A Sandwich-DNA-Hybridization FRET Strategy for miR-122 Detection

Subscriber access provided by Umea University Library

Functional Nanostructured Materials (including low-D carbon)

A Sandwich-DNA-Hybridization FRET Strategy for miR-122 Detection by Core-Shell Upconversion Nanoparticles Hong Ren, Zi Long, Xiaotong Shen, Ying Zhang, Jianghui Sun, Jin Ouyang, and Na Na ACS Appl. Mater. Interfaces, Just Accepted Manuscript • DOI: 10.1021/acsami.8b03429 • Publication Date (Web): 03 Jul 2018 Downloaded from http://pubs.acs.org on July 5, 2018

Just Accepted “Just Accepted” manuscripts have been peer-reviewed and accepted for publication. They are posted online prior to technical editing, formatting for publication and author proofing. The American Chemical Society provides “Just Accepted” as a service to the research community to expedite the dissemination of scientific material as soon as possible after acceptance. “Just Accepted” manuscripts appear in full in PDF format accompanied by an HTML abstract. “Just Accepted” manuscripts have been fully peer reviewed, but should not be considered the official version of record. They are citable by the Digital Object Identifier (DOI®). “Just Accepted” is an optional service offered to authors. Therefore, the “Just Accepted” Web site may not include all articles that will be published in the journal. After a manuscript is technically edited and formatted, it will be removed from the “Just Accepted” Web site and published as an ASAP article. Note that technical editing may introduce minor changes to the manuscript text and/or graphics which could affect content, and all legal disclaimers and ethical guidelines that apply to the journal pertain. ACS cannot be held responsible for errors or consequences arising from the use of information contained in these “Just Accepted” manuscripts.

is published by the American Chemical Society. 1155 Sixteenth Street N.W., Washington, DC 20036 Published by American Chemical Society. Copyright © American Chemical Society. However, no copyright claim is made to original U.S. Government works, or works produced by employees of any Commonwealth realm Crown government in the course of their duties.

Page 1 of 23 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

ACS Applied Materials & Interfaces

A Sandwich-DNA-Hybridization FRET Strategy for miR-122 Detection by Core-Shell Upconversion Nanoparticles Hong Ren

a,b,

a,

a

a

‡, Zi Long ‡, Xiaotong Shena, Ying Zhanga, Jianghui Sun , Jin Ouyang and Na

a,

Na * a

Key Laboratory of Theoretical and Computational Photochemistry, College of Chemistry, Beijing Normal

University, Beijing 100875, China b

The Aerospace City School of the High School Affiliated to Renmin University of China, Beijing 100087,

China

ABSTRACT Upconversion nanoparticles (UCNPs)-based fluorescence resonance energy transfer (FRET) strategy is normally restricted by the complicated preparations, low energy-transfer efficiency, as well as the challenge on improving specificity. Herein, simple DNA-functionalized UCNPs were designed as energy donors for constructing a FRET-based probe to detect the liver-specific microRNA 122 (miR-122). To improve FRET efficiency, UCNPs were constructed with confined core-shell structures, in which emitting ions were precisely located in the thin shell to make them close enough to external energy acceptors. Subsequently, capture DNA was simply functionalized on the outer surface of UCNPs based on ligand exchange that contributed to shortening the energy transfer distance without extra modification. To gain high specificity, the donor-to-acceptor distance of FRET was controlled by a sandwich-DNA-hybridization structure using two shorter DNAs with designed complementary sequences (capture DNA and dye-labelled report DNA) to capture the longer target of miR-122. Therefore, the sensitive detection of miR-122 was achieved based on the decreased signals of UCNPs and the increased signals of the dye labelled on reported DNA. With good biocompatibility, this method has been further applied to cancer cell imaging and in vivo imaging, which opened up a new avenue to the sensitive detection and imaging of microRNA in biological systems.

KEYWORDS FRET, sandwich-DNA-hybridization, miR-122, core-shell upconversion nanoparticles, cell imaging, in vivo imaging

1

ACS Paragon Plus Environment

ACS Applied Materials & Interfaces 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 2 of 23

1. INTRODUCTION MicroRNA 122 (miR-122) is the most abundant microRNAs (miRNA) in human liver 1-2

, which has been reported to be a key regulator of cholesterol and fatty-acid

metabolism in adult liver 3, and has also been regarded as a potential therapeutic target for HCV infection

4

. People have been seeking for effective methods for the

determination of miRNAs in biological systems (PCR) 7, northern blotting,

8-9

5-16

, such as polymerase chain reaction

and electrochemical-based methods

10-12

. However, these

methods still have some shortcomings including time-consuming synthesis for obtaining

functionalized

nanoparticles,

requirement

of

pre-amplification,

pre-concentration before detection, as well as the unsatisfactory sensitivity or the specificity. Hence, further studies are still needed to pursue simpler, more sensitive and specific pathway for miR-122 determinations, even applied to in situ imaging in biological systems. Upconversion nanoparticles (UCNPs)-based nanoprobes have been fabricated for biomolecule detection and even drug delivery

17-29

which are promising energy donors

for fluorescence resonance energy transfer (FRET)-based fluorescence (FL) probes 30-34. However, low FRET efficiency is still an intractable problem in the detection process with UCNPs as energy donors, which is mainly generated from the sizes of currently used UCNPs (makes only a small part of emitters within the energy-transfer distance of 10 nm). In view of this, the three-component nanoparticles with core-double shells sandwich structures were reported, in which the emitting ions were precisely located in the middle shell to effectively shorten donor-to-acceptor distance and therefore increased FRET efficiency for Ca2+ and ·OH detection

35-36

. However, it is still very

complicated because the energy transfer distance was controlled by the thickness of outer shell (the third component) of NaYF4 stabilized by oleic acid, which required acid-pretreatment to become hydrophilic ones for further modification. Therefore, the simpler synthesis of hydrophilic core-shell UCNPs without extra pretreatment and surface modification are still encouraged to construct a FRET-based UCNPs probe for miR-122 detection. Furthermore, to gain high specificity, DNA-hybridization strategy 2


