dd, J = 8.4, 7.4), 7.74 (1 H, d, J = 7.6), 7.39 (2 H, d, J = 8.5), 6.98 (2 H, d, J = 8.5), 4.15−4.01 (2 H, t), 1.72−1.56 (2 H, m), 1.42−1.29 (2H, m), 0.93 (3 H, t, J = 7.4); 13C (100 MHz, DMSO) δ 163.97, 163.75, 158.42, 146.88, 132.93, 131.65, 131.17, 130.97, 129.88, 129.24, 128.57, 128.20, 127.70, 122.88, 121.04, 116.13, 40.39, 30.13, 20.26, 14.19; HRMS calcd for C22H18NO3− [M − H]− 344.1292, found 344.1283. Anal. Calcd (%) for C22H19NO3: C, 76.50; H, 5.54; N, 4.06. Found: C, 76.18; H, 5.486; N, 3.819. N-Butyl-4-(3-hydroxyphenyl)-1,8-naphthalimide (3). A mixture of N-(n-butyl)-4-bromide-1,8-naphthalimide (1 mmol), 2-hydroxy phenylboronic acid (1.5 mmol), Pd(OAc)2 (0.005 mol), K2CO3 (2 mmol), distilled water (5 mL), and iPrOH (5 mL) was stirred at 50 °C for 1 h. The mixture was added to brine (30 mL) and extracted four times with ethyl acetate (4 × 30 mL). The solvent was concentrated under a vacuum, and the product was purified by chromatography (silica gel, EtOAc−hexane as an eluent, 1:5, v/v) to afford 142 mg of 3 as a yellow solid with the yield of 41.4%. The structure of 3 was confirmed by 1H NMR, 13C NMR, and HRMS, and the data are as follows: 1H NMR (500 MHz, DMSO) δ 8.58−8.42 (m, 2H), 8.00 (dd, J = 8.4, 0.9 Hz, 1H), 7.79 (dd, J = 8.3, 7.3 Hz, 1H), 7.72 (d, J = 7.5 Hz, 1H), 7.40−7.30 (m, 1H), 7.23 (dd, J = 7.5, 1.6 Hz, 1H), 7.05 (d, J = 7.8 Hz, 1H), 6.98 (t, J = 7.4 Hz, 1H), 4.13−3.96 (m, 2H), 1.67−1.56

V=

Vmax × S Km + S +

9671

S2 Ksi

(1) DOI: 10.1021/acs.jmedchem.7b01097 J. Med. Chem. 2017, 60, 9664−9675

Journal of Medicinal Chemistry V=

Vmax × Sn n S50 + Sn

Article

were treated with different concentrations of chrysin for three consecutive days. The total RNA was isolated by RNAiso Plus reagent. The PCR mixture contained a 2.0 μL portion of the reversetranscribed mixture, 0.4 μM primers, and SYBR Premix Ex TaqII solution. After an initial denaturation at 95 °C for 30 s, amplification was performed by denaturation at 95 °C for 5 s and extension at 60 °C for 34 s for 40 cycles. Amplified products were detected through the measurement of fluorescence intensity of the SYBR Green that binds to double-strand DNA. Negative control samples (no cDNA template) were processed in the same manner as the positive samples. The expression level of UGT1A1 was normalized with the human housekeeping gene glyceraldehyde-3-phosphate dehydrogenase (GAPDH) and expressed as fold induction over control. Analysis of UGT1A1 Enzyme Activity. For enzyme activity analysis, HepG2 cells grown in 100 mm dishes were induced for 3 days with different concentrations of chrysin as the above-mentioned. After the final day of treatment, the cell were rinsed with PBS (5 mL) and harvested with trypsin. Next HepG2 cells were centrifuged for 5 min at 200 × g, and the cell pellets were gently resuspended in 50 mM TrisHCl buffer. The cells were sonified at 200 W for 5 × 5 s on ice with a 60 s interval between the pulses by a sonifier (JYD-650, Shanghai Zhixin Instrument Co., China). The cell homogenate was centrifuged at 9 000 × g for 20 min at 4 °C to obtain the supernatant fraction (S9). Total protein concentration of the S9 samples was determined with the BCA protein assay kit. Molecular Docking Simulations. It is well-known that the integrated crystal structures of human UGTs have not been reported yet. In this study, to investigate the interactions between UGT1A1 and its ligands, the knowledge-based comparative modeling method (the package of Advanced Protein Modeling in SYBYL) was used to build the 3D structure of UGT1A1. With the help of the ORCHESTRAR module in the APM package, we established the all-atom model of UGT1A1 on the basis of the amino acid sequence of the target enzyme and several known structural homologues. The Homo sapiens sequence of UGT1A1 (accession number = NP_000454.1) was used as a target protein sequence that was obtained from NCBI. After searching the similarity between the target sequence and the homologues within the Protein Data Bank using the Fugue module, the crystal structure of UDP-glucosyltransferaseGtfB (PDB code = 1IIR) was selected as the homology template.57 On the basis of the template, the backbone of the structurally conserved regions (SCR) was built, and then the structurally variable regions were modeled through Loop Search. Finally, the 3D model of UGT1A1 was obtained following optimization with staged energy minimization. To mimic the interactions between UGT1A1 and the three substrates, the package of Surflex-Dock was employed to explore the interaction modes and binding affinities of the ligands. Surflex-dock uses a patented search engine to dock ligands into the active site of the protein and uses an empirical scoring function to assess the binding. The established 3D model of UGT1A1 was prepared as a ready receptor by adding the missing residues and calculating the partial charges of AMBER7 FF99. Three ligands including bilirubin, 1, and 2 were optimized by energy minimization and conformational search using Tripos force field. The Gasteiger−Huckel charge method was used to compute their atomic charges. The automated mode was adopted to generate the active site to bind with each substrate, while the float radius was set to 3.

