A Synthetic Alternative to Canonical One-Carbon Metabolism - ACS

Research Article pubs.acs.org/synthbio

A Synthetic Alternative to Canonical One-Carbon Metabolism Madeleine Bouzon,*,†,‡,§,∥ Alain Perret,†,‡,§,∥ Olivier Loreau,⊥ Valérie Delmas,†,‡,§,∥ Nadia Perchat,†,‡,§,∥ Jean Weissenbach,†,‡,§,∥ Frédéric Taran,⊥ and Philippe Marlière*,# †

CEA, Genoscope, 2 rue Gaston Crémieux, 91000 Evry, France CNRS UMR8030 Génomique Métabolique, 2 rue Gaston Crémieux, 91000 Evry, France § Université Evry Val d’Essone, 91000 Evry, France ∥ Université Paris-Saclay, 91000 Evry, France ⊥ CEA, iBiTecS, SCBM, 91191 Gif-sur-Yvette, France # Institute of Systems and Synthetic Biology, Génopole, 5 rue Desbruères, 91030 Evry Cedex, France ‡

S Supporting Information *

ABSTRACT: One-carbon metabolism is an ubiquitous metabolic pathway that encompasses the reactions transferring formyl-, hydroxymethyl- and methyl-groups bound to tetrahydrofolate for the synthesis of purine nucleotides, thymidylate, methionine and dehydropantoate, the precursor of coenzyme A. An alternative cyclic pathway was designed that substitutes 4-hydroxy-2-oxobutanoic acid (HOB), a compound absent from known metabolism, for the amino acids serine and glycine as one-carbon donors. It involves two novel reactions, the transamination of L-homoserine and the transfer of a one-carbon unit from HOB to tetrahydrofolate releasing pyruvate as coproduct. Since canonical reactions regenerate L-homoserine from pyruvate by carboxylation and subsequent reduction, every one-carbon moiety made available for anabolic reactions originates from CO2. The HOB-dependent pathway was established in an Escherichia coli auxotroph selected for prototrophy using long-term cultivation protocols. Genetic, metabolic and biochemical evidence support the emergence of a functional HOB-dependent one-carbon pathway achieved with the recruitment of the two enzymes L-homoserine transaminase and HOB-hydroxymethyltransferase and of HOB as an essential metabolic intermediate. Escherichia coli biochemical reprogramming was achieved by minimally altering canonical metabolism and leveraging on natural selection mechanisms, thereby launching the resulting strain on an evolutionary trajectory diverging from all known extant species. KEYWORDS: Escherichia coli, evolution, one-carbon metabolism, synthetic pathway, long-term continuous culture

T

the biochemical and thermodynamic constraints that shaped it.1,2 As a consequence, the chemical space that is within reach in nature is restrained by the architecture of the core metabolism as well as by the metabolic fluxes, which are finely tuned for biomass production. In this context, implementing synthetic alternatives to canonical pathways by engineering living cells could be fruitful for both tackling fundamental questions and targeting practical goals. The comparison of the functional merits of synthetic pathways with those of their natural counterparts may shed light on the principles of the organization of cellular metabolism. On the other hand, metabolism engineering constitutes a powerful tool for diversifying the trophic and synthetic abilities of living organisms and for broadening the set of intermediates and bioconversions available for biotechnological applications.3,4 Numerous synthetic pathways have been implemented which

he mechanisms of evolution over 3.8 billion years have endowed extant living organisms with highly varied synthetic and degradative abilities as well as with the potential to further evolve in ever changing environments. Remarkably, despite the immense diversity of the habitats to which cellular lifeforms have adapted, cellular metabolism appears as a highly integrated edifice conserved throughout all kingdoms of life. Various routes transform the environmental inorganic or organic nutrients into intermediates, which are converted through universal steps in a set of 12 metabolic precursors for synthesizing all cellular constituents and for fulfilling energy and reducing power requirements. Besides the central carbon metabolism routes, which consist in the glycolysis and the pentose phosphate pathways and the tricarboxylic acid cycle, the biosynthetic pathways of the primary metabolites (amino acids, nucleic acid monomers, fatty acids, cofactors) are strongly conserved as well; only few deviations have been described. Models have been elaborated for giving an account of the origin and evolution of metabolism and for determining © XXXX American Chemical Society

Received: January 26, 2017

A

DOI: 10.1021/acssynbio.7b00029 ACS Synth. Biol. XXXX, XXX, XXX−XXX

Research Article

ACS Synthetic Biology

Figure 1. The HOB cycle. (a) The first part of the cycle (in black) consists in E. coli biosynthesis pathway of L-homoserine. EC numbers of the enzymes involved are indicated. The second part of the cycle (in red) recruits two unknown reactions, L-homoserine transamination into HOB and HOB cleavage into pyruvate and formaldehyde. Phosphorylation of pyruvate regenerates PEP. A functional HOB cycle was selected in vivo by fueling formaldehyde into the C1 biosynthesis pathway (in gray) in an E. coli mutant lacking serine-hydroxymethyltransferase (2.1.2.1) and glycine-cleavage complex (2.1.2.10) (broken arrows). Changes in Gibbs energy, ΔrG′m at pH 7, ionic strength of 0.1 M and reactant concentration of 1 mM (in green) were calculated using the version 2.1 of eQuilibrator (http://equilibrator.weizmann.ac.il/).13 HOB standard Gibbs energy of formation ΔfG′0 was calculated using a group contribution method.14 Estimated standard ΔrG′0 are indicated in italics. (b) HOB is generated by L-homoserine transamination. (c) HOB is converted in the presence of H4F into pyruvate and CH2H4F. The wild-type activities of the recruited enzymes, 2.6.1.2 and 2.1.2.11 respectively, are also shown (in gray).

pathways and eventually, to their successful operation in a host organism. In the present work, we addressed these issues by targeting the one-carbon (C1) metabolism, one of the core metabolic pathways much conserved throughout all kingdoms of life. This pathway transfers C1-moieties at various oxidation states to the biosynthesis routes producing the building-blocks methionine, purine nucleotides, thymidylate and coenzyme A as well as the translation initiator formyl-methionyl-tRNA in Bacteria (Supplemental Figure S1a). The pivotal intermediate methylenetetrahydrofolate (CH2H4F) is obtained by the condensation

divert primary metabolites toward the biological production of valuable chemical compounds, natural as well as non-natural ones. Fewer attempts have more radically modified or substituted trophic and metabolic modes by deeply rewiring the canonical pathways of the core metabolism, yet with uneven success in terms of cellular growth ability.5−8 Because of limited understanding of complex biological networks, the experimental implementation of innovative synthetic pathways remains highly challenging at every level of the process, from the conception of novel biocatalysts to the integration of multistep B


Research Article


toate) suggested that HOB might be a marginal substrate for promiscuous enzymes. Since the HOB cycle produces the indispensable intermediate CH2H4F, its implementation can be put under selection in vivo by redesigning the C1 metabolic network such as to force the usage of the C1-moiety released by HOB cleavage as sole option for prototrophic cell growth. The HOB cycle was implemented in the bacterium Escherichia coli by subjecting a population of C1-auxotrophic E. coli mutants to two successive stages of directed evolution in vivo in long-term continuous cultures. The first stage of evolution targeted the adaptation of E. coli to the use of HOB as a CH2H4F donor through the recruitment of a HOB-hydroxymethyltransferase activity. The second stage aimed at establishing the endogenous production of HOB from L-homoserine to close the cycle. Selection for HOB Utilization as a C1-Moiety Source. An E. coli mutant lacking the enzymes which transfer C1moieties from serine and glycine to H4F was constructed by deleting the corresponding genes glyA and gcvTHP, as described in the Methods section (strain ST1, Supplemental Table S1). This mutant strain required the supply of methionine, inosine, thymidine and pantothenate (C1Cs) in the nutrient medium; the default of methionyl-tRNAi formylation did not abolish growth but rather slowed it.17 When supplied as a C1-source, HOB failed to satisfy any of the nutritional requirements of ST1 bacteria. Since this absence of complementation could result from inefficient transport of HOB, we looked for generating HOB directly in the cells by supplying bacteria with a transported HOB precursor. Banking on the broad substrate specificity of the dadA gene-encoded Dalanine dehydrogenase,18 we tested whether D-homoserine could be used by ST1 bacteria as a nitrogen and C1-source, given that D-homoserine deamination would release ammonia and HOB in the cells. In the presence of L-alanine, an inducer of dadA gene transcription, D-homoserine was an effective source of nitrogen as well as a partial C1 source for the auxotrophic strain ST1 (Supplemental Figure S2a). We assumed that this faint complementation resulted from effective transport of D-homoserine into the cells, deamination of Dhomoserine into HOB by DadA,18 and subsequent HOB cleavage and formaldehyde transfer onto H4F by a promiscuous hydroxymethyltransferase. E. coli K12 encodes two such activities, glyA-encoded serine hydroxymethyltransferase and panB-encoded dehydropantoate hydroxymethyltransferase. The strain ST1 being deleted for glyA gene and considering the structural similarity of HOB with dehydropantoate, we tested whether HOB could be substrate of the PanB enzyme. We performed experiments in vitro which indicated that the purified dehydropantoate hydroxymethyltransferase of E. coli catalyzes the conversion of HOB into pyruvate and CH2H4F in the presence of H4F (refer to Methods section). Pyruvate formation was evaluated using LTQ/Orbitrap analysis, by detecting a compound in the negative ionization mode at m/z 87.00892, with an accuracy of 1.7 ppm (peak area: 1.1 × 108 a.u.). Injection of a preparation of commercial pyruvate gave the same retention time and mass, confirming the identity of the enzymatic product. Targeting the triple objective of (i) enhanced expression of hydroxymethyltransferase activity, (ii) potential ability of divergent evolution of duplicated genes and (iii) genetic stability throughout generations, one copy of the gene panB from Bacillus subtilis (panB Bsu) was inserted into the chromosome of ST1 bacteria as a second panB allele (refer to Methods section). This duplication improved the growth of