8

has been

Page 3 of 23 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


introduced into the construction of Luminescence Resonance Energy Transfer (LRET)-based UCNPs nanoprobes by using gold-upconversion nanoparticle pyramids or graphene quantum dots

35, 37-38

. It should be noted that for obtaining high specificity

while retaining high LRET efficiency, common preparations of water-dispersible and biocompatible functionalized UCNPs are probably inappropriate due to the complicated extra steps of bioconjugations using heterobifunctional cross-linkers that would lower energy transfer efficiency

25, 36

. Fortunately, based on ligand exchange at

the liquid-liquid interface, water-soluble DNA-UCNPs were simply prepared without extra chemical modification, which can decrease the energy transfer distance controlled by the chain length of DNA 39. Thus, combing with core-shell UCNPs, the sensitive and specific detection or imaging of miR-122 would be achieved through FRET controlled by sandwich-DNA-hybridization on the surface of UCNPs. Here, we developed a new kind of UCNPs with simple core-shell structure to raise energy transfer efficiency for miR-122 detection. Without extra pretreatment for phase transfer, DNA was directly conjugated with hydrophobic UCNPs by one-pot ligand exchange at the liquid-liquid interface combined with the conversion of hydrophobic UCNPs into hydrophilic ones for further biological applications. Based on sandwich-DNA-hybridization, the longer target miR-122 was captured by two shorter DNA chains with designed sequence to insure specific detection of miR-122, which achieved sensitive miR-122 detection according to the decreased signals of UCNPs and increased signals of the dye labelled on reported DNA. This method is sensitive, specific and shows low cytotoxicity for cancer cell imaging and in vivo imaging, which would be significant for miRNA detection in biological systems.

2. EXPERIMENTAL SECTION 2.1. Materials and reagents Oleic

acid

(OA,

90%),

octadecene

(ODE),

3-[4,5-dimethyl-2-thiazolyl]-2,5-diphenyl-2-tetrazolium bromide (MTT) and LnCl3 (Ln=Gd, Yb and Er) were purchased from Alfa Aesar. Phosphate buffered saline (PBS) (0.01 M, pH =7.2–7.4) was purchased from Solarbio (Beijing Solarbio Science & Technology Co., Ltd.). Acetone, chloroform, ethanol, hexane and dimethyl sulfoxide (DMSO) were purchased from 3



Page 4 of 23

Beijing Chemical Works. NaF was obtained from Sinopharm Chemical Reagent Beijing Co., Ltd. Sodium oleate was purchased from TCI (Shanghai) Co., Ltd. Fetal bovine serum (FBS) and

DMEM

were

purchased

from

Thermo

Fisher

Scientific

(USA).

4',6-diamidino-2-phenylindole (DAPI) was obtained from Sigma-Aldrich. Isoflurane was used to anesthetize the mice before imaging. BALB/c nude mice, aged 7-8 weeks, were obtained from Vital River (Beijing, China). All chemicals were of analytical grade or better and used without further purification. Deionized water (Mill-Q, Millipore, 18.2 MΩ resistivity) was used in all experiments. The base sequences from left to right (from 5’to 3’) of miRNA were listed below: miRNA 29: UAGCACCAUCUGAAAUCGGUUA miRNA 122: UGGAGUGUGACAAUGGUGUUUG N,N,N’,N’-tetramethyl-6-carboxyrhodamine (TAMRA)-DNA: TAMRA-TCACACTCCA DNA

for

the

preparation

of

NaGdF4@NaGdF4:Yb,Er@DNA

nanoparticles:

(C6NH)-CAAACACCATTI

2.2. Instruments TEM was performed on a Tecnai G2 F20 transmission electron microscope under 200 kV accelerating voltage. UV/Vis absorption spectroscopy was obtained on UV2600 spectrophotometer (Shimadzu, Japan). Fluorescence spectra were carried out by FLS980 fluorescence

spectrophotometer

(Edingburgh

Instruments,

UK).

X-ray

diffraction

measurements were performed on Maxima XRD-7000 (Shimadzu, Japan). The vitro cytotoxicity assay was examined at 490 nm in a microplate reader (BioTek Instruments Inc, USA). The zeta potential of the nanoparticles was carried out on a Nano-ZS Zetzsozer ZEN3600 (Malvern Instruments Ltd., U.K.). Confocal laser scanning microscopy (CLSM) was operated on Nikon A1R. The excitation light intensities of NIR 980 nm laser used for spectra collecting were 1.5 W, and 748 mW for CLSM imaging. In vivo imaging was carried out on IVIS Spectrum (PerkinElmer).

2.3. Synthesis of oleate-coated NaGdF4@NaGdF4:Yb,Er nanoparticles The hydrophobic NaGdF4@NaGdF4:Yb,Er nanoparticles with oleic acid were obtained according to the layer-by-layer method reported by Prof. Liu

40-41

. 10 mL OA/ODE solvent

containing 0.5 mmol of Gd(oleate)3 and 20 mmol of NaF was stirred at 320 oC for 75 min. 4


Page 5 of 23 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Subsequently, another 0.4 mmol of Gd(oleate)3:Yb,Er in 8 mL OA/ODE solvent was added to the above reaction system, which was then kept at 320 oC for 40 min. After that, equal volume of

ethanol

was

added

into

the

above

mixture

at

room

temperature.

The

NaGdF4@NaGdF4:Yb,Er nanoparticles were centrifuged and purified by washing several times with 1:1 ethanol and hexane. The Ln(oleate)3 was synthesized according to the previous reports 40-41.

2.4. Synthesis of water-soluble NaGdF4@NaGdF4:Yb,Er@DNA nanoparticles Oleic acid stabilized NaGdF4@NaGdF4:Yb,Er nanoparticles (1 mg) in 0.8 mL chloroform was dropped into a water solution (2 mL) containing 1 OD DNA (184 nmol) under vigorously stirring overnight

39

. Afterward, the resulted NaGdF4@NaGdF4:Yb,Er@DNA nanoparticles

were purified, re-dispersed in the buffer solution and stored at 4 oC for further experiments.