(2)

Inhibition Assays. The inhibitory effects of bilirubin on UGT1A1mediated 1-O-glucuronidation and 2-O-glucuronidation, as well as the inhibitory effects of 2 on UGT1A1-mediated 1-O-glucuronidation were investigated. HLMs were preincubated with Brij58 (0.1 mg/mg total protein in HLMs) on ice for 20 min before incubation. 1 or 2 were incubated with HLM (0.2 mg/mL) for 30 min in the presence or absence of different concentrations of bilirubin (10 μM, 100 μM for inhibition screening; 0.0−2.5 μM for inhibition constant determination) or 2 (10 μM, 100 μM for inhibition screening; 0.0−5.0 μM for inhibition constant determination). After incubation at 37 °C for 30 min, 200 μL aliquots of the supernatants were diverted into the 96well plates, and the fluorescence intensity of 5 was read by a Synergy H1 Hybrid Multi-Mode Microplate Reader (BioTek, USA), under the excitation wavelength of 370 nm and the emission wavelength of 520 nm. A standard curve of 5 was used to quantify the concentration of 5 in the reaction system. 6 (NCHNG) was determined according to our previously published methods.29 The inhibition kinetic types (competitive inhibition, noncompetitive inhibition, uncompetitive type, or mixed inhibition) and the inhibition constant (IC50 values, Ki) value were evaluated by nonlinear regression using GraphPad Prism 6.0 software (GraphPad Software, Inc., La Jolla, CA, USA). Meanwhile, goodness-of-fit parameters were employed to identify the most appropriate model. The competitive inhibition (eq 3) and noncompetitive inhibition (eq 4) are given below, where Vmax is maximal velocity, S is substrate concentration, Km is the Michaelis constant, and Ki is the inhibitor constant. V=

Vmax × S

(

Km 1 + V=

I Ki

)+S

(3)

Vmax × S

(

(K m + S) + 1 +

I Ki

)

(4)