of tetrahydrofolate (H4F) with a formaldehyde moiety originating from the amino acids serine or glycine (Supplemental Figure S1b);9−11 it is then interconverted to methylH4F and formyl-H4F by reversible redox reactions. In methylotrophic organisms, in addition to those two amino acids, alternative precursors are generated by the metabolism of reduced C1 carbon sources such as methane or methanol.12 Aiming to derive the C1-moieties from carbon dioxide (CO2), we devised a cyclic pathway which reduces CO2 to formaldehyde and transfers the latter to H4F, using pyruvate as a carrier and 4-hydroxy-2-oxobutanoic acid (HOB) as an intermediate. This pathway provides an alternative route for the generation of C1-compounds, where HOB replaces the canonical C1-donors serine and glycine. We identified HOB as a nonphysiological compound which may be introduced in cellular metabolism for triggering novel biosynthetic abilities. In particular, HOB has been proposed as an intermediate in engineered pathways for 1,3-propanediol production.13,14 This synthetic alternative to the universal C1-metabolism has been enforced in Escherichia coli (E. coli) by resorting to natural evolutionary mechanisms, i.e., spontaneous random mutations and selection of adaptive variants in large populations of growing bacteria submitted to controlled selective environmental conditions.

■

RESULTS AND DISCUSSION

Design of the HOB Cycle. A first part of the HOB cycle (Figure 1a) consists in the E. coli pathway of L-homoserine biosynthesis, whose initial reaction is the carboxylation of phosphoenolpyruvate (PEP). The second part of the cycle recruits two novel reactions, the deamination of L-homoserine producing HOB (Figure 1b) and the cleavage of HOB into pyruvate and formaldehyde and transfer of the latter onto H4F (Figure 1c). The complete cycle comprises eight intermediates and reduces CO2 according to the equation: CO2 + 2NADPH 2 + 3ATP + H4F + H 2O → CH 2H4F + 2NADP + 3ADP + 3Pi

The functioning of the HOB cycle appeared feasible on the basis of various criteria: (i) all but one estimated free energy changes at standard conditions (ΔrG′m, substrate and product concentrations equal to 1 mM, calculated using version 2.1 of eQuilibrator http://equilibrator.weizmann.ac.il/) of the eight reactions are negative, thus these reactions are expected to proceed in the forward direction (Figure 1a). In these standard conditions, the phosphorylation of aspartate with a ΔrG′m of 18.3 kJ/mol is thermodynamically infeasible. However, since E. coli is able of prototrophic growth, the aspartokinase reaction, which is common to the biosynthesis of the amino acids L-methionine, L-threonine and L-lysine, must proceed under the current physiological conditions; (ii) carbon fixation is catalyzed by PEP carboxylase (EC 4.1.1.31, Ppc), one of the most efficient carboxylating enzymes; (iii) six of the eight reactions are physiological facilitating the integration of the cycle in the E. coli metabolic network; (iv) although HOB has not been identified as a metabolic intermediate in any species, it was detected as a byproduct of aminotransferase activities in plant cell lysates and as the condensation product of formaldehyde and pyruvate in animal cell extracts.15,16 The structural relatedness of HOB with some intermediates of central biosynthetic pathways (L-homoserine, dehydropanC


Research Article


Figure 2. Directed evolution of E. coli for implementing the HOB cycle. (a) Evolutionary kinetics of the growth rate of bacteria from the auxotrophic strain ST2 fed with D-homoserine as C1 and nitrogen source in a turbidostat. The daily growth rate of the culture is plotted as a function of time. Strain ST3 was isolated from a sample taken at Day 28 on mineral glucose medium supplemented with D-homoserine. (b) Evolutionary kinetics of the resurgence of prototrophy in a bacterial population from the D-homoserine-requiring strain ST3 cultivated under medium-swap regime. The bacteria were fed every 10 min with either the stressing medium (mineral glucose medium) or the permissive medium (mineral glucose medium DLhomoserine 3 mM) depending on culture turbidity. The culture volume was kept constant and a generation time of 4 h was set by the volume of the medium pulses. The ratio of stressing medium injected in the culture is plotted as a function of time. Strain ST4 was isolated on mineral glucose medium from a sample taken at Day 120. (c) Growth phenotypes of the initial strain ST2 and the evolved isolates, ST3 (D-homoserine-dependent) and ST4 (prototroph). Bacteria were streaked on mineral glucose semisolid medium supplemented with the indicated nutrients, incubated at 37 °C for 72 h and photographed. C1 set: L-methionine, thymidine, inosine (0.3 mM each), DL-pantothenate (6 μM); DHS: D-homoserine (6 mM); HOB: 4-hydroxy-2-oxobutanoate (6 mM); none: no added compound.

or HOB as the source of C1-moieties depended on the presence of the panB Bsu allele (Supplemental Figure S3b). We traced the assimilation of the C4 carbon atom of D-homoserine through the C1-pathway, by cultivating ST3 bacteria in the presence of C4-[14C]-D-homoserine as the source of both nitrogen and C1-moieties and then analyzing the radiolabeling of nucleosides and deoxynucleosides (refer to Methods section). The labeling pattern predicted for our putative HOB pathway was two radionuclei per guanine and hypoxanthine nucleosides in RNA and DNA (C2 and C8 of purines), one per thymidine in DNA, and none for uracil and cytosine nucleosides (Supplemental Figure S1a). Given the almost equimolar proportions of G:C and A:T base pairs in the E. coli genome, we expected similar radiolabeling intensities for deoxyguanosine and deoxyinosine (resulting from total deamination of deoxyadenosine; refer to Methods section), and a labeling intensity about half as strong for thymidine. The profiles obtained for the nucleosides of RNA and DNA extracted from ST3 bacteria unequivocally matched these predictions (Figure 3). These results confirmed that ST3 cells use D-homoserine as a C1-source via HOB and that the H4Fbound C1-moieties originate from D-homoserine hydroxymethyl group. In the second stage of evolution, which targeted the endogenous production of HOB from L-homoserine, a population of ST3 cells was cultured under a medium-swap regime in an automated continuous culture device.20 This culture regime alternated the feeding of the bacteria with mineral glucose medium supplemented with racemic DLhomoserine as permissive medium or mineral glucose medium

the resulting strain ST2 in the presence of D-homoserine when the C1Cs provided were limiting. However, D-homoserine alone did not satisfy completely the C1 requirements (Supplemental Figure S2b). With the objective of selecting mutants of ST2 cells able of efficient conversion of D-homoserine into HOB and of HOB into CH2H4F and pyruvate, a population of ST2 bacteria was cultivated in an automated continuous culture device19 under turbidostat regime with D-homoserine as C1 and nitrogen source in the presence of the C1-metabolites thymine and hypoxanthine and L-proline as dadA gene inducer. These conditions allowed slow growth of the bacteria at the onset of the culture (Supplemental Figure S2b). We expected that the dynamics of the turbidostat regime, by ensuring maximal growth rate, would select the best growing bacteria. The growth rate of the culture rapidly increased step-by-step (Figure 2a). After about 160 generations (Day 28), bacteria were isolated from a sample of the culture and could be propagated on mineral glucose semisolid medium with D-homoserine as unique growth complement; the supply of a dadA inducer was not required anymore and D-homoserine was an effective C1 source even in the presence of ammonia as nitrogen source. One isolate (strain ST3) chosen at random was analyzed genetically and metabolically to assess HOB-based C1metabolism. D-homoserine as well as HOB complemented all the C1-requirements of the bacteria (Figure 2c). Using derivatives of strain ST3 lacking the dadA gene or one or the other panB allele we found that (i) the use of D-homoserine as the source of C1-moieties depended on the presence of dadA gene (Supplemental Figure S3a); (ii) the use of D-homoserine D


Research Article


Figure 3. D-homoserine conversion to nucleosides through the HOB pathway. HPLC chromatograms of RNA digests (a, b) and of DNA digests (c, d) from strain ST3 grown with C4-[14C]-D-homoserine as sole C1-source, coinjected with unlabeled standard nucleosides. Nucleoside elution profiles were recorded by following absorbance at 254 nm (a, c) and radioactivity intensity (cpm: counts per minute) (b, d) of the eluate. rC, cytidine; rU, uridine; rI, inosine; rG, guanosine; rA, adenosine; dC, deoxycytidine; dI, deoxyinosine; dG, deoxyguanosine; dT, thymidine; dA, deoxyadenosine.

