A versatile platform for nanoparticle surface bioengineering based on

Subscriber access provided by Kaohsiung Medical University

Surfaces, Interfaces, and Applications

A versatile platform for nanoparticle surface bioengineering based on SiO2-binding peptide and proteinaceous Barnase*Barstar interface Victoria Shipunova, Ivan Zelepukin, Oleg A Stremovskiy, Maxim Petrovich Nikitin, Andrew Care, Anwar Sunna, Andrei V Zvyagin, and Sergey Mikhailovich Deyev ACS Appl. Mater. Interfaces, Just Accepted Manuscript • DOI: 10.1021/acsami.8b01627 • Publication Date (Web): 27 Apr 2018 Downloaded from http://pubs.acs.org on April 27, 2018

Just Accepted “Just Accepted” manuscripts have been peer-reviewed and accepted for publication. They are posted online prior to technical editing, formatting for publication and author proofing. The American Chemical Society provides “Just Accepted” as a service to the research community to expedite the dissemination of scientific material as soon as possible after acceptance. “Just Accepted” manuscripts appear in full in PDF format accompanied by an HTML abstract. “Just Accepted” manuscripts have been fully peer reviewed, but should not be considered the official version of record. They are citable by the Digital Object Identifier (DOI®). “Just Accepted” is an optional service offered to authors. Therefore, the “Just Accepted” Web site may not include all articles that will be published in the journal. After a manuscript is technically edited and formatted, it will be removed from the “Just Accepted” Web site and published as an ASAP article. Note that technical editing may introduce minor changes to the manuscript text and/or graphics which could affect content, and all legal disclaimers and ethical guidelines that apply to the journal pertain. ACS cannot be held responsible for errors or consequences arising from the use of information contained in these “Just Accepted” manuscripts.

is published by the American Chemical Society. 1155 Sixteenth Street N.W., Washington, DC 20036 Published by American Chemical Society. Copyright © American Chemical Society. However, no copyright claim is made to original U.S. Government works, or works produced by employees of any Commonwealth realm Crown government in the course of their duties.

Page 1 of 37 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

ACS Applied Materials & Interfaces

A versatile platform for nanoparticle surface bioengineering based on SiO2-binding peptide and proteinaceous Barnase*Barstar interface Victoria O. Shipunova1,2,3,* Ivan V. Zelepukin1,2,3, Oleg A. Stremovskiy1, Maxim P. Nikitin1,3, Andrew Care5, Anwar Sunna5, Andrei V. Zvyagin1,4,5,* & Sergey M. Deyev1,2

1

Shemyakin–Ovchinnikov Institute of Bioorganic Chemistry, Russian Academy of Sciences,

16/10 Miklukho–Maklaya Street, Moscow, 117997, Russia 2

National Research Nuclear University MEPhI (Moscow Engineering Physics Institute), 31

Kashirskoe shosse, Moscow, 115409, Russia 3

Moscow Institute of Physics and Technology (State University), 9 Institutskiy per.,

Dolgoprudny, Moscow Region, 141700, Russia 4

Sechenov First Moscow State Medical University, 8-2 Trubetskaya St., Moscow, 119991,

Russia 5

ARC Centre of Excellence for Nanoscale BioPhotonics (CNBP), Macquarie University,

Sydney, New South Wales, 2109, Australia

ACS Paragon Plus Environment

1

ACS Applied Materials & Interfaces 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 2 of 37

KEYWORDS: nanoparticle modification, bioengineering, cancer cells, Barnase, Barstar, HER2/neu, targeted delivery, DARPin