Note that competitive inhibition assumes that the inhibitor competes with the substrate for the same binding site within an enzyme active site; noncompetitive inhibition is a type of inhibition in which the substrate and inhibitor bind independently at two distinct sites within an enzyme.55,56 Interindividual Variability in UGT1A1 Activity and Correlation Analysis. The formation rates of 2-O-glucuronidation were measured in 14 individual HLMs for the investigation of the interindividual difference in UGT1A1 activity. 2 (5 μM) was incubated with HLM (0.2 mg/mL) for 30 min. Bilirubin (1 μM) was incubated with HLM (0.02 mg/mL) for 20 min. Ethinyloestradiol (EE, 25 μM) was incubated with HLM (0.2 mg/mL) for 30 min. Since standard glucuronides of bilirubin are not commercially available and the synthetization of the corresponding glucuronides of bilirubin and EE are time consuming and costly, the standard curves of the bilirubin and EE were used to quantify the formation of the glucuronide. The absolute protein levels of UGT1A1 in these individual HLMs were quantified with the multiple reactions monitoring (MRM) mode coupled with an isotope labeled peptide as the internal standard by tandem liquid chromatography−mass spectrometry (LC-MS/MS) in accordance with the previously reported literature.17 Specific peptides of T78YPVPFQR85 (for UGT1A1) were selected for its quantification using transition ions of 509.4/557.3 and 504.4/547.3. The correlation parameters were expressed by the linear regression coefficient (R2). Real-Time RT-PCR Analysis of UGT1A1 mRNA Expression. HepG2 cells were cultured in high-glucose Dulbecco’s Modified Eagle Medium (DMEM) supplemented with 10% fetal bovine serum (FBS) and 1% penicillin−streptomycin solution. Cultures were maintained in a humidified atmosphere containing 5% CO2 and 95% air at 37 °C. The UGT1A1 mRNA levels in HepG2 cell homogenates were quantified by real-time RT-PCR using the Applied Biosystems StepOne Real-Time PCR System software, version 2.0 (Applied Biosystems, Foster City, CA). HepG2 cells cultured in 6-well plates

■

CONCLUSION In summary, a high-affinity fluorescent probe 2 has been rationally designed and well-characterized for highly selective and sensitive sensing UGT1A1 activities in complex biological samples, on the basis of the mechanism of PET and the substrate preference of UGT1A1. In addition to the high selectivity and sensitivity, 2 also exhibits a good reactivity and high affinity toward UGT1A1, which drive the 2-based fluorescence assay to be a very sensitive method for sensing UGT1A1 activities. More importantly, both inhibition kinetic 9672



Article

ea pig liver microsomes; V, the reaction rate; Vmax, the maximum reaction rate; S, the substrate concentration; Km, the substrate affinity constant; Ksi, the substrate inhibition constant; S50, the substrate concentration resulting in 50% of Vmax; n, Hill coefficient; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; DMEM, Dulbecco’s Modified Eagle Medium; FBS, fetal bovine serum

analyses and docking simulations demonstrate that 2 could bind on UGT1A1 at the same ligand-binding site as bilirubin (an extremely important physiological substrate for UGT1A1). Further investigations clearly demonstrate that 2 could serve as a good surrogate for bilirubin, for sensing the real activities of UGT1A1 in complex biological samples, and for the highthroughput screening of UGT1A1 inhibitors using tissue preparations as enzyme sources. All of these features make 2 a promising tool for UGT1A1-ligand interactions and for exploring the biological functions of UGT1A1 in complex biological samples.