the whole pool of C1-moieties carried by H4F, are expected to derive from the carboxylation of PEP catalyzed by Ppc (Figure 1a). In contrast, in the wild-type strain MG1655, no H4Fbound C1-moiety should originate from carboxylation reactions. In both strains, however, various carbon atoms of pyrimidine and purine nucleotides derive from CO2 assimilation: the atom C6 of purines is incorporated through purKmediated phosphoribosylaminoimidazole (AIR) carboxylation; the atoms C2 and C4 of the pyrimidine ring derive from carbamoyl-phosphate and C4 of aspartate, respectively. Consequently, in order to simplify radiolabeling experiments, the pyrC gene encoding dihydroorotase was deleted from both strains ST4 and MG1655, affording the uracil-requiring strains ST45 and G2397, respectively. The prediction was that ST45 cells grown with uracil and [14C]-labeled potassium cyanate should incorporate three [14C]-labels into deoxyinosine and deoxyguanosine, one resulting from purK-mediated carboxylation (C6) and two originating from HOB (C2 and C8), deoxycytidine should not be labeled, whereas thymidine should have incorporated one [14C]-label at its methyl group originating from HOB (Supplemental Figure S1a). Strain

as stressing medium. The cultivation mode (refer to Methods section) maintained the lowest concentration of homoserine through successive generations until the bacteria no longer required the supply of this nutrient (Figure 2b). After about 720 generations (Day 120), prototrophic bacteria were isolated and propagated on mineral glucose semisolid medium. Thus, genetic suppression of the C1-auxotrophic phenotype caused by the combined deletions of the glyA and gcvTHP genes was selected by the process of directed evolution in vivo. One prototrophic isolate (strain ST4, Figure 2c) chosen at random was studied in detail. The growth parameters of both wild-type (MG1655) and evolved (ST4) prototrophs were determined in aerated liquid mineral glucose medium and compared. Lag phase and generation time were 8 and 3.5 h respectively for ST4 cells, and 2 and 1 h for MG1655 cells. To assess HOB cycle effective operation we analyzed the deoxynucleosides from DNA digests as radiolabel sinks for [14C]-CO2 metabolic conversions in both wild-type and evolved genetic contexts. [14C]-labeled potassium cyanate was provided as nitrogen and [14C]-bicarbonate source.21 In the strain ST4, the C4 atom of L-homoserine and HOB, and hence E


Research Article


Figure 4. Assimilation of bicarbonate to nucleosides through the HOB pathway. HPLC chromatograms of DNA digests from G2397 bacteria (ΔpyrC derivatives of the wild-type strain MG1655) (a, b), and from ST45 bacteria (ΔpyrC derivatives of the evolved strain ST4) (c, d), grown in mineral glucose medium with [14C]-potassium cyanate as sole nitrogen source and uracil as pyrimidine source, coinjected with unlabeled standard nucleosides. Nucleoside elution profiles were recorded by following absorbance at 254 nm (a, c) and radioactivity intensity (cpm) (b, d) of the eluate. dC, deoxycytidine; dI, deoxyinosine; dG, deoxyguanosine; dT, thymidine.

considered good candidates for specifying the enzymatic activities necessary for the operation of the HOB pathway, i.e., transaminase and hydroxymethyltransferase. Two point mutations were identified in the alaC gene which encodes for an alanine-oxoglutarate aminotransferase.22,23 These mutations lead to the substitution of two amino acids (A142P, Y275D) which are highly conserved (93% and 90%, respectively) in aminotransferases homologous to AlaC (refer to Methods section). Two mutations were located at the panB Bsu locus: a C-to-T transition, already present in the D-homoserinedependent strain ST3, was localized 125 base-pairs upstream of the start codon, and a G-to-A transition caused a valine to methionine substitution (V179M) in the encoded enzyme. We explored the involvement of these two mutated enzymes in the metabolism of HOB. The deletion of the mutated alaC gene in ST4 (strain ST44) abolished prototrophic growth. The growth of strain ST44 was restored by the supply of the C1Cs, D-homoserine or HOB (Supplemental Figure S4). Expression of the doubly mutated alaC allele from a plasmid (pGEN665, P15A replicon) conferred to the D-homoserine-dependent strain ST3 the ability to use exogenous L-homoserine as sole

G2397 grown in the same conditions should incorporate only one [14C]-label in deoxyinosine and deoxyguanosine (C6 of purines). The labeling prediction was confirmed by the HPLC profiles from DNA digests (Figure 4). In particular, thymidine in control strain G2397 DNA was not labeled (Figure 4b) but thymidine in strain ST45 DNA was labeled (Figure 4d). The labeling ratios of the thymidine peak to each purine peak were about half of what was expected. This suggested a greater dilution of the [14C]-bicarbonate available for PEP carboxylation than for AIR carboxylation. These results supported the assimilation of bicarbonate into C1Cs through the Ppccatalyzed carboxylation and the HOB cycle. Elucidation of the Genetic Basis for the Resurgence of Prototrophy. The genomic DNA sequences of the evolved strains ST3 and ST4 were determined and compared with that of the initial strain ST2 (refer to Methods section). Four mutations were identified in ST3 genome, which were fixed during the first evolution experiment and 19 mutations were identified in the genome of the prototrophic isolate ST4, including the four mutations of ST3 (Table 1). Four of these 19 mutations were located in or close to two genes which we F


Research Article


Table 1. Genetic Divergences in the Genomes of the Evolved Strains ST3 and ST4 with Respect to the Genome of Strain ST2a gene or locus

function

lrp yhcF-sspA rplB 125 bp upstream panB Bsu* panB Bsu* ybdL topA ynf L-tus ptrB

leucine regulator protein − ribosomal subunit protein L2 − hydroxymethyl-transferase methionine aminotransferase DNA topoisomerase − protease II

alaC*

alanine aminotransferase

intergenic sequence gcvA/gcvR tdh metR metB intergenic sequence f klB/cycA cycA nmpC-tdcA/tdcR

− threonine dehydratase transcriptional activator cystathionine gamma-synthase − D-alanine/D-serine/glycine transporter −

SNP in/del

relative position

mutation type

G/T deletion 10890 bp G/A C/T G/A C/T G/T deletion 15266 bp C/A C/G A/C C/G in/del T/− C/A G/T in/del −/G A/T T/G −

334 − 196 − 535 91 1523 − 507 506 823 424 − 493 101 1159 − 928 −

missense GAT/TAT − missense GAC/AAC − missense GTG/ATG nonsense CAG/TAG missense GGC/GTC − missense CTG/CCT

D112Y − D66N − V179M Q31Stop G508V − L169P

AA change

missense TAC/GAC missense GCC/CCC − nonsense GAA/TAA missense TCT/TAT − − missense TCC/GCC inversion

Y275D A142P − E165Stop S34Y fusion metBL − S310A −

a

The 19 mutations listed were detected in strain ST4. The mutations detected in strain ST3 are indicated in bold. The mutated genes implicated in the operation of the HOB pathway are indicated with an asterisk *.

the strains ST3 and ST4 in comparison with the wild-type precursor strain ST2 (Supplemental Table S4). This regulatory mutation alone conferred to the strain ST11 otherwise isogenic to ST2, the ability to grow in the presence of D-homoserine as the sole C1-source (Supplemental Figure S6). Deleting the panB Bsu allele from the ST4 chromosome caused a nutritional requirement for C1Cs (Supplemental Figure S7a), which could not be complemented by HOB or D-homoserine. Only the expression of the mutated panB Bsu allele from a multicopyplasmid (pGEN137, Supplemental Table S2) restored prototrophic growth (Supplemental Figure S7b). The ability of the wild-type and mutated forms of the PanB Bsu enzyme to cleave HOB was investigated in vitro. Both enzyme forms catalyzed the formation of pyruvate from HOB in the presence of H4F with low catalytic efficiency; the V179M mutation decreased the affinity of the enzyme for HOB but did not affect significantly its turnover (Table 2). Three-dimensional structure models of wild-type and mutant PanB Bsu were obtained based on crystallization data of E. coli PanB in the presence of dehydropantoate.26 They revealed that the residue at position 179 is localized in the active site of the enzyme in close vicinity to the methyl groups of dehydropantoate (Supplemental Figure S8). Modeling and substrate docking simulations (refer to Methods section) suggested that the methionine residue at position 179 would impede the correct positioning of the natural substrates 3-methyl-2-oxobutanoate and dehydropantoate in the active site of PanB due to steric constraints without significantly affecting the ability to metabolize HOB (Supplemental Figure S8). To test this hypothesis, competition assays were carried out, as described in Methods section. The results demonstrated that (i) 3-methyl-2oxobutanoate and HOB are competing substrates for the wildtype form of PanB Bsu; (ii) pyruvate formation from HOB catalyzed by the mutant enzyme is much less sensitive to the presence of 3-methyl-2-oxobutanoate (Supplemental Figure S9). From these observations an evolutionary scenario can be deduced for the implementation of a functional HOB cycle.

C1-source (Supplemental Table S2 and Figure S5). We determined the kinetic parameters of the purified His-tagged recombinant wild-type and mutated AlaC aminotransferases (refer to Methods section). When simultaneously present, the A142P and Y275D mutations increased a hundred-fold the catalytic efficiency (kcat/KmL‑hom) of the enzyme for Lhomoserine, whereas the catalytic efficiency for pyruvate was only slightly modified (Table 2). Although far lower than the Table 2. Kinetic Parameters of Wild-Type and Mutated Forms of the Enzymes Recruited for HOB Cycle Operation kinetic parameters enzyme AlaC wildtype

L-homoserine

a

pyruvateb AlaC A142P Y275D

L-homoserine

pyruvatec enzyme

a

Pyruvate: 1 mM. H4F: 1 mM.

d

a

kcat/Km (s−1 M−1)

69 ± 20

0.25 ± 0.04

3.6

0.05 ± 0.01

−

5000

1.7 ± 0.2

0.62 ± 0.02

360

0.07 ± 0.01

−

Km (mM)

kcat (min−1)

8900 kcat/Km (s−1 M−1)

d

HOB

0.58 ± 0.16

0.37 ± 0.02

10.6

HOBd

3.53 ± 0.75

0.25 ± 0.02

1.2

substrate

PanB Bsu wildtype PanB Bsu V179M

kcat (s−1)

Km (mM)

substrate

b

L-homoserine:

300 mM.

c

L-homoserine:

25 mM.

kcat/Km of an average enzyme,24 the kcat/KmL‑hom of mutated AlaC is comparable to those of various alanine aminotransferases for their natural substrate.25 The mutations did not alter the set of physiological amino acids transaminated with respect to the wild-type enzyme (Supplemental Table S3). As assessed by RT-qPCR analyses of mRNA transcripts of the panB genes, the C-to-T transition upstream of the panB Bsu gene increased 20-fold the level of transcription of the latter in G


