A Target-Triggered DNAzyme Motor Enabling Homogeneous

Subscriber access provided by UNIVERSITY OF ADELAIDE LIBRARIES

Article

A target-triggered DNAzyme motor enabling homogeneous, amplified detection of proteins Junbo Chen, Albert Zuehlke, Bin Deng, Hanyong Peng, Xiandeng Hou, and Hongquan Zhang Anal. Chem., Just Accepted Manuscript • DOI: 10.1021/acs.analchem.7b03529 • Publication Date (Web): 03 Nov 2017 Downloaded from http://pubs.acs.org on November 5, 2017

Just Accepted “Just Accepted” manuscripts have been peer-reviewed and accepted for publication. They are posted online prior to technical editing, formatting for publication and author proofing. The American Chemical Society provides “Just Accepted” as a free service to the research community to expedite the dissemination of scientific material as soon as possible after acceptance. “Just Accepted” manuscripts appear in full in PDF format accompanied by an HTML abstract. “Just Accepted” manuscripts have been fully peer reviewed, but should not be considered the official version of record. They are accessible to all readers and citable by the Digital Object Identifier (DOI®). “Just Accepted” is an optional service offered to authors. Therefore, the “Just Accepted” Web site may not include all articles that will be published in the journal. After a manuscript is technically edited and formatted, it will be removed from the “Just Accepted” Web site and published as an ASAP article. Note that technical editing may introduce minor changes to the manuscript text and/or graphics which could affect content, and all legal disclaimers and ethical guidelines that apply to the journal pertain. ACS cannot be held responsible for errors or consequences arising from the use of information contained in these “Just Accepted” manuscripts.

Analytical Chemistry is published by the American Chemical Society. 1155 Sixteenth Street N.W., Washington, DC 20036 Published by American Chemical Society. Copyright © American Chemical Society. However, no copyright claim is made to original U.S. Government works, or works produced by employees of any Commonwealth realm Crown government in the course of their duties.

Page 1 of 20

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Analytical Chemistry

A target-triggered DNAzyme motor enabling homogeneous, amplified detection of proteins Junbo Chen,1,2 Albert Zuehlke,2 Bin Deng,2 Hanyong Peng, 2 Xiandeng Hou,1,3 and Hongquan Zhang2* 1

Analytical & Testing Centre, Sichuan University, Chengdu, Sichuan, 610064, China.

2

Division of Analytical and Environmental Toxicology, Department of Laboratory Medicine

and Pathology, Faculty of Medicine and Dentistry, University of Alberta, Edmonton, Alberta, T6G 2G3, Canada. 3

College of Chemistry, Sichuan University, 29 Wangjiang Road, Chengdu, Sichuan, 610064, China.

* E-mail: [email protected]

1

ACS Paragon Plus Environment


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 2 of 20

ABSTRACT We report here the concept of a self-powered, target-triggered DNA motor constructed by engineering a DNAzyme to adapt into binding-induced DNA assembly. An affinity ligand was attached to the DNAzyme motor via a DNA spacer, and a second affinity ligand was conjugated to the gold nanoparticle (AuNP) that was also decorated with hundreds of substrate strands serving as high-density, three-dimensional track for the DNAzyme motor. Binding of a target molecule to the two ligands induced hybridization between the DNAzyme and its substrate on the AuNP which are otherwise unable to spontaneously hybridize. The hybridization of DNAzyme with the substrate initiates the cleavage of the substrate and the autonomous movement of the DNAzyme along the AuNP. Each moving step restores the fluorescence of a dye molecule, enabling monitoring of the operation of the DNAzyme motor in real time. A simple addition or depletion of the cofactor Mg2+ allows for fine control of the DNAzyme motor. The motor can translate a single binding event into cleavage of hundreds of substrates, enabling amplified detection of proteins at room temperature and without the need for separation.

INTRODUCTION Inspired by endogenous protein motors,1,2 various synthetic DNA motors have been constructed by taking advantage of the specificity and predictability of Watson-Crick base pairing.3-5 Fueled by DNA hybridization or hydrolysis,6-9 DNA motors can walk autonomously along tracks made from DNA. DNA tracks, typically one- or two-dimensional, contain track strands that guide the movement of DNA motors. Linear DNA tracks often consist of a limited number of anchorages, which constrains DNA motors to only 1-3 walking steps.10-14 The use of DNA origami to build two-dimensional tracks improves the number of walking steps, so that walking of 20 to 30 steps is achieved.15-18 However, the application of DNA motors to signal amplification and biosensing is limited because of low mobility and difficulty in real-time monitoring of walking process. To improve the mobility and processivity of DNA motors, nano- and micro-materials, including carbon nanotubes, 19, 20 gold nanoparticles (AuNPs),