■

■

(1) Guillemette, C.; Levesque, E.; Rouleau, M. Pharmacogenomics of Human Uridine Diphospho-Glucuronosyltransferases and Clinical Implications. Clin. Pharmacol. Ther. 2014, 96, 324−339. (2) Rowland, A.; Miners, J. O.; Mackenzie, P. I. The UDPGlucuronosyltransferases: Their Role in Drug Metabolism and Detoxification. Int. J. Biochem. Cell Biol. 2013, 45, 1121−1132. (3) Oda, S.; Fukami, T.; Yokoi, T.; Nakajima, M. A Comprehensive Review of UDP-glucuronosyltransferase and Esterases for Drug Development. Drug Metab. Pharmacokinet. 2015, 30, 30−51. (4) Kiang, T. K.; Ensom, M. H.; Chang, T. K. UDPGlucuronosyltransferases and Clinical Drug-Drug Interactions. Pharmacol. Ther. 2005, 106, 97−132. (5) Bock, K. W. Roles of Human UDP-Glucuronosyltransferases in Clearance and Homeostasis of Endogenous Substrates, and Functional Implications. Biochem. Pharmacol. 2015, 96, 77−82. (6) Tukey, R. H.; Strassburg, C. P. Human UDP-Glucuronosyltransferases: Metabolism, Expression, and Disease. Annu. Rev. Pharmacol. Toxicol. 2000, 40, 581−616. (7) Strassburg, C. P.; Lankisch, T. O.; Manns, M. P.; Ehmer, U. Family 1 Uridine-5′-Diphosphate Glucuronosyltransferases (UGT1A): from Gilbert’s Syndrome to Genetic Organization and Variability. Arch. Toxicol. 2008, 82, 415−433. (8) Goon, C. P.; Wang, L. Z.; Wong, F. C.; Thuya, W. L.; Ho, P. C. L.; Goh, B. C. UGT1A1Mediated Drug Interactions and its Clinical Relevance. Curr. Drug Metab. 2016, 17, 100−106. (9) Miners, J. O.; Chau, N.; Rowland, A.; Burns, K.; McKinnon, R. A.; Mackenzie, P. I.; Tucker, G. T.; Knights, K. M.; Kichenadasse, G. Inhibition of Human UDP-Glucuronosyltransferase Enzymes by Lapatinib, Pazopanib, Regorafenib and Sorafenib: Implications for Hyperbilirubinemia. Biochem. Pharmacol. 2017, 129, 85−95. (10) Zhu, L.; Xiao, L.; Li, W.; Zhang, Y.; Han, W.; Zhu, Y.; Ge, G.; Yang, L. Human UDP-Glucuronosyltransferases 1A1, 1A3, 1A9, 2B4 and 2B7 are Inhibited by Diethylstilbestrol. Basic Clin. Pharmacol. Toxicol. 2016, 119, 505−511. (11) Zhang, N.; Liu, Y.; Jeong, H. Y. Drug-Drug Interaction Potentials of Tyrosine Kinase Inhibitors via Inhibition of UDPGlucuronosyltransferases. Sci. Rep. 2016, 5, 17778. (12) Wang, L. Z.; Chan, C. E. L.; Wong, A. L. A.; Wong, F. C.; Lim, S. W.; Chinnathambi, A.; Alharbi, S. A.; Lee, L. S. U.; Soo, R.; Yong, W. P.; Lee, S. C.; Ho, P. C. L.; Sethi, G.; Goh, B. C. Combined Use of Irinotecan with Histone Deacetylase Inhibitor Belinostat could Cause Severe Toxicity by Inhibiting SN-38 Glucuronidation via UGT1A1. Oncotarget 2017, 8, 41572−41581. (13) Wang, X.-X.; Lv, X.; Li, S.-Y.; Hou, J.; Ning, J.; Wang, J.-Y.; Cao, Y.-F.; Ge, G.-B.; Guo, B.; Yang, L. Identification and Characterization of Naturally Occurring Inhibitors against UDP-Glucuronosyltransferase 1A1 in Fructus Psoraleae (Bu-Gu-Zhi). Toxicol. Appl. Pharmacol. 2015, 289, 70−78. (14) Court, M. H. Interindividual Variability in Hepatic Drug Glucuronidation: Studies into the Role of Age, Sex, Enzyme Inducers, and Genetic Polymorphism Using the Human Liver Bank as a Model System. Drug Metab. Rev. 2010, 42, 209−224. (15) Yoda, E.; Paszek, M.; Konopnicki, C.; Fujiwara, R.; Chen, S.; Tukey, R. H. Isothiocyanates Induce UGT1A1 in Humanized UGT1Mice in a CAR Dependent Fashion that is Highly Dependent Upon Oxidative Stress. Sci. Rep. 2017, 7, 46489. (16) Sato, Y.; Nagata, M.; Tetsuka, K.; Tamura, K.; Miyashita, A.; Kawamura, A.; Usui, T. Optimized Methods for Targeted PeptideBased Quantification of Human Uridine 5 ′-Diphosphate-Glucur-

ASSOCIATED CONTENT

* Supporting Information S

The Supporting Information is available free of charge on the ACS Publications website at DOI: 10.1021/acs.jmedchem.7b01097. Synthesis and characterization of compounds, isoform selectivity screening, identification of 2 glucuronide, effects of pH on the fluorescence responses, effects of viscosity on the fluorescence responses, fluorescence interference assays, absorption and fluorescence spectra of 2 and 5, quantum efficiency of fluorescence, chemical stability of 2, summary of currently used probes for UGT1A1, HTS inhibitors of UGT1A1, and additional spectroscopic data (PDF) Molecular formula strings (CSV)

■

REFERENCES

AUTHOR INFORMATION

Corresponding Authors

*E-mail: [email protected]. *E-mail: [email protected]. ORCID

Guang-Bo Ge: 0000-0002-9670-4349 Author Contributions ○

These authors contributed equally to the study.