2.5. In Vitro Cytotoxicity Assay The standard MTT assay was applied to examine toxicity information using HepG2 cells. The HepG2 cells were incubated in Dulbecco’s Modified Eagle Medium containing 10% FBS at 37 °C under an atmosphere of 5% CO2 for 24 h in a 96 well plate. Then, different amounts of NaGdF4@NaGdF4:Yb,Er@DNA nanoparticles were added into various wells and incubated with HepG2 cells for another 24 h. Subsequently, 20 µL of 5 mg mL−1 MTT solution in PBS (pH = 7.4) was added into each well and further incubated for 4 h. 150 µL DMSO was added to each well to dissolve the MTT formazan crystals following the aspiration of supernatant in each well. Afterward, the absorbance was determined at 490 nm in a microplate reader.

2.6. Cellular uptake and confocal luminescence imaging For CLSM, the HepG2 cells were seeded in the confocal petri dishes in Dulbecco’s Modified Eagle Medium containing 10 % FBS for overnight incubation in 5 % CO2 at 37 oC. The NaGdF4@NaGdF4:Yb,Er@DNA nanoparticles with and without TAMRA-DNA were added into the HepG2 cells at 37 oC for 0, 1, 4, 8 and 20 h, respectively. Thereafter, the medium was removed and the cells were washed three times with PBS (pH=7.4), fixed with methanol (1 mL) for 10 min at -20 oC, and then rinsed with PBS three times again. Subsequently, DAPI (2 µg/mL) was used to stain the cell nucleus for about 15 min at 37 oC in darkness,

and

then

rinsed

with

PBS

three

times.

5


To

further

apply


Page 6 of 23

NaGdF4@NaGdF4:Yb,Er@DNA nanoparticles to the intracellular miR-122 imaging, HepG2 and CCC-HEL-1 cells were incubated with the mixture of NaGdF4@NaGdF4:Yb,Er@DNA nanoparticles

and

TAMRA-labelled

DNA,

pure

nanoparticles

of

NaGdF4@NaGdF4:Yb,Er@DNA nanoparticles for 8 h, respectively. Then the images of HepG2 and CCC-HEL-1 cells were recorded by CLSM.

2.7. In Vivo Imaging of NaGdF4@NaGdF4:Yb,Er@DNA In vivo imaging was carried out on IVIS Spectrum (PerkinElmer). BALB/c nude mice, aged 7-8 weeks, were obtained from Vital River (Beijing, China). First, 50 µL of NaGdF4@NaGdF4:Yb,Er@DNA (20 mg/mL) and 50 µL of (TAMRA)-DNA (5 µM) were mixed, then the mixture was subcutaneously injected into the tumor issue of BALB/c nude mice. Subsequently, different amounts of miR-122 (5 µL, 7.5 µL, 15 µL, 30 µL (5 µM, respectively) were injected into the same site for in vivo imaging. The signals were recorded

after incubation for 0.5 h, plenty of photons emitted from the same region of interest (ROI) were

observed.

For

endogenous

miR-122

detection,

the

mixture

of

NaGdF4@NaGdF4:Yb,Er@DNA (20 mg/mL) and PBS, as well as the mixture of NaGdF4@NaGdF4:Yb,Er@DNA (20 mg/mL) and (TAMRA)-DNA (5 µM) were injected into mice by tail vein injection, and fed them for about another 4 h. Then, we dissected the mice to take their livers out to conduct the optical imaging experiments. The images were obtained with 980 and 545 nm excitation. All protocols requiring the use of animals were approved by the animal care committee of Beijing Normal University.

2. RESULTS AND DISCUSSION 3.1. Design of NaGdF4@NaGdF4:Yb,Er@DNA nanoparticles As

shown

in

Scheme

1,

firstly,

the

oleate

capped

core-shell

UCNPs

of

NaGdF4@NaGdF4:Yb,Er were prepared by a layer-by-layer seed-mediated shell growth strategy: the core of NaGdF4 was first prepared by the addition of NaF into Gd(oleate)3-contained OA/ODE solvent, and then the shell of NaGdF4:Yb,Er was subsequently deposited on the surface of the core by the addition of Gd(oleate)3:Yb,Er

40-41

into reaction system, which formed NaGdF4@NaGdF4:Yb,Er core-shell nanoparticles. As designed, the nanoparticles emitted emissions at 545 nm under 980 nm excitation. 6


Page 7 of 23 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Subsequently, the UCNPs-contained chloroform was dropped into a capture DNA solution and stirred for about 12 h without any extra chemical modifications

39

; the capture

DNA-functionalized UCNPs were simply synthesized through the ligand exchange between the capture DNA and lanthanide ions on the surface of the oleic acid capped NaGdF4@NaGdF4:Yb,Er nanoparticles. Secondly, the sandwich-FRET detection system was constructed: capture DNA-functionalized UCNPs were the energy donor, and the dye of TAMRA labelled on another shorter DNA acted as the energy acceptor for its excitation at about 550 nm that corresponded with the emission of UCNPs at 545 nm. Close to external energy acceptors, emitting ions (Er3+) precisely located in the inner shell of DNA-functionalized UCNPs, and the longer target of miR-122 can make the energy donor (UCNPs) and acceptor (TAMRA) close enough through hybridization with two shorter DNAs. By the sandwich-DNA-hybridization, TAMRA was directly connected with shorter capture DNA that labelled on UCNPs surface without any extra ligand, which dramatically shortened the distance from TAMRA to the surface of UCNPs. Therefore, the energy transfer from UNCPs to TAMRA occurred, which obtained decreased signals at 545 nm as well as increased ones at 580 nm. At last, the detection of miR-122 can be achieved by the measurement of the changed signals during the energy transfer.

Scheme

1.

Schematic

illustration

of

the

synthesis

and

workflow

NaGdF4@NaGdF4:Yb,Er@DNA nanoparticles for sensitive detection of miR-122.