Research Article

ACS Synthetic Biology The panB Bsu gene specialized for the conversion of HOB in two steps. In the strain ST3, the low affinity for HOB of PanB enzymes was compensated by an enhanced expression level of panB Bsu gene. In the prototroph ST4, the selected V179M mutation lowered the accessibility of the natural substrate for the active site thus shifting the competition in favor of the nonnatural substrate. Strikingly, this mutation decreased the already weak efficiency of the enzyme on HOB. This mitigation might constitute a trade-off for the optimal distribution of 3-methyl-2oxobutanoate between dehydropantoate, valine and leucine biosynthesis routes. By contrast, the E. coli panB gene stayed unaltered ensuring the physiological activity of dehydropantoate-hydroxymethyltransferase, indispensable for the biosynthesis of the coenzyme A. In parallel, two mutations which enhanced the marginal activity of a transaminase for Lhomoserine were selected by triggering growth in evermore limiting concentrations of supplied homoserine. On the basis of the respective metabolic organization of wildtype and evolved prototrophic strains and of the residue composition of E. coli,27 we evaluated by quick calculation the theoretical amounts of L-homoserine and bicarbonate needed for the synthesis of one gram of dried MG1655 and ST4 cells (Supplemental Table S5). The results indicated that the HOBbased prototroph ST4 requires four times more L-homoserine than its wild-type ancestor MG1655. Furthermore, the amount of CO2 assimilated through Ppc-catalyzed carboxylation in the evolved bacteria is almost twice the amount assimilated in their wild-type counterparts. It is likely that at least some of the mutations fixed during the evolution process of ST3 into ST4 may help to optimize the endogenous production of Lhomoserine and its distribution between three metabolic pathways: the canonical biosynthesis pathways of methionine and threonine and the evolved HOB-based C1-pathway. One notes that several mutations affect genes implicated in methionine metabolism (metR, metBL, ybdL; refer to Table 1) and one mutation introduces a nonsense codon in the middle of the gene tdh which encodes threonine dehydrogenase. Interestingly, in the constructed strains ST1 and ST2, the glycine auxotrophy caused by the deletion of the gene glyA is bypassed by the constitutive expression of the (kbl-tdh) operon (refer to the Methods section). One can hypothesize that glycine synthesis in the evolved strain ST4 is ensured by threonine cleavage by ltaE-encoded L-threonine aldolase,28 and that the mutation which inactivates threonine dehydrogenase might have been selected for diminishing L-homoserine drain toward threonine. The relative contributions of these various mutations to the fine-tuning of metabolic fluxes in ST4 bacteria remain to be evaluated.

selection screen and applying adequate evolutionary techniques. This methodology does not require prior knowledge of the changes needed; instead, a succession of spontaneously appearing adaptive mutations is fixed in the population, each contributing an incremental improvement toward the targeted phenotype. It is remarkable that such a coarse adaptation process can lead to the selection of alleles specifying finely tuned enzyme variants able to discriminate against their natural substrates. The metabolic repertoire of E. coli has been enlarged by the stable installation of HOB as an essential metabolic intermediate. The specificities of two enzymes were evolved in a concerted way for adopting an imposed compound as product and substrate, demonstrating the plasticity of biosynthesis in real time. The relative ease with which HOB was acclimated as an indispensable metabolite by selecting a few mutations in a bacterium as common as E. coli is at odds with its apparent absence in natural organisms. In particular, HOB is not mentioned in any recently established E. coli metabolome database.29,30 It is possible that some organisms do produce detectable levels of HOB but have escaped notice and that HOB is effectively involved in C1-transfer in some phyla. Alternatively, HOB might have been neglected or even thoroughly avoided by natural selection because its cleavage by promiscuous aldolases would release formaldehyde which is toxic and requires efficient scavenging. However, the loose substrate specificity of both aminotransferase AlaC and hydroxymethyl-transferase PanB suggests that HOB might be produced and transformed in wild-type E. coli, though marginally. The emergence of HOB as a necessary metabolic intermediate under selective conditions puts into light the evolutionary potential of promiscuous enzymes and of underground metabolites.31,32 Our approach which combined the design and construction of appropriate genetic contexts with in vivo directed evolution protocols enabled the deep rewiring of central biosynthesis routes and carbon flux in short time-scales exploiting the high plasticity and the resilience of the metabolic network of E. coli toward strong selective conditions. Following a similar approach, Antonovsky et al. succeeded in transplanting in E. coli the Calvin cycle and mobilizing functionally the enzymes phosphoribulose kinase and rubisco, by selecting for the endogenous production of phosphotrioses from CO2 in a rationally constructed metabolic chassis.7 Systematic attempts to recruit molecules that have been neglected or even ostracized by natural selection and implementation of innovative metabolic routes are therefore expected to open up new avenues of scientific exploration and industrial exploitation by overcoming the local optimizations that have constrained evolution to current metabolisms.

■

CONCLUSIONS The present study demonstrates that a universally conserved pathway of central metabolism, i.e., CH2H4F biosynthesis from serine and glycine, can be replaced with an artificial alternative. Biochemical reprogramming of the model bacterium E. coli was obtained by minimally altering canonical metabolism with a few genetic deletions and one heterologous gene insertion and by applying to these purposely engineered bacteria in vivo selective cultivation protocols leveraging on natural selection mechanisms. It is worth stressing that the evolved HOB-based bacteria did not originate from serendipitous discovery nor elucidation of an unknown metabolic potentiality, but from the thorough implementation of a synthetic pathway by rationally constructing an inescapable

■

METHODS Chemicals, Media and Cultivation Conditions. Chemicals were purchased from Sigma-Aldrich. 4-hydroxy-2oxobutanoic acid (HOB) was synthesized by Syntheval (France) according to a published method33 and obtained as a lactone. Purity was superior to 95% as judged by NMR. Bacteria were routinely grown in Luria−Bertani medium or in minimal saline defined medium (MS) supplemented with Dglucose (2 g/L) as a carbon source as previously described.34 The MSN- medium consisted of MS medium devoid of ammonium chloride and was used when a particular compound was supplied as sole nitrogen source. Growth media were H


Research Article


recombinase genes.38 Kanamycin resistant recombinant clones were selected on LB plates and checked for growth on MS glucose medium to confirm that the panB Bsu gene was expressed and that its product was functional. The correct integration at the kdgK locus was verified both by the absence of growth of the recombinant bacteria on MS medium with 2 g/L glucuronate as sole carbon source and by the analysis of PCR products obtained using DNA from isolated single colonies as a template and specific primers. Continuous Cultures. Turbidostat Regime. ST2 bacteria were adapted to grow with D-homoserine as the sole C1-source as follows: the first step of adaptation consisted in manual serial subcultures of ST2 bacteria in the selective medium MSNglucose D-homoserine (6 mM) L-proline (1 mM) thymine (0.3 mM) hypoxanthine (0.3 mM). L-proline was added as inducer of dadA expression instead of L-alanine so that D-homoserine constitutes the only nitrogen source. The bacteria were diluted 50-fold in fresh medium (5 mL) each time the optical density (OD600 nm) of the culture reached 0.4, corresponding to a bacterial density of about 5 × 108 cells/mL. The fifth subculture (20 mL) was then injected into an automaton-driven GM3 fluidic cultivation device.19 At regular time intervals (every 10 min), the optical density of the culture was measured and compared to a fixed threshold (OD600 nm value of 0.4). When the measured OD600 nm exceeded the threshold, a pulse (1.8 mL) of fresh nutrient medium of same composition than above was injected into the culture, the volume of which was maintained constant at 18 mL. The monitoring of the turbidity ensured that the biomass in the culture vessel remained constant and that the bacteria grew at their maximal growth rate. In that case, assuming that the culture is in a steady state, the daily growth rate (μ) is equal to the dilution rate (D), so μ (hour−1) = nv/24V, where n is the number of daily pulses of medium injected in the culture, v the volume of a pulse, V the total volume of the culture. Culture samples collected on Day 28 were streaked on semisolid MSN- glucose D-homoserine (6 mM) and MS glucose D-homoserine (6 mM) media. Isolated clones were checked for D-homoserine dependence. Strain ST3 was isolated on MS glucose D-homoserine (6 mM) semisolid medium. Medium-Swap Regime. A population of growing ST3 bacteria in MS glucose D-homoserine (6 mM) medium was injected into an automated GM3 fluidic cultivation device. A generation time of 4 h was imposed by the injection of medium pulses of either stressing or permissive medium every 10 min. The composition of the medium pulses was determined by the turbidity of the culture. Every 10 min the optical density of the culture was measured and compared to a fixed threshold (OD600 nm value of 0.4). When the measured optical density exceeded the threshold a pulse of stressing medium (MS glucose) was injected into the culture; otherwise a pulse of permissive medium (MS glucose 3 mM DL-homoserine) was injected. The volume of the culture was kept constant at 16 mL and the generation time was maintained at 4 h by the volume of the pulses injected (460 μL). After 120 days under this regime, the culture grew satisfactorily in MS glucose medium. A sample of the culture was streaked on MS glucose semisolid medium. Prototrophic isolates were obtained after 72 h of incubation at 37 °C and propagated on MS glucose semisolid medium. Bacterial Growth Assays. A Microbiology Reader Bioscreen C apparatus (Thermo Fisher Scientific) was used for growth curve experiments. It consists of a thermostatic incubator and a culture growth monitoring device (OD reader).