Notes

The authors declare no competing financial interest.

■

ACKNOWLEDGMENTS This work was supported by the National Key Research and Development Program of China (2016YFC1303900), the National S&T Major Projects of China (2017ZX09101004), the NSF of China (81473181, 81773687, 81573501, 81703606, and 21572029), the State Key Laboratory of Fine Chemicals (KF1504 and KF1408), and the First Affiliated Hospital of Zhengzhou University-DICP Joint Research Foundation (201613).

■

ABBREVIATIONS USED UGT1A1, uridine diphosphate glucuronosyltransferase 1A1; UDPGA, uridine diphosphate glucuronic acid; (2, NHPN), Nbutyl-4-(4-hydroxyphenyl)-1,8-naphthalimide); HLM, human liver microsomes; HRMS, high-resolution mass spectrometry; NMR, nuclear magnetic resonance; 5, 2-O-glucuronide; (1, NCHN), N-(3-carboxypropyl)-4-hydroxy-1,8-naphthalimide; PET, photoinduced electron transfer; PPT, 20(S)-protopanaxatriol; NB, nilotinib; EE, ethinyloestradiol; DDI, drug−drug interactions; HTS, high-throughput screening; DMSO-d6, dimethyl sulfoxide-d6; TMS, tetramethylsilane; UFLC, ultrafast liquid chromatography−ultraviolet spectrometry; GPLM, guin9673