3.2. Characterizations of NaGdF4@NaGdF4:Yb,Er@DNA nanoparticles 7


of


Page 8 of 23

To confirm the successful construction of core-shell UCNPs of NaGdF4@NaGdF4:Yb,Er by layer-by-layer seed-mediated shell growth route (Figure 1A)

35-36

, some characterizations

on synthesized nanoparticles were employed. As demonstrated by transmission electron microscope (TEM) images, the NaGdF4 core showed an average diameter of 12.4 nm (Figure 1B-a, Figure S1-A in Supporting Information). After the deposition of NaGdF4:Yb,Er on the NaGdF4 core surface, the whole core-shell UCNPs grew to be 16.8 nm (Figure 1B-b, Figure S1-B), which indicated that the shell of UCNPs was in the thickness of about 2.2 nm. In addition, judging from the 2D elemental mapping by energy-dispersive X-ray spectroscopy (EDS), Gd3+ was confirmed to be present in the core of nanoparticles, and Yb3+ and Er3+ were mainly distributed in the shell (Figure 1C). Therefore, emitting ions (Er3+) were precisely located in the thin shell, which was close to external energy acceptors for obtaining the high energy-transfer efficiency, and the thickness of UCNPs shell was in accordance with the basic requirement of the energy-transfer distance within 10 nm for FRET. Furthermore, the fabricated nanoparticles were hexagonal-phase NaGdF4 (JPCDS No. 27-0699) demonstrated by

X-ray

diffraction

(XRD)

patterns

(Figure

1D)

42-43

.

Thus,

UCNPs

of

NaGdF4@NaGdF4:Yb,Er with core-shell structure were successfully constructed, ready for the subsequent DNA functionalization on the surface of UCNPs.

8


Page 9 of 23 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Figure 1. Characterizations of core-shell UCNPs nanoparticles of NaGdF4@NaGdF4:Yb,Er. (A) Preparation process of core-shell nanoparticles. (B) TEM images of the NaGdF4 core (a) and the core-shell nanoparticles (b). (C) 2D elemental mapping by EDS for the distribution of Gd3+, Yb3+ and Er3+. (D) XRD patterns of NaGdF4 (a) and NaGdF4@NaGdF4:Yb,Er (b) nanoparticles.

As demonstrated in Figure 2A, the capture DNA was successfully functionalized on the outer surface of UCNPs according to the record of typical UV-Vis absorbance of DNA at 260 nm from functionalized nanoparticles. DNA chains modified on the surface of nanoparticles showed lighter color in TEM image (Figure S2-A), and the peaks of DNA marked by green 9



Page 10 of 23

circles in FT-IR spectra (Figure S2-B) also confirmed the successful modification of DNA on NaGdF4@NaGdF4:Yb,Er nanoparticles surfaces. This was further demonstrated by observations on the highly negative charge on nanoparticles by zeta potential measurement (Figure 2B), which was also in accordance with the report

39

. In addition, the feasibility of

selecting TAMRA-labelled DNAs as energy acceptor was confirmed by the green emission of UCNPs (Figure 2C-a), which matched well with the absorption of TAMRA (Figure 2C-b) that showed emission at 580 nm (Figure 2C-c). Significantly, DNA functionalization had no effect on the upconversion optical property of UCNPs, which was demonstrated by the similar emissions of NaGdF4@NaGdF4:Yb,Er@DNA and NaGdF4@NaGdF4:Yb,Er under the excitation at 980 nm (Figure 2D-a, b). Therefore, during FRET process, based on the hybridization of miR-122 with two designed shorter DNAs, the emission of UCNPs at 545 nm decreased combining with the increase of TAMRA emission at 580 nm (Figure 2D-c). The PL decay spectra of UCNPs before and after reacting with miRNA at different concentrations also proved the successful energy transfer between the UCNPs and TAMRA-labelled DNAs (Figure S3). Thus, DNA-functionalized core-shell UCNPs could be used for the sensitive detection of miR-122 without any interference.

Figure

2.

Characterizations

of

DNA-functionalized

core-shell

UCNPs

of

NaGdF4@NaGdF4:Yb,Er@DNA. (A) UV-Vis spectra before and after DNA functionalization. 10


Page 11 of 23 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


(B) Zeta potential (pH=7.4). (C) The emission of nanoparticles excited at 980 nm (a), the absorption (b) and emission (c) spectra of TAMRA. (D) Emission spectra before (a) and after (b) DNA functionalization, as well as the emission spectrum of nanoparticles after FRET with the presence of miR-122 (c).

3.3. The feasibility of UCNPs for the detection of miR-122 To examine the performance of DNA-functionalized core-shell UCNPs for the detection of miR-122, the sensitivity and linearity were determined. As shown in Figure 3, with the increase of miR-122 amount, upconversion emission of NaGdF4@NaGdF4:Yb,Er@DNA at 545 nm decreased combining with the increase of signals at 580 nm, generated from FRET from UCNPs to TAMRA through sandwich-hybridization of longer miR-122 with two shorter DNAs. The inset of Figure 3 showed plots of I545nm/I580nm against miR-122 concentration, giving the linear range of 0 to 10-12 M with the LOD of 10-13 M. Furthermore, this method exhibited high specificity for sandwich-hybridization between miR-122 and designed DNAs. This was further confirmed by the failure of determining a similar 22-mer oligonucleotide of microRNA 35 (non-complementary to two shorter DNAs), which showed no obvious changes on signals of both UCNPs and TAMRA (Figure S4). In addition, the FRET efficiency was calculated to be 48.99%, based on the equation: E=1-I1/I0, where I0 is the original FL intensity of UCNPs at 545 nm in the emission spectra without miR-122, I1 is the FL intensity at 545 nm with 100 nM miR-122.

11



Page 12 of 23

Figure 3. The emission spectra of NaGdF4@NaGdF4:Yb,Er@DNA nanoparticles in the presence of different concentrations of miR-122. The insets are the linear relationship between I580 nm/I545 nm and miR-122 concentration (up), as well as the enlarged view of the emission at 580 nm (down).