21-26

microparticles,27 and gold

film,28 have been used to build DNA tracks, accommodating hundreds to thousands of track 2


Page 3 of 20

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


strands on individual tracks. Therefore, autonomous walking of hundreds of steps was achieved, which enhanced the applicability of DNA motors for signal amplification. Additionally, the unique optical properties of nanomaterials facilitate real-time monitoring of the movement of DNA motors.21 On the other hand, DNA tracks on nano- and micro-materials are less defined, which makes the movement of the motors stochastic.21-23 Although the use of nano- and micro-materials enables applications of DNA motors to signal amplification and biosensing, most DNA motors are only responsive to nucleic acid targets22-25, 27, 28. We first used AuNPs to build three-dimensional DNA tracks of high density and constructed a DNA motor system enabling proteins to trigger the operation of the motor.21 The DNA motor uses a nicking endonuclease to power the movement of the motor, and 37 oC is required for the operation of the DNA motor. However, the external addition of a protein enzyme to drive the movement of the motor is not often practical in highly desirable point-of-care testing and in situ applications 29. We have recently used AuNPs to construct a DNAzyme motor that operates in living cells in response to a specific intracellular microRNA.23 Herein, we aim to construct self-powered motors that are responsive to protein targets and operate at room temperature without the requirement for protein enzymes. To achieve this, we engineer the DNAzyme to adapt into binding-induced DNA assembly (BINDA) and build a target-triggered DNAzyme motor that autonomously traverses along AuNPs. Inspired by proximity ligation assay30-33, we recently proposed a new concept of DNA assembly termed BINDA which enables protein binding to trigger the assembly of separate DNA components that are otherwise unable to spontaneously assemble 34-36. Additionally, the use of DNAzyme allows us to rationally design the binding arms of the DNAzyme motor, enabling the motor to maintain similar walking activity at different temperatures. The DNAzyme motor also has the advantage of easy control, as a simple addition or depletion of the cofactor Mg2+ can switch the DNAzyme motor on or off. With these appealing features of self-powered motion, reliable operation at different temperatures, improved controllability, and response to non-DNA targets, we envision future applications of the DNAzyme motor to in situ signal amplification and point-of-care testing.

3



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 4 of 20

EXPERIMENTAL SECTION Materials and Reagents. DNA oligonucleotides were synthesized by Integrated DNA Technologies (IDT, Coralville, IA). The DNA sequences and modifications are listed in Table S1. A 20-nm gold nanoparticle solution was obtained from Ted Pella (Redding, CA). Streptavidin, BSA, HSA, transferrin, PSA, and GAPDH were purchased from Sigma-Aldrich (Oakville, ON, Canada). All other reagents were of analytical grade. Estimation of Tm of Hybrid between DNAzyme and Substrate. Estimating the Tm of the hybrid between the DNAzyme and its substrate is of great importance for DNAzyme design. In the absence of target molecules, the hybridization between the DNAzyme and its substrate is an intermolecular interaction. We used IDT OligoAnalyzer to estimate the Tm of the hybrid under conditions of 50 nM DNA, 200 mM NaCl, and 10 mM MgCl2. The concentration of 50 nM DNA was used because ~230 substrates were conjugated to each AuNP and 0.23 nM AuNP was used for operation of the motor. In the presence of the target molecules, the binding of the same target molecule to two ligands converts the intermolecular hybridization between the DNAzyme and its substrate into an intramolecular interaction. To estimate the Tm of the binding-induced hybrid between the DNAzyme and its substrate, we used

a

sequence

in

which

TCTCTTCTCCGAGCCGGTCGAAATAGT

is

the linked

to

DNAzyme

sequence

its

sequence

substrate

ACTATrAGGAAGAGA by using a spacer containing 112 thymine bases (Figure S16). This sequence was used to simulate binding-induced intramolecular interaction between the DNAzyme and its substrate. 112 thymine bases of the spacer are attributed to 47 spacing bases in the DNAzyme sequence, 30 spacing bases in the L2 sequence, 15 spacing bases in the substrate sequence, and 20 spacing bases used to represent the size of the target molecule (Table S1, Figure S2a). The Tm of the hybrid between the DNAzyme and its substrate is increased from 7 °C to 40 °C through target binding because target binding dramatically increases the local effective concentrations of the DNAzyme and its substrate. Preparation of AuNP Track. The preparation of the AuNP track for the DNAyzme motor was conducted by conjugating thiol-labeled oligonucleotides onto AuNP via formation of gold-sulfur bonds. To prepare the AuNP track for the DNAyzme motor responsive to streptavidin, 20 nm AuNPs (1.16 nM) were mixed with a 30-thymin-base oligonucleotide 4