Article

onosyltransferases in Biological Specimens Using Liquid Chromatography-Tandem Mass Spectrometry. Drug Metab. Dispos. 2014, 42, 885−889. (17) Fallon, J. K.; Harbourt, D. E.; Maleki, S. H.; Kessler, F. K.; Ritter, J. K.; Smith, P. C. Absolute Quantification of Human UridineDiphosphate Glucuronosyl Transferase (UGT) Enzyme Isoforms 1A1 and 1A6 by Tandem LC-MS. Drug Metab. Lett. 2008, 2, 210−222. (18) Fallon, J. K.; Neubert, H.; Goosen, T. C.; Smith, P. C. Targeted Precise Quantification of 12 Human Recombinant Uridine-Diphosphate Glucuronosyl Transferase 1A and 2B Isoforms Using NanoUltra-High-Performance Liquid Chromatography/Tandem Mass Spectrometry with Selected Reaction Monitoring. Drug Metab. Dispos. 2013, 41, 2076−2080. (19) Lv, X.; Wang, D. D.; Feng, L.; Wang, P.; Zou, L. W.; Hao, D. C.; Hou, J.; Cui, J. N.; Ge, G. B.; Yang, L. A Highly Selective Marker Reaction for Measuring the Activity of Human Carboxylesterase 1 in Complex Biological Samples. RSC Adv. 2016, 6, 4302−4309. (20) Napolitano, R.; Pariani, G.; Fedeli, F.; Baranyai, Z.; Aswendt, M.; Aime, S.; Gianolio, E. Synthesis and Relaxometric Characterization of a MRI Gd-Based Probe Responsive to Glutamic Acid Decarboxylase Enzymatic Activity. J. Med. Chem. 2013, 56, 2466−2477. (21) Wu, J.-J.; Cao, Y.-F.; Feng, L.; He, Y.-Q.; Hong, J. Y.; Dou, T.Y.; Wang, P.; Hao, D.-C.; Ge, G.-B.; Yang, L. A Naturally Occurring Isoform-Specific Probe for Highly Selective and Sensitive Detection of Human Cytochrome P450 3A5. J. Med. Chem. 2017, 60, 3804−3813. (22) Court, M. H. Isoform-Selective Probe Substrates for In Vitro Studies of Human UDP-Glucuronosyltransferases. Methods Enzymol. 2005, 400, 104−116. (23) Dai, Z. R.; Feng, L.; Jin, Q.; Cheng, H. L.; Li, Y.; Ning, J.; Yu, Y.; Ge, G. B.; Cui, J. N.; Yang, L. A Practical Strategy to Design and Develop an Isoform-Specific Fluorescent Probe for a Target Enzyme: CYP1A1 as a Case Study. Chem. Sci. 2017, 8, 2795−2803. (24) Zou, L. W.; Wang, P.; Qian, X. K.; Feng, L.; Yu, Y.; Wang, D. D.; Jin, Q.; Hou, J.; Liu, Z. H.; Ge, G. B.; Yang, L. A Highly Specific Ratiometric Two-Photon Fluorescent Probe to Detect Dipeptidyl Peptidase IV in Plasma and Living Systems. Biosens. Bioelectron. 2017, 90, 283−289. (25) Dai, Z.-R.; Ge, G.-B.; Feng, L.; Ning, J.; Hu, L.-H.; Jin, Q.; Wang, D.-D.; Lv, X.; Dou, T.-Y.; Cui, J.-N. A Highly Selective Ratiometric Two-Photon Fluorescent Probe for Human Cytochrome P450 1A. J. Am. Chem. Soc. 2015, 137, 14488−14495. (26) Jin, Q.; Feng, L.; Wang, D. D.; Wu, J. J.; Hou, J.; Dai, Z. R.; Sun, S. G.; Wang, J. Y.; Ge, G. B.; Cui, J. N.; Yang, L. A Highly Selective Near-Infrared Fluorescent Probe for Carboxylesterase 2 and its Bioimaging Applications in Living Cells and Animals. Biosens. Bioelectron. 2016, 83, 193−199. (27) Jin, Q.; Feng, L.; Wang, D. D.; Dai, Z. R.; Wang, P.; Zou, L. W.; Liu, Z. H.; Wang, J. Y.; Yu, Y.; Ge, G. B.; Cui, J. N.; Yang, L. A TwoPhoton Ratiometric Fluorescent Probe for Imaging Carboxylesterase 2 in Living Cells and Tissues. ACS Appl. Mater. Interfaces 2015, 7, 28474−28481. (28) Wang, P.; Xia, Y. L.; Zou, L. W.; Qian, X. K.; Dou, T. Y.; Jin, Q.; Li, S. Y.; Yu, Y.; Wang, D. D.; Luo, Q.; Ge, G. B.; Yang, L. An Optimized Two-Photon Fluorescent Probe for Biological Sensing and Imaging of Catechol-O-Methyltransferase. Chem. - Eur. J. 2017, 23, 10800−10807. (29) Lv, X.; Ge, G. B.; Feng, L.; Troberg, J.; Hu, L. H.; Hou, J.; Cheng, H. L.; Wang, P.; Liu, Z. M.; Finel, M.; Cui, J. N.; Yang, L. An Optimized Ratiometric Fluorescent Probe for Sensing Human UDPGlucuronosyltransferase 1A1 and its Biological Applications. Biosens. Bioelectron. 2015, 72, 261−267. (30) Terai, T.; Tomiyasu, R.; Ota, T.; Ueno, T.; Komatsu, T.; Hanaoka, K.; Urano, Y.; Nagano, T. TokyoGreen Derivatives as Specific and Practical Fluorescent Probes for UDP-Glucuronosyltransferase (UGT) 1A1. Chem. Commun. 2013, 49, 3101−3. (31) Lv, X.; Wang, X. X.; Hou, J.; Fang, Z. Z.; Wu, J. J.; Cao, Y. F.; Liu, S. W.; Ge, G. B.; Yang, L. Comparison of the Inhibitory Effects of Tolcapone and Entacapone against Human UDP-Glucuronosyltransferases. Toxicol. Appl. Pharmacol. 2016, 301, 42−49.