3.4. Cell Imaging of miR-122 For potential biological applications, the biocompatibility of DNA-functionalized core-shell UCNPs of NaGdF4@NaGdF4:Yb,Er@DNA was evaluated. The standard 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium

bromide

(MTT)

cell

assay

was

performed on HepG2 cells to estimate the cytotoxicity of UCNPs. As demonstrated, more than 88.9% cell viability was acquired in concentration ranges up to 100 mg·mL-1 NaGdF4@NaGdF4:Yb,Er@DNA after the incubation for 24 h (Figure S5). Therefore, the present method could be applied to the sensing and imaging of miRNAs in biological systems with low cytotoxicity. Subsequently, NaGdF4@NaGdF4:Yb,Er@DNA nanoparticles were used for the in situ imaging of miR-122 in cells. Considering the liver-specific miR-122 was frequently down-regulated in hepatocarcinoma humans that constituting 70% of total miRNA population in human liver

44

, HepG2 cancer cells were selected as model cells, which were 12


Page 13 of 23 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


simultaneously compared with CCC-HEL-1 normal cells. For cell imaging of miR-122, the successful entering of NaGdF4@NaGdF4:Yb,Er@DNA and TAMRA-labelled DNA into cells has been confirmed by CLSM images of cells obtained after the incubation of NaGdF4@NaGdF4:Yb,Er@DNA and TAMRA-labelled DNA with HepG2 (Figure S6, S7). Then, the effect of incubation time on the imaging was firstly investigated by incubating HepG2 cells with NaGdF4@NaGdF4:Yb,Er@DNA nanoparticles for different time. The images were recorded by CLSM upon 980 nm excitation. As demonstrated in Figure 4, we observed weak luminescence signals after the incubation of cells for 1 h; signal intensities increased with the increase of the incubation time and became brightest at 8 h. While no significant increased signal was recorded at 20 h, which indicated the optimized incubation time would be 8 h.

Figure 4. CLSM images of HepG2 cells incubated with NaGdF4@NaGdF4:Yb,Er@DNA for different incubation time, λex = 980 nm.

To further introduce the present UCNPs into intracellular miR-122 imaging, HepG2 and CCC-HEL-1 cells were incubated with the mixture of NaGdF4@NaGdF4:Yb,Er@DNA and TAMRA-labelled DNA, which were simultaneously compared with blank signals obtained by 13



incubating with NaGdF4@NaGdF4:Yb,Er@DNA only. As demonstrated, compared with images acquired by incubating with UCNPs only (Figure 5A-i), we collected decreased signals for CCC-HEL-1 cells incubated with the mixture of UCNPs and TAMRA-labelled DNA (Figure 5A-ii). The decreased signals can be assigned to FRET from UCNPs to the dye of TAMRA by sandwich-hybridization between longer miR-122 and two complementary DNAs, definitely realized the imaging of miRNA in cells. While no obvious decreased signal was observed in images of HepG2 cells because no FRET occurred with down-regulated expression of miR-122. Furthermore, the relative contents of miR-122 in HepG2 and CCC-HEL-1 cells were further confirmed by quantitative real-time polymerase chain reaction (qRT-PCR) and electrophoretic analysis, which was in accordance with the previous reports (Figure S8)

1, 45

. It should be noted, although aggregation of NPs might generate during cell

imaging, it still has little effect on the detection of miR-122 by our method. Therefore, we could directly acquire the cell imaging to obtain the miR-122 information in cells, which could also be applied to the imaging of other miRNAs and therefore show potentials in clinic diagnosis.

14


Page 14 of 23

Page 15 of 23 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Figure 5. CLSM images of (A) CCC-HEL-1 and (B) HepG2 cells incubated with NaGdF4@NaGdF4:Yb,Er@DNA only (i) and the mixture of NaGdF4@NaGdF4:Yb,Er@DNA and TAMRA-labelled DNA (ii).

3.5 In vivo imaging of NaGdF4@NaGdF4:Yb,Er@DNA In vivo experiments were carried out to verify the good performance of the NaGdF4@NaGdF4:Yb,Er@DNA. In the experiments, both exogenous and endogenous miR-122 have been detected by in vivo imaging. Firstly, the feasibility of exogenous miR-122 detection by this method was confirmed by in vivo imaging of BALB/c nude mice with human liver cancer. As demonstrated, strong imaging signal was obtained when the tumor mouse was subcutaneously injected with the mixture of NaGdF4@NaGdF4:Yb,Er@DNA and (TAMRA)-DNA (Figure 6b), while no signal was observed by PBS injection (Figure 6a). Compared with Figure 6b, no significant difference was observed without (TAMRA)-DNA (Figure 6c) injection, indicating the important role of (TAMRA)-DNA during the detection. While, with the subcutaneous injection

of

miR-122

into

the

tumor

issue

of

BALB/c

nude

mice

with

NaGdF4@NaGdF4:Yb,Er@DNA and (TAMRA)-DNA, the FL signal decreased due to the high abundance of miR-122 (Figure 6d to g), which was consistent with the trend of in vitro experimental results. Therefore, the NaGdF4@NaGdF4:Yb,Er@DNA can be used for the detection of exogenous miR-122 by vivo imaging.

15



Figure 6. In vivo optical imaging of a nude mouse with human liver cancer (inoculated with HepG2 cells for 2 weeks) subcutaneously injected with different reagents. (a) 100 µL PBS (0.01 M, pH 7.2-7.4); (b) 50 µL UCNPs (20 mg/mL)+50 µL (TAMRA)-DNA (5 µM); (c) 50 µL UCNPs+30 µL miR-122 (5 µM); (d) 50 µL UCNPs+50 µL (TAMRA)-DNA+5 µL miR-122 (5 µM); (e) 7.5 µL; (f) 15 µL; (g) 30 µL. λex = 980 nm. ROIs are denoted in rose red circles.