solidified with 15 g/L agar for the preparation of Petri dishes. Bacterial cultures were usually incubated at 37 °C. The nutrients required for the growth of C1-pathway-defective bacteria were added to the culture medium at the following final concentrations when not otherwise stated: 0.3 mM Lmethionine, 0.3 mM thymidine, 0.3 mM inosine, 6 μM DLpantothenate. Amino acids (L-alanine, D-homoserine) were added at 6 mM when used as nitrogen sources and at 0.6 mM (L-alanine) and 1 mM (L-proline) when used as dadAX operon inducers. D-homoserine and HOB were used as C1-sources at 6 mM. When required, antibiotics were added at the following concentrations: 100 mg/L ampicillin; 100 mg/L spectinomycin; 180 mg/L erythromycin; 30 mg/L apramycin; 25 mg/L chloramphenicol and 30 mg/L kanamycin. Construction of Bacterial Strains and Plasmids. The strains used and constructed in this study were all derivatives of the wild-type Escherichia coli K12 strain MG1655. Their relevant genotypes and filiations are listed in Supplemental Table S1. The various genetic contexts were obtained by serial P1 transductions according to the method of Miller.35 Standard procedures for digestion with restriction enzymes (Fermentas, Biolabs), ligation of PCR amplification products obtained using specific primers (MWG), transformation of competent bacteria, and selection of transformed clones were used for plasmid constructions.36 The sequences of the cloned fragments were checked by Sanger sequencing. The plasmids were then introduced into the appropriate recipient cells by the electroporation-mediated transformation technique. The names and characteristics of the plasmids used and constructed in this study are summarized in Supplemental Table S2. The glyA, gcvTHP, and panB genes were knocked-out by inframe deletion in a recB recC sbcA background (strain JC8679) by homologous recombination according to a published procedure.37 The in-frame deletions of kdgK, dadA and alaC coding sequences were obtained as previously described.38 The C1 auxotrophic strain ST1 was constructed by serial transduction of the alleles ΔglyA::aad and ΔgcvTHP::erm into the recipient strain +2518 which constitutively expresses the (kbltdh) operon. This genetic context allowed the disentanglement of the joint syntheses of glycine and CH2H4F from serine through glyA-encoded serine hydroxymethyltransferase activity. The deletion of glyA in the strain +2518 had no phenotypic consequence on the resulting strain +2711 because glycine was stably produced from threonine cleavage. Strain +2518 was obtained after prolonged cultivation (12 days) of a MG1655 E. coli single colony in MS medium with 2 g/L L-threonine as sole carbon source and colony isolation on semisolid MS Lthreonine medium as previously described.39 A copy of the Bacillus subtilis panB gene was integrated into the E. coli chromosome at the kdgK locus as follows: the panB Bsu gene from pEVL525 was introduced into the cloning site of an integration vector (R6K replicon) flanked by the 500 bp-long upstream and downstream sequences of the kdgK gene and the ahp gene for kanamycin resistance. The sequence which originates from the integration vector and is situated upstream of the start codon of panB Bsu gene was as follows: CTCGAGGTCGACGGTATCGATAAGCTTGATATCGAATTCAAATCATAAAAAATTTATTTGCTTTATTAAAGAGGAGAAATTAATTA. The substitution of the chromosomal kdgK gene with the heterologous DNA fragment containing the panB and ahp genes was carried out by transforming a ΔpanB E. coli auxotroph (+2259 strain) with the linearized plasmid in the presence of the vector pKD46 which expresses λ I


Research Article


protein with an N-terminal His-tag (plasmids pGEN642, pGEN617 and pGEN618, respectively). These genes were also inserted into the expression vector pET22b (Novagen) to generate proteins with a C-terminal His-tag (plasmids pGEN878, pGEN879 and pGEN880). The resulting plasmids were introduced into E. coli BL21 (DE3) by chemical transformation. Cell culture, cell extract preparation and purification of His-tagged recombinant proteins were conducted as reported above. The functionality of the purified Nter and C-ter His-tagged PanB enzymes was assessed by analyzing the ability to catalyze the formation of dehydropantoate from the physiological substrates 3-methyl-2-oxobutanoate and CH2H4F. The reaction mixes consisted of 15 μg proteins, 5 mM 3-methyl-2-oxobutanoate and 1 mM CH2 H4F in 100 μL of 50 mM phosphate buffer, pH 7.0, 2 mM MgCl2 and were incubated for 2 h at 37 °C. CH2H4F was prepared extemporaneously by incubating H4F and formaldehyde at 37 °C for 5 min as previously described.41 The cleavage of HOB into pyruvate was assayed in the presence of H4F using the following conditions: 15 μg proteins were incubated for 2 h at 37 °C with 5 mM HOB and 1 mM H4F in 100 μL of 50 mM Tris HCl buffer pH 7.0, 2 mM MgCl2. Reactions were stopped by filtration through a 3 kDa MWCO membrane. The products of the reactions, dehydropantoate or pyruvate, were detected by LC−MS analysis using the same method as that applied for AlaC activity characterization and described above. E. coli PanB enzyme actively catalyzed dehydropantoate formation as well as the cleavage of HOB into pyruvate and CH2H4F. B. subtilis wild-type and mutated enzymes appeared in these conditions about 10-fold less active than E. coli counterpart. The conditions of reactions were optimized for Bacillus subtilis PanB in order to improve its activity. Enzymatic reactions were performed at 25 °C by incubating 5 μg of purified protein with both substrates H4F (1 mM) and HOB (0; 1; ...; 20 mM) in 100 μL of 100 mM Tris-HCl buffer, pH 9.0, 20 mM MgCl2 for 0, 15, 30, or 60 min and stopped by filtration through a 3 kDa MWCO membrane. In these conditions, accumulation of pyruvate with time was linear up to 60 min. Pyruvate was quantified by LC−MS/MS. Analyses were carried out on a Dionex UltiMate 3000 RS LC system (Thermo Scientific Dionex Corporation, Sunnyvale, CA, USA) coupled to a QTRAP 5500 Hybrid triple quadrupole-linear ion trap mass spectrometer (ABSciex, Toronto, Canada) equipped with an ESI source. The QTRAP mass spectrometer was operated in the negative ion mode with the following parameters: ion source (IS) 4500 V, curtain gas (CUR) 20 au, temperature (TEM) 500 °C, gas 1 (GS1) 45 au, gas 2 (GS2) 60 au, CID−medium. MS/MS experiments were performed using Multiple Reaction Monitoring scan type. Chromatographic separation was performed on a ZIC pHILIC HPLC column at 40 °C. The flow rate was set at 0.5 mL/min and the injection volume was 10 μL. Mobile phase A consisted of 10 mM ammonium carbonate in water adjusted with ammonium hydroxide to pH 10.0, and mobile phase B of acetonitrile. A linear gradient from 80% to 40% of B in A was applied over a period of 12 min. Kinetic constants of the enzymes were calculated by nonlinear analysis of initial rates from duplicate experiments. Competition assays were performed by quantifying the rate of pyruvate formation by PanB-catalyzed HOB cleavage in the presence of the enzyme’s natural substrate, 3-methyl-2oxobutanoate. Reactions were performed at 25 °C by

Overnight bacterial cultures were washed once in MS mineral medium and diluted 100-fold in the growth medium; 200 μL aliquots of the cell suspensions were distributed into honeycomb 100-wells plates. Each experiment was done in triplicate. The plates were incubated at 37 °C under continuous agitation. Bacterial growth was followed by recording optical densities at 600 nm every 15 min for 72 h if not otherwise stated. Biochemical Assays. AlaC Enzyme Characterization. The wild-type alaC gene and its mutated counterpart alaC A142P Y275D were excised from pGEN656 and pGEN657, respectively, and ligated into a pET47b (Novagen) derivative to generate in each case a protein with an N-terminal His-tag. The resulting plasmids, pGEN673 and pGEN676, were introduced into E. coli BL21 (DE3) by chemical transformation. Standard methods were used for cell culture, induction of gene expression, cell extract preparation and purification of Histagged recombinant proteins.40 The substrate specificities of wild-type and mutated AlaC recombinant proteins were determined by liquid chromatography/mass spectrometry (LC−MS) (Table S3). Reactions were performed at 25 °C in 100 μL of 50 mM Tris HCl buffer, pH 8.0, containing 500 μM pyridoxal-5′-phosphate (PLP) and 12 μg of purified AlaC enzyme. Aminotransferase activity was assayed with a mix of the 20 proteinogenic amino acids plus Lornithine and L-homoserine (5 mM each) in the presence of both pyruvate and 2-oxoglutarate (5 mM each) by monitoring the formation of the corresponding 2-oxo acids, the products of deamination. Reactions were stopped after 3 h by filtration through a 3 kDa Molecular Weight Cut Off (MWCO) membrane. LC−MS analyses were carried out using a LTQ/ Orbitrap mass spectrometer coupled to an Accela LC system (Thermo Fisher). A ZIC-pHILIC column (150 × 4.6 mm × 5 μm; Merck Chemicals) thermostated at 40 °C was used for chromatographic separation. A mobile phase gradient was used with a flow rate of 0.5 mL/min: mobile phase A consisted of 10 mM ammonium carbonate and mobile phase B consisted of acetonitrile. The gradient started at 20% A in B for 2 min followed by a linear gradient up to 60% A over 14 min, and finally 8 min at 60% A. The entire eluent was sprayed into the mass spectrometer using a heated electrospray ionization source (250 °C) at 4 kV with sheath, auxiliary and sweep gases set at 60, 50, and 0 arbitrary units, respectively. Desolvation of the droplets was further aided by setting the heated capillary temperature at 275 °C. The metabolites were detected in the negative mode by full scan mass analysis from m/z 50−1000 at a resolving power of 30,000 at m/z = 400. Initial rates of the reaction were determined for both wild-type and mutated AlaC recombinant enzymes using a continuous coupled assay with L-alanine dehydrogenase (Sigma-Aldrich), Lhomoserine as an amine donor and pyruvate as the amine acceptor; the reduction of NAD+ was followed by absorbance at 340 nm. Kinetic constants were determined by nonlinear analysis of initial rates from duplicate experiments using SigmaPlot 9.0 (Systat Software, Inc.). Enzymatic reactions were performed at 25° in 100 μL of 50 mM Tris HCl buffer, pH 8.0, containing 500 μM PLP, 5 mM NAD+, 3.7 μg alanine dehydrogenase, 2.34 μg wild-type AlaC or 1.11 μg mutated AlaC as well as L-homoserine and pyruvate in concentrations indicated in Table 2. Absorbance variations were registered in a Safas UV mc2 double beam spectrophotometer. PanB Enzyme Characterization. The E. coli panB gene and the B. subtilis wild-type and mutated V179 M panB genes were inserted into a pET47b derivative to produce in each case a J