Page 5 of 20

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


dually labeled with a biotin molecule at its 3'-end and a thiol group at the 5'-end and a DNA-RNA chimeric substrate dually labeled with a FAM molecule at its 3'-end and a thiol group at its 5'-end. The molar ratio of these three components in the solution was 1:100:1000. This solution was incubated at room temperature overnight. Tween 20 (1%) was used to make the final solution contain 0.05% Tween 20, to reduce adsorption and aggregation of the AuNPs. To enhance the oligonucleotide loading amounts, 3 M NaCl was used to make an increment of 0.05 M NaCl two times and thereafter an increment of 0.1 M NaCl six more times. After each increment, the solutions was sonicated for 30 s followed by 20 min incubation at room temperature. After incubation at room temperature for 24 h, a thiol-modified spacing oligonucleotide containing 10 thymine bases was then added to the solution at an oligonucleotide to AuNP ratio of 1000 to 1. The spacing oligonucleotide was used to occupy the free space on the AuNP surface, reducing the interaction between the substrate and AuNP. Because of its relatively low concentration (~0.9 µM), the spacing oligonucleotide does not significantly replace the previously conjugated substrate strands and biotin-labeled oligonucleotides. After incubation at room temperature for another 24 h, the solution was centrifuged at 13, 000 g for 20 min to separate the AuNPs from the unconjugated DNA. The AuNPs were washed four times using 1 mL of 1×PBS

buffer (pH

7.4) containing 0.05% Tween 20. The AuNPs were resuspended in 1×PBS (pH 7.4) at a concentration of 2.3 nM, and stored at 4 °C prior to use. The optimized procedures allow preparation of the AuNP track with low batch-to-batch variation (~5%). To prepare the AuNP track for the DNAzyme motor responsive to thrombin, 200 nM streptavidin was incubated with 400 nM biotin-labeled 29-mer aptamer in 1×PBS buffer (pH 7.4) at room temperature for 30 min. Each streptavidin molecule was then bound with two aptamer molecules. These streptavidin-aptamer conjugates were then incubated with the AuNP track prepared above for streptavidin at a molar ratio of 200 to 1. After incubation at room temperature for 1 h, 10 µM biotin was used to occupy the free biotin-binding sites of streptavidin. The AuNPs were then washed twice using 1 mL of 1×PBS (pH 7.4) buffer containing 0.05% Tween 20 and resuspended in 1×PBS (pH 7.4) at a concentration of 2.3 nM. Determination of Substrate Loading on AuNPs. To determine the substrate loading 5



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 6 of 20

amount per AuNP, we used mercaptoethanol to release the substrate from the AuNP and determined the fluorescence of released substrates. The substrate loading amount was then determined against a calibration. Specifically, 10 µL of 2.3 nM AuNP track solution was mixed with 90 µL of 10 mM mercaptoethanol in 1×PBS. The mixture was placed in the dark. After an overnight incubation at room temperature, the solution was then centrifuged at 13,000 g for 10 min to precipitate AuNPs. A 95 µL supernatant was transferred onto a 96-well plate (Fisher Scientific, Ottawa, ON, Canada), which was then loaded onto a fluorescence microplate reader (Beckman Coulter, DTX 800) for fluorescence detection. Calibration solutions were prepared to contain varying concentrations of substrate (from 1 nM to 100 nM) in 1×PBS and 10 mM mercaptoethanol. The fluorescence intensities of AuNP solutions before and after release of substrate strands by mercaptoethanol were used to calculate the efficiency of fluorescence quenching by AuNPs. The quenching efficiency is 98.4%, proving the ability of a single AuNP to efficiently quench fluorescence from hundreds of FAM-labeled single-stranded DNA sequences on this surface. Evaluation of the Target-Triggered DNAzyme Motor Operation. To evaluate the operation of the DNAzyme motor responding to streptavidin, we measured the fluorescence increase from sample and blank solutions in real time. Unless otherwise stated, sample solutions contained 0.23 nM AuNP track, 2 nM biotin-labeled DNAzyme, 200 mM NaCl, 10 mM MgCl2, 0.01% BSA and specified concentrations of streptavidin (added last) in 100 µL of 25 mM Tris-acetate buffer (pH 8.3). Blank solutions contained all other components except streptavidin. Solutions were transferred to a 96-well assay plate, which was then loaded onto the fluorescence microplate reader for real-time fluorescence detection. The fluorescence was measured every 10 min for a total of 2 h by using 485 nm for excitation and 515 nm for emission. The operation of the motor responding to thrombin was monitored as for streptavidin. The different amounts of thrombin were mixed with 0.23 nM AuNP track, 2 nM DNAzyme attached with 15-mer aptamer, 200 mM NaCl, 0.01% BSA in 95 µL of 25 mM Tris-acetate buffer(pH 8.3) or 5% human serum (only for thrombin). After incubation at room temperature for 20 min, 5 µL of 200 mM MgCl2 was added. Fluorescence was then measured every 10 min for a total of 2 h. 6