Furthermore, the detection of endogenous miR-122 was carried out by in vivo imaging of healthy livers taken from healthy BALB/c nude mice. In the experiments, the reagents were injected into mice by tail vein injection, followed by the feeding for about 4 h. After the feeding, the mice were still vivacious, which indicated that the UCNPs showed low toxicity to mice within 4 hours. Then, we dissected the mice to take out their livers for the optical imaging. As shown in Figure 7, the significant FL signals with the injection of UCNPs (Figure 7C-ii) or the mixture of (TAMRA)-DNA and UCNPs (Figure 7B-iii) demonstrated that the reagents were successfully accumulated in liver. Significantly, with the injection of (TAMRA)-DNA and UCNPs (Figure 7C-iii), the FL signals decreased compared with the 16


Page 16 of 23

Page 17 of 23 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


liver injected with UCNPs only (Figure 7C-ii), which demonstrated that our detection system can be used for the detection of endogenous miR-122 in healthy liver of BALB/c nude mice. Therefore, the synthesized NaGdF4@NaGdF4:Yb,Er@DNA can be well used for the detection of both exogenous and endogenous miR-122 in mice.

Figure 7. Optical imaging of fresh liver tissue samples from healthy mice injected with reagents by tail vein injection. (A) 200 µL PBS (0.01 M, pH 7.2-7.4); (B) UCNPs+100 µL PBS; (C) 100 µL UCNPs (20 mg/mL)+100 µL (TAMRA)-DNA.

3. CONCLUSIONS

In summary, FRET-based UCNPs exhibited high FRET efficiency because the core-shell structure made emitting ions located in the thin shell, which were close enough to external energy acceptors. The energy transfer distance was controlled by the length of DNA chain, which was simply functionalized on UCNPs by ligand exchange at the liquid-liquid interface without any extra surface ligand-needed modification. Subsequently, the FRET occurred for the specific and sensitive detection of miR-122, based on sandwich-DNA-hybridization between the longer miR-122 and shorter capture DNAs on UCNPs surface and dye-labeled reported DNAs. On account of low cytotoxicity, FRET-based UCNPs were successfully used for the imaging of miR-122 in cells and both exogenous and endogenous miR-122 in mice. 17



Page 18 of 23

This strategy has opened up a new pathway to the determination of miRNA in biological systems, which shows potential in clinical diagnosis or therapy.

ASSOCIATED CONTENT Supporting Information. The Supporting Information is available free of charge on the ACS Publications website. Supplementary

size

distribution

results of

NaGdF4

and

NaGdF4@NaGdF4:Yb,Er

nanoparticles, PL decays spectra and upconversion luminescence emission spectra of NaGdF4@NaGdF4:Yb,Er@DNA nanoparticles before and after reacting with miRNA at different concentrations, in vitro cytotoxicity results, TEM image and FT-IR spectra of NaGdF4@NaGdF4:Yb, Er@DNA, qRT-PCR result, as well as supplementary CLSM image of HepG2 cells were exhibited in Supporting Information.

AUTHOR INFORMATION Corresponding Author *Tel.: +86-10-58805373. E-mail: [email protected] (N. Na)

Author Contributions ‡These authors contributed equally to this work.

Notes The authors declare no competing financial interest.

ACKNOWLEDGMENTS N. Na, H. Ren, Z. Long, et al thank the National Natural Science Foundation of China (21675015, 21422503) and the Fundamental Research Funds for the Central Universities; J. Ouyang thanks the financial support provided by the National Natural Science Foundation of China (21475011, 21675014).

REFERENCES (1) Esau, C.; Davis, S.; Murray, S. F.; Yu, X. X.; Pandey, S. K.; Pear, M.; Watts, L.; Booten, S. 18


Page 19 of 23 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


L.; Graham, M.; McKay, R.; Subramaniam, A.; Propp, S.; Lollo, B. A.; Freier, S.; Bennett, C. F.; Bhanot, S.; Monia, B. P. miR-122 Regulation of Lipid Metabolism Revealed by in Vivo Antisense Targeting. Cell Metab. 2006, 3 (2), 87-98. (2) Bi, S.; Chen, M.; Jia, X.; Dong, Y. A Hot-Spot-Aactive Magnetic Graphene Oxide Substrate for MicroRNA Detection Based on Cascaded Chemiluminescence Resonance Energy Transfer. Nanoscale 2015, 7 (8), 3745-3753. (3) Lin, C. J.; Gong, H. Y.; Tseng, H. C.; Wang, W. L.; Wu, J. L. miR-122 Targets an Anti-Apoptotic Gene, Bcl-w, in Human Hepatocellular Carcinoma Cell Lines. Biochem. Biophys. Res. Commun. 2008, 375 (3), 315-320. (4) Kutay, H.; Bai, S.; Datta, J.; Motiwala, T.; Pogribny, I.; Frankel, W.; Jacob, S. T.; Ghoshal, K. Downregulation of miR-122 in the Rodent and Human Hepatocellular Carcinomas. J. Cell. Biochem. 2006, 99 (3), 671-678. (5) Su, S.; Fan, J.; Xue, B.; Yuwen, L.; Liu, X.; Pan, D.; Fan, C.; Wang, L. DNA-Conjugated Quantum Dot Nanoprobe for High-Sensitivity Fluorescent Detection of DNA and Micro-RNA. ACS Appl. Mater. Inter. 2014, 6 (2), 1152-1157. (6) Zhang, S.; Liu, R.; Xing, Z.; Zhang, S.; Zhang, X. Multiplex miRNA Assay Using Lanthanide-Tagged Probes and the Duplex-Specific Nuclease Amplification Strategy. Chem. Commun. 2016, 52 (99), 14310-14313. (7) Gerasimova, Y. V.; Peck, S.; Kolpashchikov, D. M. Enzyme-Assisted Binary Probe for Sensitive Detection of RNA and DNA. Chem. Commun. 2010, 46 (46), 8761-8763. (8) Persat, A.; Santiago, J. G. MicroRNA Profiling by Simultaneous Selective Isotachophoresis and Hybridization with Molecular Beacons. Anal. Chem. 2011, 83 (6), 2310-2316. (9) Qu, X.; Li, Y.; Li, L.; Wang, Y.; Liang, J.; Liang, J. Fluorescent Gold Nanoclusters: Synthesis and Recent Biological Application. J. Nanomater. 2015, 2015, 1-23. (10) Labib, M.; Ghobadloo, S. M.; Khan, N.; Kolpashchikov, D. M.; Berezovski, M. V. Four-Way Junction Formation Promoting Ultrasensitive Electrochemical Detection of MicroRNA. Anal. Chem. 2013, 85 (20), 9422-9427. (11) Khan, N.; Cheng, J.; Pezacki, J. P.; Berezovski, M. V. Quantitative Analysis of MicroRNA in Blood Serum with Protein-Facilitated Affinity Capillary Electrophoresis. Anal. Chem. 2011, 83 (16), 6196-6201. (12) Wang, T.; Viennois, E.; Merlin, D.; Wang, G. Microelectrode miRNA Sensors Enabled by Enzymeless Electrochemical Signal Amplification. Anal. Chem. 2015, 87 (16), 8173-8180. (13) Lodes, M. J.; Caraballo, M.; Suciu, D.; Munro, S.; Kumar, A.; Anderson, B. Detection of Cancer with Serum miRNAs on an Oligonucleotide Microarray. PLOS ONE 2009, 4 (7), e6229. (14) Tian, Q.; Wang, Y.; Deng, R.; Lin, L.; Liu, Y.; Li, J. Carbon Nanotube Enhanced Label-Free Detection of MicroRNAs Based on Hairpin Probe Triggered Solid-Phase Rolling-Circle Amplification. Nanoscale 2015, 7 (3), 987-993. (15) Lu, Z.; Zhang, L.; Deng, Y.; Li, S.; He, N. Graphene Oxide for Rapid MicroRNA Detection. Nanoscale 2012, 4 (19), 5840-5842. (16) Huang, J.; Wang, H.; Yang, X.; Yang, Y.; Quan, K.; Ying, L.; Xie, N.; Ou, M.; Wang, K. A Supersandwich Fluorescence in Situ Hybridization Strategy for Highly Sensitive and Selective mRNA Imaging in Tumor Cells. Chem. Commun. 2016, 52 (2), 370-373. 19