Research Article

ACS Synthetic Biology incubating 5 μg of purified wild-type or mutated PanB Bsu enzyme with 10 mM HOB and various concentrations of 3methyl-2-oxobutanoate (0; 0.5; 1; 5 and 10 mM) in 100 μL of 100 mM Tris-HCl buffer, pH 9.0, 20 mM MgCl2, 1 mM H4F for 0, 15, 30, or 60 min. The reactions were stopped by filtration through a 3 kDa MWCO membrane. Pyruvate was quantified by LC−MS/MS as described above. Modeling of PanB Bsu Enzyme Three-Dimensional Structure. The substrates (HOB, 3-methyl-2-oxobutanoate, dehydropantoate) were retrieved from the Pubchem Compound database (http://pubchem.ncbi.nlm.nih.gov/). The three-dimensional structures of the active site of wild-type and of mutated V179M PanB Bsu were modeled by sequence homology with Modeler software using the crystallized structure of E. coli PanB complexed with dehydropantoate (PDB code: 1M3U). E. coli and B. subtilis PanB protein sequences share 48% of identities over 90% of their length (BlastP Align). The amino acids which coordinate Mg2+ ion and those which interact with dehydropantoate are all conserved between the PanB proteins of the two species.26 Mg2+ ion and dehydropantoate were arranged in the active site models so as the coordination interactions and distances match published data. In the same manner, HOB was set out by superimposition of the atoms of the carbonyl and carboxylate functions on those of dehydropantoate. The distances between valine in position 179 in wild-type PanB Bsu and methionine in its mutated counterpart and the methyl and hydroxymethyl groups of dehydropantoate and HOB were measured. Docking of 3-methyl-2-oxobutanoate in the active site of both wild-type and mutated V179M PanB Bsu was performed using AutoDock Vina software.42 Gasteiger charges and nonpolar hydrogen atoms were added using AutoDockTools. Side chain protonation states assumed a negative charge for aspartate and glutamate, a positive charge for lysine and a neutral charge for histidine. The 2+ charge of the magnesium ion was added to Autodock Vina’s atomic parameters. Protein side chains were allowed to move and all degrees of freedom were possible for the ligand. The obtained docking poses were analyzed on the basis of scoring values of Autodock’s scoring function. Chemical Synthesis of C4-[14C]-D-homoserine. C4[14C]-D-Homoserine (specific activity 2.07 GBq/mmol; radiochemical purity >97%; ee >94%) was prepared from ethyl bromo-[1-14C]acetate (specific activity 2.07 GBq/mmol, radiochemical purity ≥95%, obtained from Amersham) and (R)(+)-boc-2-tert-butyl-3-methyl-4-imidazolidinone according to the synthetic procedure developed by Seebach et al.43 The overall yield from ethyl bromo-[1-14C]-acetate was 27%. TLC: Rf = 0.53 (plastic sheet cellulose F; 2-butanol/water/ acetic acid 1/1/1), coelution with an unlabeled authentic sample (visualization by staining with ninhydrin solution), radiochemical purity 97.1% (measured with a RITA Star apparatus from Raytest). A Shimadzu chromatograph equipped with a diode array detector (220 nm) and a Berthold Flowstar LB513 for radiochemical detection was used for chiral analytical HPLC.44 Column: Chirobiotic T (Astec, 46 × 250 mm, 5 μM, 20 °C), eluting at 1 mL/min with acetonitrile/water (80/ 20). Radiolabeled L-homoserine and D-homoserine were coeluted with unlabeled authentic samples. Retention times: RTL‑homoserine = 20.8 min, RTD‑homoserine = 22.4 min. The enantiomeric excess of D-homoserine was equal to 94%.

Chemical Synthesis of Radiolabeled Potassium Cyanate K14CNO. Potassium [14C]-cyanate was prepared by ozone oxidation of cyanide.45 Briefly, a mixture of K14CN (370 MBq, 33 MBq/mg, 11.2 mg) and K13CN (1.2 mg, tracer for 13 C NMR analysis) was dissolved in 30 mL of slightly basic water (pH = 7.45); the pH of the solution increased to pH = 10.38 as a consequence. After a few minutes, the oxygen/ozone mixture was allowed to bubble through the solution under stirring. When the pH reached 9.38, bubbling was stopped. Water was removed under vacuum to give crude potassium [14C]-cyanate as a white solid. 13C NMR (100 MHz, D2O): δ = 128.6 (t, J = 10.8 Hz, 13CNO−), 160.6 (traces of H13CO3−). Radio-Labeling, Extraction and Digestion of Total RNA and Genomic DNA. An overnight culture of ST3 bacteria in MS glucose D-homoserine (6 mM) was diluted 50fold in MS glucose C4-[14C]-D-homoserine (6 mM, 50 mCi/ mmole) and incubated for 24h at 37 °C with aeration. Similarly, overnight cultures of strains ST46 and G2397 in MS glucose uracil (0.5 mM) were diluted 50-fold in MSN-glucose uracil (0.5 mM) and K14CNO (3 mM, 59 mCi/mmole) and incubated for 24 to 72h at 37 °C with aeration. The RNAs were stabilized using the RNAprotect Bacteria reagent (QIAGEN) and total RNAs were extracted using an RNA extraction kit following the procedures recommended by the manufacturer (QIAGEN). Genomic DNA was extracted using the Genomic Tips kit (QIAGEN, 100/G columns). The concentrations of purified nucleic acid preparations were determined by measuring the absorbance at 260 nm (Beckman DU-600 spectrophotometer). The protocol for enzymatic digestion of nucleic acids was adapted from published procedures.46,47 Aliquots of 10 to 20 μg of purified DNA in 90 μL 10 mM Tris (pH 8) or of purified RNA in 90 μL water were denatured in boiling water for 5 min then chilled on ice; 10.5 μL of 0.5 M sodium acetate 20 mM ZnCl2 buffer (pH 5.3) and 5 μL of P1 Nuclease (Sigma, 1 mg/ mL, 0.25 U/μL) were added to each digestion mix. The samples were incubated for 2 h at 37 °C. Then, 10 μL 0.1 M glycine hydrochloride buffer (pH 10.4) and 5 μL bovine intestinal mucosa alkaline phosphatase (Sigma, 1 mg/mL, 3.5 U/μL) were added and the samples were incubated for 2 h at 37 °C. To avoid nonreproducible results due to partial deamination of adenosine and deoxyadenosine by deaminase impurities frequently present in commercial phosphatase preparations,48 a deamination step was performed to convert all adenosine and deoxyadenosine into inosine and deoxyinosine, respectively. Aliquots of 5 μL of adenosine deaminase (Sigma, 0.1 U/μL) were added to the nucleic acid digests, and the samples were incubated for 1 h at 37 °C and stored at −20 °C before further analysis. HPLC Analysis of Radio-Labeled Nucleosides. Samples of RNA and DNA digests were injected into a Shimadzu HPLC apparatus. Nucleosides were separated on an Uptisphere 5ODB column (Interchim) at room temperature with a mobile phase consisting of 10% methanol-90% aqueous buffer (12.5 mM citrate, 25 mM sodium acetate, 30 mM sodium hydroxide, pH 5.3) at a flow rate of 0.8 mL/min. The elution profile of each nucleoside (cytidine, uridine, inosine, guanosine and adenosine) and deoxynucleoside (deoxycytidine, deoxyinosine, deoxyguanosine, thymidine and deoxyadenosine) (1 mg/mL) was separately determined with nonlabeled compounds by UV detection (UV detector, 254 nm). Aliquots of 5 to 20 μL of the RNA or DNA digests were coinjected into the column with a mix of nonlabeled nucleosides or deoxynucleosides (1 mg/mL K