(32) Ciotti, M.; Owens, I. S. Evidence for Overlapping Active Sites for 17 Alpha-Ethynlestradiol and Bilirubin in the Human Major Bilirubin UDP-Glucuronosyltransferase. Biochemistry 1996, 35, 10119−10124. (33) Rios, G. R.; Tephly, T. R. Inhibition and Active Sites of UDPGlucuronosyltransferases 2B7 and 1A1. Drug Metab. Dispos. 2002, 30, 1364−1367. (34) Yang, N.; Sun, R. B.; Liao, X. Y.; Aa, J. Y.; Wang, G. J. UDPGlucuronosyltransferases (UGTs) and Their Related Metabolic CrossTalk with Internal Homeostasis: A Systematic Review of UGT Isoforms for Precision Medicine. Pharmacol. Res. 2017, 121, 169−183. (35) He, Y. J.; Fang, Z. Z.; Ge, G. B.; Jiang, P.; Jin, H. Z.; Zhang, W. D.; Yang, L. The Inhibitory Effect of 20(S)-Protopanaxatriol (ppt) towards UGT1A1 and UGT2B7. Phytother. Res. 2013, 27, 628−632. (36) Ai, L. M.; Zhu, L. L.; Yang, L.; Ge, G. B.; Cao, Y. F.; Liu, Y.; Fang, Z. Z.; Zhang, Y. Y. Selectivity for Inhibition of Nilotinib on the Catalytic Activity of Human UDP-Glucuronosyltransferases. Xenobiotica 2014, 44, 320−325. (37) Zhu, L. L.; Ge, G. B.; Liu, Y.; He, G. Y.; Liang, S. C.; Fang, Z. Z.; Dong, P. P.; Cao, Y. F.; Yang, L. Potent and Selective Inhibition of Magnolol on Catalytic Activities of UGT1A7 and 1A9. Xenobiotica 2012, 42, 1001−1008. (38) Uchaipichat, V.; Winner, L. K.; Mackenzie, P. I.; Elliot, D. J.; Williams, J. A.; Miners, J. O. Quantitative Prediction of In Vivo Inhibitory Interactions Involving Glucuronidated Drugs from In Vitro Data: the Effect of Fluconazole on Zidovudine Glucuronidation. Br. J. Clin. Pharmacol. 2006, 61, 427−439. (39) Uchaipichat, V.; Mackenzie, P. I.; Elliot, D. J.; Miners, J. O. Selectivity of Substrate (Trifluoperazine) and Inhibitor (Amitriptyline, Androsterone, Canrenoic acid, Hecogenin, Phenylbutazone, Quinidine, Quinine, and Sulfinpyrazone) ″Probes″ for Human UDPGlucuronosyltransferases. Drug Metab. Dispos. 2005, 34, 449−456. (40) Huang, Y. P.; Cao, Y. F.; Fang, Z. Z.; Zhang, Y. Y.; Hu, C. M.; Sun, X. Y.; Yu, Z. W.; Zhu, X.; Hong, M.; Yang, L.; Sun, H. Z. Glycyrrhetinic Acid Exhibits Strong Inhibitory Effects Towards UDPGlucuronosyltransferase (UGT) 1A3 and 2B7. Phytother. Res. 2013, 27, 1358−1361. (41) Ghosh, S. S.; Sappal, B. S.; Kalpana, G. V.; Lee, S. W.; Chowdhury, J. R.; Chowdhury, N. R. Homodimerization of Human Bilirubin-Uridine-Diphosphoglucuronate Glucuronosyltransferase-1 (UGT1A1) and its Functional Implications. J. Biol. Chem. 2001, 276, 42108−42115. (42) Ge, G. B.; Ning, J.; Hu, L. H.; Dai, Z. R.; Hou, J.; Cao, Y. F.; Yu, Z. W.; Ai, C. Z.; Gu, J. K.; Ma, X. C.; Yang, L. A Highly Selective Probe for Human Cytochrome P450 3A4: Isoform Selectivity, Kinetic Characterization and its Applications. Chem. Commun. 2013, 49, 9779−9781. (43) Lei, W.; Wang, D.-D.; Dou, T.-Y.; Hou, J.; Feng, L.; Yin, H.; Luo, Q.; Sun, J.; Ge, G.-B.; Yang, L. Assessment of the Inhibitory Effects of Pyrethroids against Human Carboxylesterases. Toxicol. Appl. Pharmacol. 2017, 321, 48−56. (44) Wang, D. D.; Zou, L. W.; Jin, Q.; Hou, J.; Ge, G. B.; Yang, L. Recent Progress in the Discovery of Natural Inhibitors against Human Carboxylesterases. Fitoterapia 2017, 117, 84−95. (45) Weng, Z. M.; Wang, P.; Ge, G. B.; Dai, Z. R.; Wu, D. C.; Zou, L. W.; Dou, T. Y.; Hou, J.; Zhang, T. Y.; Yang, L. Structure-Activity Relationships of Flavonoids as Natural Inhibitors against E. coli βGlucuronidase. Food Chem. Toxicol. 2017, 109, 975−983. (46) Wen, Z.; Tallman, M. N.; Ali, S. Y.; Smith, P. C. UDPGlucuronosyltransferase 1A1 is the Principal Enzyme Responsible for Etoposide Glucuronidation in Human Liver and Intestinal Microsomes: Structural Characterization of Phenolic and Alcoholic Glucuronides of Etoposide and Estimation of Enzyme Kinetics. Drug Metab. Dispos. 2006, 35, 371−380. (47) Lv, X.; Hou, J.; Xia, Y. L.; Ning, J.; He, G. Y.; Wang, P.; Ge, G. B.; Xiu, Z. L.; Yang, L. Glucuronidation of Bavachinin by Human Tissues and Expressed UGT Enzymes: Identification of UGT1A1 and UGT1A8 as the Major Contributing Enzymes. Drug Metab. Pharmacokinet. 2015, 30, 358−365. 9674