(17) Feng, Y.; Chen, H.; Ma, L.; Shao, B.; Zhao, S.; Wang, Z.; You, H. Surfactant-Free Aqueous Synthesis of Novel Ba2GdF7:Yb(3+), Er(3+)@PEG Upconversion Nanoparticles for in Vivo Trimodality Imaging. ACS Appl. Mater. Inter. 2017, 9 (17), 15096-15102. (18) Li, H.; Wei, R.; Yan, G. H.; Sun, J.; Li, C.; Wang, H.; Shi, L.; Capobianco, J. A.; Sun, L. Smart Self-Assembled Nanosystem Based on Water-Soluble Pillararene and Rare-Earth-Doped Upconversion Nanoparticles for pH-Responsive Drug Delivery. ACS Appl. Mater. Inter. 2018, 10 (5), 4910-4920. (19) Yang, Y.; Shao, Q.; Deng, R.; Wang, C.; Teng, X.; Cheng, K.; Cheng, Z.; Huang, L.; Liu, Z.; Liu, X.; Xing, B. In Vitro and in Vivo Uncaging and Bioluminescence Imaging by Using Photocaged Upconversion Nanoparticles. Angew. Chem. Int. Ed. 2012, 51 (13), 3125-3129. (20) Wang, L.; Yan, R.; Huo, Z.; Zeng, J.; Bao, J.; Wang, X.; Peng, Q.; Li, Y. Fluorescence Resonant Energy Transfer Biosensor Based on Upconversion-Luminescent Nanoparticles. Angew. Chem. Int. Ed. 2005, 44 (37), 6054-6057. (21) Boyer, J.-C.; Cuccia, L. A.; Capobianco, J. A. Synthesis of Colloidal Upconverting NaYF4:Er3+/Yb3+ and Tm3+/Yb3+ Monodisperse Nanocrystals. Nano Lett. 2007, 7 (3), 847-852. (22) Bogdan, N.; Vetrone, F.; Ozin, G. A.; Capobianco, J. A. Synthesis of Ligand-Free Colloidally Stable Water Dispersible Brightly Luminescent Lanthanide-Doped Upconverting Nanoparticles. Nano Lett. 2011, 11 (2), 835-840. (23) Liu, C.; Qi, Y.; Qiao, R.; Hou, Y.; Chan, K.; Li, Z.; Huang, J.; Jing, L.; Du, J.; Gao, M. Detection of Early Primary Colorectal Cancer with Upconversion Luminescent NP-Based Molecular Probes. Nanoscale 2016, 8 (25), 12579-12587. (24) Wu, S.; Kong, X. J.; Cen, Y.; Yuan, J.; Yu, R. Q.; Chu, X. Fabrication of a LRET-Based Upconverting Hybrid Nanocomposite for Turn-On Sensing of H2O2 and Glucose. Nanoscale 2016, 8 (16), 8939-8946. (25) Zhang, L.; Wang, T.; Yang, L.; Liu, C.; Wang, C.; Liu, H.; Wang, Y. A.; Su, Z. General Route to Multifunctional Uniform Yolk/Mesoporous Silica Shell Nanocapsules: A Platform for Simultaneous Cancer-Targeted Imaging and Magnetically Guided Drug Delivery. CHEM-EUR J 2012, 18 (39), 12512-12521. (26) Yang, X.; Xiong, J.; Qiu, P.; Chen, M.; He, D.; He, X.; Wang, K.; Tang, J. Synthesis of a Core/Satellite-Like Multifunctional Nanocarrier for pH- and NIR-Triggered Intracellular Chemothermal Therapy and Tumor Imaging. RSC Adv. 2017, 7 (13), 7742-7752. (27) Jia, X.; Yin, J.; He, D.; He, X.; Wang, K.; Chen, M.; Li, Y. Polyacrylic Acid Modified Upconversion Nanoparticles for Simultaneous pH-Triggered Drug Delivery and Release Imaging. J. Biomed. Nanotechnol. 2013, 9 (12), 2063-2072. (28) Yang, D.; Ma, P. a.; Hou, Z.; Cheng, Z.; Li, C.; Lin, J. Current Advances in Lanthanide Ion (Ln3+)-Based Upconversion Nanomaterials for Drug Delivery. Chem. Soc. Rev. 2015, 44 (6), 1416-1448. (29) Dai, Y.; Xiao, H.; Liu, J.; Yuan, Q.; Ma, P. a.; Yang, D.; Li, C.; Cheng, Z.; Hou, Z.; Yang, P.; Lin, J. In Vivo Multimodality Imaging and Cancer Therapy by Near-Infrared Light-Triggered Trans-Platinum Pro-Drug-Conjugated Upconverison Nanoparticles. J. Am. Chem. Soc. 2013, 135 (50), 18920-18929. (30) DaCosta, M. V.; Doughan, S.; Han, Y.; Krull, U. J. Lanthanide Upconversion Nanoparticles and Applications in Bioassays and Bioimaging: A Review. Anal. Chim. Acta. 20