Research Article


Bioinformatic Analysis of AlaC Mutations. A set of 999 sequences homologous to AlaC was collected using BlastP searches in the UniRef100 database (i.e., clusters of sequences from Uniprot KB with 100% identity). The expectation value (E) threshold used was 10. Sequence identity along the full length of AlaC ranged from 100% to 40%. The 999 sequences were multiple-aligned with Mafft software. The conservation of the amino acid residue at each position in AlaC was evaluated using the Jalview sequence alignment analyzer.54 Quantitative PCR Analysis of panB Gene Expression. The relative expression levels of E. coli and Bacillus subtilis panB genes in evolved and nonevolved bacteria were evaluated by RT-qPCR analysis. The bacteria were cultivated until the OD600 nm reached 0.5−0.7. The appropriate volume of a RNA stabilization solution was then added, the samples centrifuged for 10 min at 4500 rpm and the supernatants were discarded; the cell pellets were frozen at −80 °C. Total RNA was extracted using the RNeasy kit (QIAGEN). Contaminating genomic DNA was eliminated by treatment with Turbo DNase (Ambion, Life Technologies), and the absence of DNA from purified total RNA was verified by PCR. Total RNA was quantified using a Qubit fluorimeter (Life Technologies). cDNA was produced with the SuperScript Vilo cDNA synthesis kit (Invitrogen) and purified using the Ampure kit (BeckmanCoulter). A Stratagene Full Velocity kit (Integrated Genomics) and Mx3005P real-time PCR system (Agilent Technologies) were used for qPCR. The primer pairs used for qPCR were designed so as to amplify an approximately 200 bp region from each panB gene: panB E. coli: 5′-TTAGAAGCTGCTGGGGCACA (forward) and 5′-CCGTTTCGGCGAGGAAATT (reverse); panB B. subtilis: 5′-GCGCCAAAAAATTAATAGAAGACAG (forward) and 5′-GTGTTCTCTCAACACCGTGG (reverse). Primer concentrations were optimized and dissociation curves were generated for each of the primer pairs to verify the amplification of a single PCR product. Amplifications were performed in duplicate using cDNA equivalent to 20 ng of total RNA in five sequential 3-fold dilutions. The amplification cycling conditions were: initial denaturation at 95 °C for 3 min, then 40 cycles of denaturation at 95 °C for 30 s; annealing at 60 °C for 30 s; and extension at 72 °C for 30 s. Data were analyzed using MxPro QPCR software (Agilent). The entire experiment, from exponentially growing bacteria to RNA extraction, cDNA synthesis and qPCR, was performed twice. The comparative Ct (Cycle threshold) method was used to compare the abundance of the mRNAs for each panB allele in the strains corresponding to different evolution steps, and of the mRNAs for the two alleles in the same strain at each evolution step. The differences (ΔCt) between Ct for the internal control amplicon and Ct for the target amplicon were determined.

each) respectively and chromatographed. The elution profiles were determined successively by UV detection at 254 nm and by measuring radioactivity content of the eluate (Berthold Flowstar LB513 radioactivity counter). The detection of radioactivity generally lagged a few seconds behind the detection of the nucleosides by UV; this was due to the time necessary for the sample to flow through one detector to the other. Preparation and Sequencing of Genomic DNA Libraries. Single-end libraries for sequencing with the Illumina Genome Analyzer IIx were generated with 1 μg genomic DNA from strains ST2, ST3 and ST4 following a protocol recommended by the supplier (Illumina Inc.). For each strain sequenced, about 30 million valid single-end reads were generated (median length of 76 bp), yielding a coverage of 480× with respect to the reference genome (E. coli K12 wildtype strain MG1655). Mate-paired libraries for 454-Titanium sequencing (454 Life Sciences) were generated from 15 μg of genomic DNA from strains ST3 and ST4 by employing HydroShear technology (Genomic Solutions). The resulting 8 kbp DNA fragments were end-repaired, column-purified, ligated and circularized as recommended by the manufacturer. The circularized constructs containing the genomic DNA were column-purified and sheared using Adaptive Focused Acoustic Technology (Covaris, Inc.). Sheared constructs were end-repaired and ligated with 454 paired end sequencing adapters, and single stranded 454 libraries were generated and sequenced on a Genome FLX Sequencer using a 454-Titanium sequencing kit. Approximately 220 000 and 258 000 mate-pair reads were produced for ST3 and ST4 genomic DNA respectively, with an average length of 400 bp for strain ST3 and 350 bp for strain ST4, yielding a chromosome coverage of about 18× for both strains. Mutation Analysis. The PALOMA pipeline, integrated in the platform Microscope (http://www.genoscope.cns.fr/agc/ microscope/)49 and based on the SSAHA2 package,50 was used to map Illumina reads against E. coli MG1655 reference sequence (NC_000913.3) and to detect single nucleotide variations (SNVs) and short insertions or deletions (indels) on the chromosomic sequences of ST2, ST3 and ST4 strains. The identification of SNVs and indels involved three main steps: (i) Preparation of data, i.e., file conversion, removal of duplicate reads and, as required, splitting paired-end reads; (ii) Mapping of reads onto the reference molecule combining the SSAHA search algorithm (Sequence Search and Alignment by Hashing Algorithm) with the cross_match software (http://www.phrap. org). Regions of high similarity are identified by SSAHA and aligned using a banded Smith-Waterman-Gotoh algorithm;51,52 (iii) Assessment of the significance of the SNVs detected on the basis of the coverage and the quality of bases in the reads displaying this deviation from the reference sequence. The overall coverage of ST2, ST3 and ST4 genomes by unambiguously mapped reads was 199×, 201× and 199×, respectively. Every SNVs which were detected with PALOMA with a high significance score were confirmed by Sanger sequencing of PCR products. In order to identify any large deletions or rearrangements in the genomes of the evolved strains ST3 and ST4, the matepaired reads obtained from 454-sequencing were assembled de novo using the Newbler soft package (454-Life Sciences). The assembled genomes were compared to E. coli MG1655 reference sequence using the NUCmer3.0 extension of MUMmer package.53

■

ASSOCIATED CONTENT

S Supporting Information *

The Supporting Information is available free of charge on the ACS Publications website at DOI: 10.1021/acssynbio.7b00029. Strains and plasmids constructed in this study, additional figures (Figures S1−S9) and tables (Tables S1−S5) (PDF)

■

AUTHOR INFORMATION

Corresponding Authors

*E-mail: [email protected]. *E-mail: [email protected]. L


Research Article

ACS Synthetic Biology ORCID

(14) Soucaille, P., and Boisart, C. (2013) Method for the preparation of 1,3-propanediol from sucrose, USPTO Patent Application 20130309737. (15) Glover, J. R., Chapple, C. C. S., Rothwell, S., Tober, I., and Ellis, B. E. (1988) Allylglucosinolate biosynthesis in Brassica carinata. Phytochemistry 27, 1345−1348. (16) Hift, H., and Mahler, H. R. (1952) The enzymatic condensation of pyruvate and formaldehyde. J. Biol. Chem. 198, 901−914. (17) Harvey, R. J. (1973) Growth and initiation of protein synthesis in Escherichia coli in the presence of trimethoprim. J. Bacteriol. 114, 309−322. (18) Wild, J., and Klopotowski, T. (1981) D-Amino acid dehydrogenase of Escherichia coli K12: positive selection of mutants defective in enzyme activity and localization of the structural gene. Mol. Gen. Genet. 181, 373−378. (19) Mutzel, R., and Marlière, P. (2000) Method and device for selecting accelerated proliferation of living cells in suspension, Patent WO 00/34433. (20) Marliere, P., Patrouix, J., Doring, V., Herdewijn, P., Tricot, S., Cruveiller, S., Bouzon, M., and Mutzel, R. (2011) Chemical evolution of a bacterium’s genome. Angew. Chem., Int. Ed. 50, 7109−7114. (21) Johnson, W. V., and Anderson, P. M. (1987) Bicarbonate is a recycling substrate for cyanase. J. Biol. Chem. 262, 9021−9025. (22) Kim, S. H., Schneider, B. L., and Reitzer, L. (2010) Genetics and regulation of the major enzymes of alanine synthesis in Escherichia coli. J. Bacteriol. 192, 5304−5311. (23) Yoneyama, H., Hori, H., Lim, S.-J., Murata, T., Ando, T., Isogai, E., and Katsumata, R. (2011) Isolation of a Mutant Auxotrophic for LAlanine and Identification of Three Major Aminotransferases That Synthesize L-Alanine in Escherichia coli. Biosci., Biotechnol., Biochem. 75, 930−938. (24) Bar-Even, A., Noor, E., Savir, Y., Liebermeister, W., Davidi, D., Tawfik, D. S., and Milo, R. (2011) The moderately efficient enzyme: evolutionary and physicochemical trends shaping enzyme parameters. Biochemistry 50, 4402−4410. (25) Duff, S. M., Rydel, T. J., McClerren, A. L., Zhang, W., Li, J. Y., Sturman, E. J., Halls, C., Chen, S., Zeng, J., Peng, J., Kretzler, C. N., and Evdokimov, A. (2012) The enzymology of alanine aminotransferase (AlaAT) isoforms from Hordeum vulgare and other organisms, and the HvAlaAT crystal structure. Arch. Biochem. Biophys. 528, 90−101. (26) von Delft, F., Inoue, T., Saldanha, S. A., Ottenhof, H. H., Schmitzberger, F., Birch, L. M., Dhanaraj, V., Witty, M., Smith, A. G., Blundell, T. L., and Abell, C. (2003) Structure of E. coli Ketopantoate Hydroxymethyl Transferase Complexed with Ketopantoate and Mg2+, Solved by Locating 160 Selenomethionine Sites. Structure 11, 985− 996. (27) Neidhardt, F., and Umbarger, H. (1996) Chemical composition of Escherichia coli, In Escherichia coli and Salmonella. Cellular and Molecular Biology, 2nd ed. (Neidhardt, F., Ed.), pp 13−16, ASM Press, Washington, D.C. (28) Liu, J.-Q., Dairi, T., Itoh, N., Kataoka, M., Shimizu, S., and Yamada, H. (1998) Gene cloning, biochemical characterization and physiological role of a thermostable low-specificity L-threonine aldolase from Escherichia coli. Eur. J. Biochem. 255, 220−226. (29) Guo, A. C., Jewison, T., Wilson, M., Liu, Y., Knox, C., Djoumbou, Y., Lo, P., Mandal, R., Krishnamurthy, R., and Wishart, D. S. (2013) ECMDB: the E. coli Metabolome Database. Nucleic Acids Res. 41, D625−630. (30) Bennett, B. D., Kimball, E. H., Gao, M., Osterhout, R., Van Dien, S. J., and Rabinowitz, J. D. (2009) Absolute metabolite concentrations and implied enzyme active site occupancy in Escherichia coli. Nat. Chem. Biol. 5, 593−599. (31) D’Ari, R., and Casadesus, J. (1998) Underground metabolism. BioEssays 20, 181−186. (32) Notebaart, R. A., Szappanos, B., Kintses, B., Pal, F., Gyorkei, A., Bogos, B., Lazar, V., Spohn, R., Csorgo, B., Wagner, A., Ruppin, E., Pal, C., and Papp, B. (2014) Network-level architecture and the

Madeleine Bouzon: 0000-0002-9581-6584 Author Contributions

PM conceived the project; MB, PM designed the experiments; MB, VD, OL, AP, NP, FT performed research; MB, PM, AP, FT, JW analyzed data; MB, PM, JW wrote the manuscript. Notes

The authors declare no competing financial interest.