Page 7 of 20

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


RESULTS AND DISCUSSION Design Principle of Target-Triggered DNAzyme Motor. The target-triggered DNAzyme motor system is shown schematically in Scheme 1, using a modified DNAzyme of 8-17E as an example (Figure S1). The motor system consists of two main components: (1) a DNAzyme linked to an affinity ligand L1 and (2) a AuNP decorated with a second affinity ligand L2 and the substrate for the DNAzyme. The AuNP serves as a scaffold to construct three-dimensional tracks of hundreds of substrate molecules (Figure S2a). The high density of the substrate on the AuNP surface enhances the movement of the DNAzyme along the three-dimensional tracks. We modified the DNA-RNA chimeric substrate by adding 14 thymines (spacer S2) at the 5'-end and by conjugating a fluorescent dye to the 3'-end. The addition of spacer S2 enhances the accessibility of the substrate sequence to the DNAzyme. The labeling of the substrate with the fluorophore facilitates real-time monitoring of the motor operation because the AuNP is able to efficiently quench the fluorescence of the dye molecules.37-40 The determined quenching efficiency is 98.4%, which is comparable to that of DABCYL-quenched beacons.40 When both arm 1 and arm 2 of the DNAzyme hybridize to the DNA-RNA chimeric substrate, the DNAzyme catalyzes the hydrolysis of the substrate at the ribonucleotide site. To prevent self-hybridization between the DNAzyme and the substrate, we designed arm 1 to have only 5 n. t. and arm 2 to have 7 n. t. (Figure S1b). The estimated melting temperatures (Tm) of arm 1 and arm 2 hybridizing to the substrate are Pb2+≈ Ca2+ > Ba2+≈ Zn2+. We also studied the effect of Mg2+ concentration on the DNAzyme activity, and found that the target-activated DNAzyme is most active in 10 mM Mg2+ (Figure S5).

Figure 1. a) A target-triggered DNAzyme motor responsive to streptavidin. b) Linear increase of fluorescence over time indicates that the DNAzyme motor cleaves the substrates in the presence of both the target (200 pM streptavidin) and the cofactor Mg2+. c) Iterative control 10


Page 11 of 20

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


of the motor operation by adding Mg2+ or sequestering Mg2+ with EDTA. d) Background fluorescence arising from target-independent substrate cleavage by motors built with different DNAzymes. e) Operation of the DNAzyme motor under different temperatures.

Because the activity of the motor relies on the presence of both the target and the cofactor Mg2+, we reason that the motor operation can be simply controlled by the addition or depletion of Mg2+. To achieve this fine control, we used EDTA to sequester the Mg2+ in the motor solution. We first added 200 pM streptavidin and 10 mM Mg2+ to the motor system. The motor is therefore activated and the DNAzyme autonomously cleaves off the substrates from the AuNP tracks, giving rise to the increase in fluorescence (Figure 1c). After 15 min operation, we added 10 mM EDTA to the solution. Chelation of Mg2+ by EDTA inhibits Mg2+ from acting as the cofactor. The DNAyzme is thus deactivated and the motor stops, reflected by no more increase in fluorescence. The motor operation is switched on again by the addition of another 10 mM Mg2+. Therefore, we are able to iteratively switch the motor on or off by either adding Mg2+ or depleting Mg2+ with EDTA chelation (Figure 1c). We tested five versions of DNAzyme used to build the motors. These DNAzymes vary by different lengths of arm 1 and arm 2 (Table S1). Optimization of their lengths is important because the shorter arm 2 reduces the background due to target-independent activity, yet a minimum length is needed for a fast kinetics of the DNAzyme. We first tested the background generated from the motors built with the five DNAzymes (Figure 1d), and found that using DNAzymes 3, 4, and 5 resulted in low backgrounds. We then evaluated the response of these DNAzyme motors to a specific target (250 pM streptavidin). The strongest fluorescence response (Figure S6) and the highest moving speed (Table 1) were obtained from the motors built with DNAzymes 2 and 3. Therefore, we chose DNAzyme 3 as the optimum for constructing the motor. The underlying reasons for the observed differences among the five DNAzymes are discussed in detail (Figure S6).