Page 20 of 23

Page 21 of 23 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


2014, 832, 1-33. (31) Ou, M.; Huang, J.; Yang, X.; Quan, K.; Yang, Y.; Xie, N.; Wang, K. MnO2 Nanosheet Mediated "DD-A" FRET Binary Probes for Sensitive Detection of Intracellular mRNA. Chem. Sci. 2017, 8 (1), 668-673. (32) Yang, Y.; Huang, J.; Yang, X.; Quan, K.; Wang, H.; Ying, L.; Xie, N.; Ou, M.; Wang, K. FRET Nanoflares for Intracellular mRNA Detection: Avoiding False Positive Signals and Minimizing Effects of System Fluctuations. J. Am. Chem. Soc. 2015, 137 (26), 8340-8343. (33) Ying, L.; Xie, N.; Yang, Y.; Yang, X.; Zhou, Q.; Yin, B.; Huang, J.; Wang, K. A Cell-Surface-Anchored Ratiometric i-Motif Sensor for Extracellular pH Detection. Chem. Commun. 2016, 52 (50), 7818-7821. (34) Gai, S.; Li, C.; Yang, P.; Lin, J. Recent Progress in Rare Earth Micro/Nanocrystals: Soft Chemical Synthesis, Luminescent Properties, and Biomedical Applications. Chem. Rev. 2014, 114 (4), 2343-2389. (35) Li, S.; Xu, L.; Ma, W.; Wu, X.; Sun, M.; Kuang, H.; Wang, L.; Kotov, N. A.; Xu, C. Dual-Mode Ultrasensitive Quantification of MicroRNA in Living Cells by Chiroplasmonic Nanopyramids Self-Assembled from Gold and Upconversion Nanoparticles. J. Am. Chem. Soc. 2016, 138 (1), 306-312. (36) Wang, F.; Liu, X. Recent Advances in the Chemistry of Lanthanide-Doped Upconversion Nanocrystals. Chem. Soc. Rev. 2009, 38 (4), 976-989. (37) Zhang, P.; Rogelj, S.; Nguyen, K.; Wheeler, D. Design of a Highly Sensitive and Specific Nucleotide Sensor Based on Photon Upconverting Particles. J. Am. Chem. Soc. 2006, 128 (38), 12410-12411. (38) Laurenti, M.; Paez-Perez, M.; Algarra, M.; Alonso-Cristobal, P.; Lopez-Cabarcos, E.; Mendez-Gonzalez, D.; Rubio-Retama, J. Enhancement of the Upconversion Emission by Visible-to-Near-Infrared Fluorescent Graphene Quantum Dots for miRNA Detection. ACS Appl. Mater. Inter. 2016, 8 (20), 12644-12651. (39) Li, L. L.; Wu, P.; Hwang, K.; Lu, Y. An Exceptionally Simple Strategy for DNA-Functionalized Up-Conversion Nanoparticles as Biocompatible Agents for Nanoassembly, DNA Delivery, and Imaging. J. Am. Chem. Soc. 2013, 135 (7), 2411-2414. (40) Li, Z.; Liang, T.; Lv, S.; Zhuang, Q.; Liu, Z. A Rationally Designed Upconversion Nanoprobe for in Vivo Detection of Hydroxyl Radical. J. Am. Chem. Soc. 2015, 137 (34), 11179-11185. (41) Li, Z.; Lv, S.; Wang, Y.; Chen, S.; Liu, Z. Construction of LRET-Based Nanoprobe Using Upconversion Nanoparticles with Confined Emitters and Bared Surface as Luminophore. J. Am. Chem. Soc. 2015, 137 (9), 3421-3427. (42) Zhang, F.; Che, R.; Li, X.; Yao, C.; Yang, J.; Shen, D.; Hu, P.; Li, W.; Zhao, D. Ddirect Imaging the Upconversion Nanocrystal Core/Shell Structure at the Subnanometer Level: Shell Thickness Dependence in Upconverting Optical Properties. Nano Lett. 2012, 12 (6), 2852-2858. (43) Li, X.; Wang, R.; Zhang, F.; Zhao, D. Engineering Homogeneous Doping in Single Nanoparticle to Enhance Upconversion Efficiency. Nano Lett. 2014, 14 (6), 3634-3639. (44) Bai, S.; Nasser, M. W.; Wang, B.; Hsu, S. H.; Datta, J.; Kutay, H.; Yadav, A.; Nuovo, G.; Kumar, P.; Ghoshal, K. MicroRNA-122 Inhibits Tumorigenic Properties of Hepatocellular Carcinoma Cells and Sensitizes These Cells to Sorafenib. J. Biol. Chem. 2009, 284 (46), 21



32015-32027. (45) Deng, X. G.; Qiu, R. L.; Wu, Y. H.; Li, Z. X.; Xie, P.; Zhang, J.; Zhou, J. J.; Zeng, L. X.; Tang, J.; Maharjan, A.; Deng, J. M. Overexpression of miR-122 Promotes the Hepatic Differentiation and Maturation of Mouse ESCs through a miR-122/FoxA1/HNF4a-Positive Feedback Loop. Liver Int. 2014, 34 (2), 281-295.

22


Page 22 of 23

Page 23 of 23 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Table of Contents

23


A Sandwich-DNA-Hybridization FRET Strategy for miR-122 Detection

Recommend Documents