Article

(48) Zhang, D. L.; Zhang, D. X.; Cui, D.; Gambardella, J.; Ma, L.; Barros, A.; Wang, L. F.; Fu, Y. L.; Rahematpura, S.; Nielsen, J.; Donegan, M.; Zhang, H. J.; Humphreys, W. G. Characterization of the UDP Glucuronosyltransferase Activity of Human Liver Microsomes Genotyped for the UGT1A1*28 Polymorphism. Drug Metab. Dispos. 2007, 35, 2270−2280. (49) Zhou, J.; Tracy, T. S.; Remmel, R. P. Correlation between Bilirubin Glucuronidation and Estradiol-3-Gluronidation in the Presence of Model UDP-Glucuronosyltransferase 1A1 Substrates/ Inhibitors. Drug Metab. Dispos. 2011, 39, 322−329. (50) Liu, Y.; Ramirez, J.; House, L.; Ratain, M. J. Comparison of the Drug-Drug Interactions Potential of Erlotinib and Gefitinib via Inhibition of UDP-Glucuronosyltransferases. Drug Metab. Dispos. 2010, 38, 32−39. (51) Wind, S.; Schnell, D.; Ebner, T.; Freiwald, M.; Stopfer, P. Clinical Pharmacokinetics and Pharmacodynamics of Afatinib. Clin. Pharmacokinet. 2017, 56, 235−250. (52) Aoshima, N.; Fujie, Y.; Itoh, T.; Tukey, R. H.; Fujiwara, R. Glucose Induces Intestinal Human UDP-glucuronosyltransferase (UGT) 1A1 to Prevent Neonatal Hyperbilirubinemia. Sci. Rep. 2015, 4, 6343. (53) Smith, C. M.; Graham, R. A.; Krol, W. L.; Silver, I. S.; Negishi, M.; Wang, H. B.; Lecluyse, E. L. Differential UGT1A1 Induction by Chrysin in Primary Human Hepatocytes and HepG2 Cells. J. Pharmacol. Exp. Ther. 2005, 315, 1256−1264. (54) Galijatovic, A.; Otake, Y.; Walle, U. K.; Walle, T. Induction of UDP-Glucuronosyltransferase UGT1A1 by the Flavonoid Chrysin in Caco-2 Cells - Potential Role in Carcinogen Bioinactiviation. Pharm. Res. 2001, 18, 374−379. (55) Wienkers, L. C.; Heath, T. G. Predicting In Vivo Drug Interactions from In Vitro Drug Discovery Data. Nat. Rev. Drug Discovery 2005, 4, 825−833. (56) Miners, J. O.; Bowalgaha, K.; Elliot, D. J.; Baranczewski, P.; Knights, K. M. Characterization of Niflumic Acid as a Selective Inhibitor of Human Liver Microsomal UDP-Glucuronosyltransferase 1A9: Application to the Reaction Phenotyping of Acetaminophen Glucuronidation. Drug Metab. Dispos. 2011, 39, 644−652. (57) Mulichak, A. M.; Losey, H. C.; Walsh, C. T.; Garavito, R. M. Structure of the UDP-Glucosyltransferase GtfB that Modifies the Heptapeptide Aglycone in the Biosynthesis of Vancomycin Group Antibiotics. Structure 2001, 9, 547−557.

9675


A Practical and High-Affinity Fluorescent Probe for Uridine

Recommend Documents