11



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 12 of 20

Table 1. Moving speed of motors built with five DNAzymes DNAzyme

1

2

3

Arm

1

2

1

2

1

2

1

2

1

2

n.t.

6

8

5

8

5

7

4

7

3

7

kobs (min-1)

0.210

0.383

4

0.392

5

0.087

0.005

We then tested the operation of the DNAzyme motor under different temperatures. While the motor operates similarly under temperatures ranging from 22 °C to 37 °C (Figure 1e). The ability of the DNAzyme motor to maintain a similar operation activity under different temperatures is mainly attributed to the use of the DNAzyme and BINDA to construct the motor. Unlike protein enzymes whose activity usually demands an optimal temperature, the DNAzyme relies on the formation of a stable DNAzyme-substrate complex and the release of DNAzyme from the cleaved substrates.45 As described above, to construct the motor, we truncated the 8-17E DNAzyme to have a 5-nt arm 1 and a 7-nt arm 2. The Tm of the binding-induced hybrid between the 8-17E DNAzyme and its substrate is about 40 °C, whereas the Tm of the hybrid after cleavage is about 7 °C. Therefore, within 22 °C to 37 °C temperature range, the DNAzyme is able both to form a stable complex with the substrate and to achieve fast disassociation from the cleaved substrates. When the operating temperature was further increased to 40 °C, significant decrease in moving speed was observed as expected (Figure 1e). The moving of the DNAzyme motor is anticipated to remain on the AuNP track on which the motor is anchored by target binding. We designed an experiment to verify this anticipation. In this experiment, we prepared two types of AuNP tracks, AuNP track I containing substrate strands each labeled with a FAM molecule and biotin-labeled oligonucleotides for streptavidin binding and AuNP track II containing only substrate strands each labeled with a ROX molecule. Therefore streptavidin binding cannot place the DNAyzme motor onto track II. We then examined the operation of the motor in the presence of only track I or both tracks and monitored the fluorescence from FAM and ROX (Figure S7a). Similar increase of FAM fluorescence was observed for both operations, whereas there is little increase of ROX fluorescence (Figure S7b), which confirms that the moving of the motor localizes within individual AuNP tracks and there is little cleavage of substrates across 12


Page 13 of 20

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


different AuNP tracks. We determined the maximum steps that the motor can move along the AuNP tracks in response to a single binding event. To achieve the maximum number of moving steps, we must ensure that only a single streptavidin molecule is brought to each AuNP track. We therefore used excess amount of AuNP track (230 pM) over that of streptavidin (200 pM). To examine whether one streptavidin molecule could be bound to two AuNPs, resulting in undesirable AuNP aggregation, we characterized the solutions using UV-Vis spectroscopy, and we did not observe AuNP aggregation (Figure S8). We also optimized the concentrations of AuNP track and biotin-labeled motor to obviate decrease in sensitivity due to occupying of four binding sites of an individual streptavidin molecule by four biotins from the AuNP track or four biotins from the biotin-labeled DNAzyme (Figure S9). We monitored the motor operation in real time for 10 hours (Figure 2a and Figure S10). Fluorescence increases linearly with time for the first 7 hours, suggesting that the DNAzyme moves on the AuNP tracks at a constant rate during this period. We calculated the moving steps of the motor responding to a single binding event (Figure 2a). The motor moves ~150 steps within 7 hours in response to a single binding event. Because we have determined that ~230 substrates are present on a single AuNP and because each moving step corresponds to the cleavage of one substrate molecule, the DNAyzme cleaves ~65% of the total substrates on the AuNP at a constant rate. As the substrate molecules are cleaved off from the AuNP, fewer substrate molecules on the AuNP are available to hybridize with the DNAzyme, and subsequently, the rate of operation slows. After 10 hours, the motor has moved 178 steps, resulting in the cleavage of ~77% of the total substrates on the AuNP. This high cleavage efficiency implies that the 46-thymine spacer S1 provides a sufficient spatial distance for the DNAzyme to access the majority of the substrates on the AuNP tracks (Figure S2b). We examined the response of the motor to varying concentrations of streptavidin. We recorded the fluorescence increase of the motor solutions containing 230 pM AuNP tracks and varying concentrations of streptavidin. The fluorescence increases linearly during the 2 hours operating time for all streptavidin concentrations (Figure 2b). We then used the fluorescence increase of the first hour to calculate the cleavage rates. The cleavage rates are proportional to streptavidin concentrations (Figure S11a). Because of the extraordinary 13



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 14 of 20

binding affinity between biotin and streptavidin, the streptavidin concentrations are equivalent to the activated DNAzyme concentrations. The linear relationship between the cleavage rate and the activated DNAzyme concentrations suggests that each activated DNAzyme molecule cleaves the substrates at a same rate. The cleavage rate of each DNAzyme molecule, referred to as the multiple-turnover rate constant, is the slope of the correlation line. These results further confirm that when DNAzyme molecules are placed in close proximity onto the AuNP through target binding, the DNAzyme cleaves the substrates at a maximum rate.