■

ACKNOWLEDGMENTS Research was supported by CEA Genoscope. We thank A. BarEven and V. Döring for helpful discussions and thorough reading of the manuscript, J. Patrouix and L. Gaillon for technical support in continuous cultures, K. Labadie, J. Poulain and Genoscope’s sequencing team for genome sequencing, S. Cruveiller, V. Barbe and B. Chane-Woon-Ming for bioinformatic analysis, K. Bastard for protein modelling, E. Daryi for LC−MS setup, G. Gyapay and P. Trukniewicz for RT-qPCR experiments.

■

REFERENCES

(1) Braakman, R., and Smith, E. (2013) The compositional and evolutionary logic of metabolism. Phys. Biol. 10, 011001. (2) Noor, E., Eden, E., Milo, R., and Alon, U. (2010) Central carbon metabolism as a minimal biochemical walk between precursors for biomass and energy. Mol. Cell 39, 809−820. (3) Jensen, R. A. (1976) Enzyme recruitment in evolution of new function. Annu. Rev. Microbiol. 30, 409−425. (4) Schulenburg, C., and Miller, B. G. (2014) Enzyme recruitment and its role in metabolic expansion. Biochemistry 53, 836−845. (5) Mainguet, S. E., Gronenberg, L. S., Wong, S. S., and Liao, J. C. (2013) A reverse glyoxylate shunt to build a non-native route from C4 to C2 in Escherichia coli. Metab. Eng. 19, 116−127. (6) Bogorad, I. W., Lin, T.-S., and Liao, J. C. (2013) Synthetic nonoxidative glycolysis enables complete carbon conservation. Nature 502, 693. (7) Antonovsky, N., Gleizer, S., Noor, E., Zohar, Y., Herz, E., Barenholz, U., Zelcbuch, L., Amram, S., Wides, A., Tepper, N., Davidi, D., Bar-On, Y., Bareia, T., Wernick, David, G., Shani, I., Malitsky, S., Jona, G., Bar-Even, A., and Milo, R. (2016) Sugar Synthesis from CO2 in Escherichia coli. Cell 166, 115−125. (8) Siegel, J. B., Smith, A. L., Poust, S., Wargacki, A. J., Bar-Even, A., Louw, C., Shen, B. W., Eiben, C. B., Tran, H. M., Noor, E., Gallaher, J. L., Bale, J., Yoshikuni, Y., Gelb, M. H., Keasling, J. D., Stoddard, B. L., Lidstrom, M. E., and Baker, D. (2015) Computational protein design enables a novel one-carbon assimilation pathway. Proc. Natl. Acad. Sci. U. S. A. 112, 3704−3709. (9) Matthews, R. (1996) One-carbon metabolism, In Escherichia coli and Salmonella. Cellular and Molecular Biology, 2nd ed. (Neidhardt, F., Ed.), pp 600−611, ASM Press, Washington, D.C. (10) Scarsdale, J. N., Radaev, S., Kazanina, G., Schirch, V., and Wright, H. T. (2000) Crystal structure at 2.4 A resolution of E. coli serine hydroxymethyltransferase in complex with glycine substrate and 5-formyl tetrahydrofolate. J. Mol. Biol. 296, 155−168. (11) Fujiwara, K., Okamura-Ikeda, K., and Motokawa, Y. (1984) Mechanism of the glycine cleavage reaction. Further characterization of the intermediate attached to H-protein and of the reaction catalyzed by T-protein. J. Biol. Chem. 259, 10664−10668. (12) Chistoserdova, L., Kalyuzhnaya, M. G., and Lidstrom, M. E. (2009) The expanding world of methylotrophic metabolism. Annu. Rev. Microbiol. 63, 477−499. (13) Chen, Z., Geng, F., and Zeng, A. P. (2015) Protein design and engineering of a de novo pathway for microbial production of 1,3propanediol from glucose. Biotechnol. J. 10, 284−289. M


Research Article

ACS Synthetic Biology evolutionary potential of underground metabolism. Proc. Natl. Acad. Sci. U. S. A. 111, 11762−11767. (33) Lane, R. S., and Dekker, E. E. (1969) 2-Keto-4-hydroxybutyrate. Synthesis, chemical properties, and as a substrate for lactate dehydrogenase of rabbit muscle. Biochemistry 8, 2958−2966. (34) Richaud, C., Mengin-Lecreulx, D., Pochet, S., Johnson, E. J., Cohen, G. N., and Marliere, P. (1993) Directed evolution of biosynthetic pathways. Recruitment of cysteine thioethers for constructing the cell wall of Escherichia coli. J. Biol. Chem. 268, 26827−26835. (35) Miller, J. H. (1972) Experiments in Molecular Genetics, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY. (36) Sambrook, J., Fritsch, E. F., and Maniatis, T. (1989) Molecular Cloning. A Laboratory Manual, 2nd ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY. (37) Winans, S. C., Elledge, S. J., Krueger, J. H., and Walker, G. C. (1985) Site-directed insertion and deletion mutagenesis with cloned fragments in Escherichia coli. J. Bacteriol. 161, 1219−1221. (38) Datsenko, K. A., and Wanner, B. L. (2000) One-step inactivation of chromosomal genes in Escherichia coli K-12 using PCR products. Proc. Natl. Acad. Sci. U. S. A. 97, 6640−6645. (39) Aronson, B. D., Levinthal, M., and Somerville, R. L. (1989) Activation of a cryptic pathway for threonine metabolism via specific IS3-mediated alteration of promoter structure in Escherichia coli. J. Bacteriol. 171, 5503−5511. (40) Kreimeyer, A., Perret, A., Lechaplais, C., Vallenet, D., Médigue, C., Salanoubat, M., and Weissenbach, J. (2007) Identification of the Last Unknown Genes in the Fermentation Pathway of Lysine. J. Biol. Chem. 282, 7191−7197. (41) Teller, J. H., Powers, S. G., and Snell, E. E. (1976) Ketopantoate hydroxymethyltransferase. I. Purification and role in pantothenate biosynthesis. J. Biol. Chem. 251, 3780−3785. (42) Trott, O., and Olson, A. J. (2010) AutoDock Vina: Improving the speed and accuracy of docking with a new scoring function, efficient optimization, and multithreading. J. Comput. Chem. 31, 455− 461. (43) Seebach, D., Dziadulewicz, E., Behrendt, L., Cantoreggi, S., and Fitzi, R. (1989) Synthesis of Nonproteinogenic (R)- or (S)-Amino Acids Analogues of Phenylalanine, Isotopically Labelled and Cyclic Amino Acids from tert-Butyl 2-(tert-Butyl)-3-methyl-4-oxo-1-imidazolidinecarboxylate (Boc-BMI). Liebigs Annalen der Chemie 1989, 1215− 1232. (44) Berthod, A., Liu, Y., Bagwill, C., and Armstrong, D. W. (1996) Facile liquid chromatographic enantioresolution of native amino acids and peptides using a teicoplanin chiral stationary phase. Journal of Chromatography A 731, 123−137. (45) Loreau, O., and Marlière, P. (2013) Straightforward preparation of labeled potassium cyanate by ozonation and application to the synthesis of [13C] or [14C]ureidocarboxylic acids. J. Labelled Compd. Radiopharm. 56, 347−350. (46) Mesbah, M., Premachandran, U., and Whitman, W. B. (1989) Precise Measurement of the G+C Content of Deoxyribonucleic Acid by High-Performance Liquid Chromatography. Int. J. Syst. Bacteriol. 39, 159−167. (47) Li, G., Shimelis, O., Zhou, X., and Giese, R. W. (2003) Scaleddown nuclease P1 for scaled-up DNA digestion. Biotechniques 34, 908−909. (48) Crain, P. F. (1990) Preparation and enzymatic hydrolysis of DNA and RNA for mass spectrometry. Methods Enzymol. 193, 782− 790. (49) Vallenet, D., Belda, E., Calteau, A., Cruveiller, S., Engelen, S., Lajus, A., Le Fevre, F., Longin, C., Mornico, D., Roche, D., Rouy, Z., Salvignol, G., Scarpelli, C., Thil Smith, A. A., Weiman, M., and Medigue, C. (2013) MicroScope–an integrated microbial resource for the curation and comparative analysis of genomic and metabolic data. Nucleic Acids Res. 41, D636−647. (50) Ning, Z., Cox, A. J., and Mullikin, J. C. (2001) SSAHA: A Fast Search Method for Large DNA Databases. Genome Res. 11, 1725− 1729.

(51) Smith, T. F., and Waterman, M. S. (1981) Identification of common molecular subsequences. J. Mol. Biol. 147, 195−197. (52) Gotoh, O. (1982) An improved algorithm for matching biological sequences. J. Mol. Biol. 162, 705−708. (53) Kurtz, S., Phillippy, A., Delcher, A. L., Smoot, M., Shumway, M., Antonescu, C., and Salzberg, S. L. (2004) Versatile and open software for comparing large genomes. Genome Biology 5, R12. (54) Katoh, K., and Standley, D. M. (2013) MAFFT Multiple Sequence Alignment Software Version 7: Improvements in Performance and Usability. Mol. Biol. Evol. 30, 772−780.

N


A Synthetic Alternative to Canonical One-Carbon Metabolism - ACS

Recommend Documents