Figure 2. a) Moving steps of the motor in response to a single binding event. b) Response of the motor to varying concentrations of streptavidin.

We are able to detect the response of the motor to 1 pM streptavidin for three main reasons: the motor is able to translate a single binding event into cleavage of hundreds of substrates; there is very low background fluorescence due to minimum DNAzyme activity in the absence of the target binding; and the AuNPs have excellent fluorescence quenching. The efficiency of fluorescence quenching by a single AuNP was estimated to be 98.4%. Within the linear cleavage period, the cleavage rate or fluorescence intensity is linearly proportional to the concentration of the target molecule (Figure S11b). The DNAzyme used to construct the target-triggered DNAzyme motor is not limited to the 8-17E DNAzyme. To test if other RNA-cleaving DNAzymes could be used to construct the DNAzyme motor, we used three RNA-cleaving DNAzymes, Mg5, 8-17, and 10-23

14


Page 15 of 20

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


DNAzymes, to construct the DNAzyme motors in addition to the 8-17E DNAzyme. The operation of four DNAzyme motors in response to 200 pM streptavidin was then compared (Figure S12). To minimize the effect of arm sequences on the performance of the DNAzyme motors, four DNAzyme motors were designed to have similar arms 1 and 2. The DNAzyme motors constructed by 8-17E and Mg5 DNAzymes showed much higher activity than those constructed by 8-17 and 10-23 DNAzymes. Target-Triggered DNAzyme Motor Responsive to Thrombin. Having evaluated and optimized the new motor system, we are able to simply alter affinity ligands to construct motors responsive to specific targets. In principle, new motors can be responsive to any other biomolecules that can be bound simultaneously by two ligands. Here, we demonstrate the use of aptamers as affinity ligands to construct a motor specifically responding to human α-thrombin (Figure 3a). We incorporated a 15-mer aptamer, serving as L1, at the 5-end' of the DNAyzme. We then introduced a 29-mer aptamer, serving as L2, onto the AuNP track. The 15-mer aptamer binds to the fibrinogen-recognition site of thrombin and the 29-mer aptamer binds to its heparin-binding site. The binding of two aptamers to a single thrombin molecule activates the motor, initiating the autonomous and stepwise cleavage of substrates on the AuNP tracks (Figure. 3a). When varying concentrations of thrombin were used to test the response of the motor, a linear relationship was observed between thrombin concentrations and cleavage rates (Figure 3b, Figure S13). The motor was able to generate a fluorescence increase distinguishable from the background in response to 5 pM thrombin. This limit of detection (5 pM) is lower than those of most homogeneous assays for detection of thrombin (Table S3). We tested the specificity of the motor by determining its response to four other proteins [human serum albumin (HSA), prostate specific antigen (PSA), glyceraldehyde 3-phosphate dehydrogenase (GAPDH), and transferrin]. These four proteins at 50 nM concentrations did not yield fluorescence distinguishable from the background, whereas the target protein at concentration 100 times lower (0.5 nM thrombin) resulted in a large fluorescence increase (Figure 3c). We further examined the response of the motor to varying concentrations of thrombin present in diluted human serum. 5% serum did not cause significant interference, which demonstrates the specificity of the motor (Figure S14). When the operation of the motor was tested in 50% serum, no fluorescence increase was observed, 15



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 16 of 20

suggesting that high percent serum can inhibit activity of the DNAzyme motor (Figure S15). The high specificity of the motor originates from its intrinsic feature: the simultaneous binding of two ligand molecules to the same target molecule is required to activate the motor.

Figure 3. a) A target-triggered DNAzyme motor responsive to thrombin. b) Response of the motor to varying concentrations of thrombin. c) Specific response of the motor to thrombin molecules.

CONCLUSIONS We have demonstrated the design and operation of the target-triggered DNAzyme motor constructed with DNAzyme on AuNPs. This new DNAzyme motor is distinct from existing DNA motors. Firstly, binding-induced DNA assembly is the underlying strategy to construct the motor, which enables the use of proteins to activate the motor. The new target-triggered DNAzyme motor strategy can be adapted to specifically respond to any biomolecules capable of simultaneous binding to two ligand molecules. Secondly, the autonomous motion of the motor is self-powered without the need for external addition of protein enzymes, because of the use of DNAzyme to build the motor and to power its movement. The use of DNAzyme also enables the motor to maintain reliable activity under different temperatures. Thirdly, the motor is able to translate a single binding event into cleavage of hundreds of substrates from a single AuNP, resulting in enhanced detection capability. Finally, the motor can be switched

16


Page 17 of 20

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


on or off by simply adding or depleting the DNAzyme cofactor Mg2+. The new strategy to integrate diverse molecular binding into synthetic DNA motors is significant for broadening the applications of DNA motors to molecular sensing, cell imaging, molecular interaction monitoring, and controlled delivery and release of therapeutics.

SUPPORTING INFORMATION AVAILABLE Table S1, S2, S3 and Figures S1, S2, S3, S4, S5, S6, S7, S8, S9, S10, S11, S12, S13, S14, S15, S16. This material is available free of charge via the Internet at http://pubs.acs.org.

AUTHOR INFORMATION Corresponding Author *

E-mail: [email protected]

ACKNOWLEDGMENTS The authors acknowledge financial support from the Natural Sciences and Engineering Research Council of Canada, the University Hospital Foundation, the University of Alberta, Alberta Innovates, and Alberta Health, and sChina Scholarship Council scholarship to J.C.

REFERENCES (1)

Vale, R. D. Cell. 2003 112, 467-480.

(2)

Finer, J. T.; Sim-mons, R. M.; Spudich, J. A. Nature. 1994, 368, 113-119.

(3)

Pan, J.; Li, F.; Cha, T. G.; Chen, H.; Choi, J. H. Curr. Opin. Biotechnol. 2015, 34, 56-64.

(4)

Liu, H.; Liu, D. Chem. Commun. 2009, 21, 2625-2635.

(5)

Song, C., Wang, Z. G.; Ding, B. Small, 2013, 22, 9, 2382-2392.

(6)

Tian, Y.; He, Y.; Chen, Y.; Yin, P.; Mao, C.D. Angew. Chem. Int. Ed. 2005, 44,

4355-4358. (7)

Muscat, R. A.; Bath, J.; Turberfield, A. J. Nano Lett. 2011, 11, 982-987.

(8)

Venkataraman, S.; Dirks, R. M.; Rothemund, P. W. K.; Winfree, E.; Pierce, N. A. Nat.

Nanotechnol. 2007, 2, 490-494. (9)

Wang, C.Y.; Ren, J.S.; Qu, X G. Chem. Commun. 2011, 47, 1428-1430. 17



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 18 of 20

(10) Omabegho T.; Sha R.; Seeman, N. C. Science.2009, 324, 67-71. (11) Shin, J. S.; Pierce, N. A. J. Am. Chem. Soc. 2004, 126 10834-10835. (12) Bath, J.; Green, S. J.; Allen, K. E.; Turberfield, A. J.; Small. 2009, 5, 1513-1516. (13) Liu, M.H.; Hou, R.Z.; Cheng, J.; Loh, I. Y.; Sreelatha, S.; Tey, J. N.; Wei, J.; Wang, Z. S.

ACS Nano. 2014, 8, 1792-1803. (14) You, M. X.; Chen, Y.; Zhang, X. B.; Liu, H. P.; Wang, R. W.; Wang, K. L.; Williams, K. R.; Tan, W. H. Angew. Chem. Int. Ed. 2012, 124, 2507-2510. (15) Lund, K.; Manzo, A. J.; Dabby, N.; Michelotti, N.; Johnson-Buck, A.; Nangreave, J.; Taylor, S.; Pei, R. J.; Stojanovic, M. N.; Walter, N. G.; Winfree, E.; Yan, H. Nature. 2010, 465, 206-210. (16) Flipse, J.; Bakker, F. L.; Slachter, A.; Dejene; F. K.; Van Wees, B. J. Nat. Nanotechnol. 2012, 7, 166-168. (17) Wickham, S. F. J.; Bath, J.; Katsuda, Y.; Endo, M.; Hidaka, K.; Sugiyama, H.; Turberfield, A. J. Nat. Nanotechnol. 2012, 7, 169-173. (18) Liber, M.; Tomov, T. E.; Tsukanov, R.; Berger, Y.; Nir, E. Small. 2015, 11, 568-575. (19) Cha, T. G.; Pan, J.; Chen, H.; Salgado, J.; Li, X.; Mao, C.; Choi, J. H. Nat. Nanotechnol. 2014, 9, 39-43. (20) Cha, T. G.; Pan, J.; Chen, H.; Salgado, J.; Li, X.; Mao, C.; Choi, J. H. J. Am. Chem. Soc. 2015, 137, 9429-9437. (21) Zhang, H.; Lai, M. D.; Zuehlke, A.; Peng, H. Y.; Li, X. F.; Le, X. C. Angew. Chem. Int.

Ed. 2015, 54, 14326-14330. (22) Yang, X. L.; Tang, Y. A.; Mason, S. D.; Chen, J. B.; Li, F. ACS Nano. 2016, 10, 2324-2330. (23) Peng, H.Y.; Li, X. F.; Zhang, H.; Le, X. C. A microRNA-initiated DNAzyme motor operating in living cells. Nat. Commun. 2017, 8, 14378 doi: 10.1038/ncomms14378. (24) Qu, X.M.; Zhu, D.; Yao, G. B.; Su, S.; Chao, J.; Zuo, X. L.; Wang, L. H.; Shi, J. Y.; Wang, L. H., Huang, W.; Pei, H.; Fan, C. H. Angew. Chem. Int. Ed. 2017, 56, 1855-1858. (25) Liang, C. P.; Ma, P. Q.; Liu, H.; Guo, X. G.; Yin, B. C.; Ye, B. C. Angew. Chem. Int. Ed. 2017, 56, 9077–9081. (26) Li, W.; Wang, L.; Jiang, W. Chem. Commun. 2017, 53, 5527. 18


Page 19 of 20

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


(27) Jung, C.; Allen, P. B.; Ellington, A. D. Nat. Nanotechnol. 2016, 11, 157-163. (28) Yehl, K.; Mugler, A.; Vivek, S.; Liu, Y.; Zhang, Y.; Fan, M. Z.; Weeks, E. R.; Salaita, K.

Nat. Nanotechnol. 2016, 11, 184-190. (29) Bath, J.; Turberfield, A. J. Nat. Nanotechnol. 2007, 2, 275-284. (30) Fredriksson, S.; Gullberg, M.; Jarvius, J.; Olsson, C.; Pietras, K.; Gustafsdottir, S. M.; Ostman, A.; Landegren, U. Nat. Biotechnol. 2002, 20, 473−477. (31) Hu, J.; Yu, Y.; Brooks, J. C.; Godwin, L. A.; Somasundaram, S.; Torabinejad, F.; Kim, J.; Shannon, C.; Easley, C. J. J Am. Chem. Soc. 2014, 136, 8467-8474. (32) Zong, C.; Wu, J.; Liu, M.; Yang, L.; Liu, L.; Yan, F.; Ju, H. Anal. Chem. 2014, 86, 5573-5578. (33) Zou, M.; Li, D1.; Yuan, R.; Xiang, Y. Biosens. Bioelectron. 2017, 92, 624-629. (34) Zhang, H.; Li, X. F.; Le, X. C. Anal. Chem. 2012, 84, 877-884. (35) Zhang, H.; Li, F.; Dever, B.; Wang, C.; Li, X. F.; Le, X. C. Angew. Chem. Int. Ed. 2013, 52, 10698-10705. (36) Deng, B.; Chen, J. B.; Zhang, H. Anal. Chem. 2014, 86, 7009-7016. (37) Bhatt, N.; Huang, P. J. J.; Dave, N.; Liu, J. W. Langmuir, 2011, 27, 6132-6137. (38) Wu, P. W.; Hwang, K. V.; Lan, T.; Lu, Y. J. Am. Chem. Soc. 2013, 135, 5254-5257. (39) Uddayasankar, U.; Krull, U. J. Anal. Chim. Acta. 2013, 803, 113-122 (40) Dubertret, B.; Calame, M.; Libchaber, A. J. Nat. Biotechnol. 2001, 19, 365-370. (41) Brown, A. K.; Li, J.; Pavot, C. M. B.; Lu, Y. Biochemistry. 2003, 42, 7152-7161. (42) Zhou, W.; Chen, Q.; Huang, P. J.; Ding, J.; Liu, J. Anal. Chem. 2015, 87, 4001-4007. (43) Schlosser, K.; Li, Y. ChemBioChem. 2010, 11, 866-879. (44) Kim, H. K.; Rasnik, I.; Liu, J.; Ha, T.; Lu, Y. Nat. Chem. Biol. 2007, 3, 763-768. (45) Santoro, S. W.; Joyce, G. F., Biochemistry. 1998, 37, 13330-13342.

19



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 20 of 20

For TOC only

20


A Target-Triggered DNAzyme Motor Enabling Homogeneous

Recommend Documents