ABSTRACT Nanoparticle surface engineering can change its chemical identity to enable surface-coupling with functional biomolecules. However, common surface coupling methods such as physical adsorption or chemical conjugation often suffer from the low coupling yield, poorly controllable orientation of biomolecules and steric hindrance during target binding. These issues limit the application scope of nanostructures for theranostics and personalized medicine. To address these shortfalls, we developed a rapid and versatile method of nanoparticle biomodification. The method is based on a SiO2-binding peptide that binds to the nanoparticle surface and a protein adaptor system, Barnase*Barstar protein pair, serving as а “molecular glue” between the peptide and attached biomolecule. The biomodification procedure shortens to several minutes, preserves the orientation and functions of biomolecules and enables control over the number and ratio of attached molecules. The capabilities of the proposed biomodification platform were demonstrated by coupling different types of nanoparticles with DARPin9.29 and 4D5scFv – molecules that recognizes the HER2/neu oncomarker – and by subsequent highly selective immunotargeting of the modified nanoparticles to different HER2/neu-overexpressing cancer cells in one-step or two-step (with pre-targeting by HER2/neu-recognizing molecule) modes. The method preserved the biological activity of the DARPin9.29 molecules attached to a nanoparticle, whereas the state-of-the-art carbodiimide EDC/sulfo-NHS method of conjugation led to a complete loss of the functional activity of the DARPin9.29 nanoparticle-protein complex. Moreover, the method allowed surface-design of nanoparticles that selectively interacted with antigens in complex biological fluids, such as whole blood. The demonstrated


2

Page 3 of 37 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


capabilities show this method as promising alternative to commonly used chemical conjugation techniques in nanobiotechnology, theranostics and clinical applications.

1. Introduction Advances in nanobiotechnology foster the development of personalized medicine and new approaches for the diagnosis and therapy of socially significant diseases

1–4

. Nano- and

microparticles as well as nanoparticle-based structures are of particular interest as new and unique therapeutic and diagnostic agents due to their drastically different physico-chemical properties in comparison with bulk structures or biomolecules. Multifunctionality, including therapeutic and diagnostic functions, represents one of the key design parameters of these materials. The desired multifunctionality can be achieved by coupling nanoparticle surface to biofunctional molecules, including antibodies, peptides, aptamers, toxins, etc. For example, a nanoparticle loaded with drugs coupled to targeting biomolecules is capable of delivering the drugs to target cells

5,6

. This targeted delivery property enables realization of a "magic bullet"

concept – selectively affecting only pathology sites sparing healthy tissues. Currently, the main approaches to the biomolecules coupling with nanoparticle surface are based on non-specific adsorption of molecules on the surface, or chemical conjugation, which places a stringent demand on the nanoparticle surface moieties. These methods often lead to attached molecules with heterogeneous orientation, low surface density and steric hindrance during target binding. These issues limit the effectiveness of nanostructures in targeted drug delivery and the sensitivity of the methods or biosensors 7,8. Here, we describe the development of a universal method for the surface bioengineering of nanoand microparticles with retention of the orientation and functional activity of molecules being


3


Page 4 of 37

attached by using specific interactions between peptides and the solid phase to which they bind (in our case, the particle surface). Rationally designed peptides selectively and efficiently bind to a wide range of organic and inorganic materials, including metals, semiconductors, polymers and minerals

9,10

, and facilitate the particle surface modification with proteins

11

without disrupting

the protein functional activity. For example, peptides capable of binding to zeolites and SiO2 surfaces have been reported 9,10,12. To date, various reproducible protocols for synthesizing SiO2coated nanoparticles with on-demand control of their physical characteristics (size, porosity, ζpotential, fluorescence, magnetism, etc.) have been reported, focusing on biocompatible and bioinert nanoparticles 13. Therefore, a versatile biomodification platform of these particles using SiO2-binding peptides (SBPs) is highly demanded. The described approach is especially attractive since peptides can be genetically fused with many functional protein blocks, which mediate biological activity, thereby opening many opportunities for direct coupling of nanoparticles to biomolecules without additional steps of the surface modification, including cumbersome chemical conjugation. In this paper, we propose a protein adaptor system, Barnase and Barstar, as a “molecular glue” for the universal biomodification of nanoparticles with functional biomolecules via the peptide binding to solid SiO2 phase. Barnase, a bacterial ribonuclease of Bacillus amyloliquefaciens, and its natural inhibitor – Barstar are small proteins (12 and 10 kDa, respectively) that are characterized by extremely fast kinetics (kon ~ 108 M-1·c-1) and high binding affinities (Ka ~ 1014 M-1)

14

. Expression of fusion proteins of e.g. Barstar with a peptide binding to the surface of

silica particles and the use of its counterpart Barnase fused with a targeting or fluorescent biomolecule, affords rational design of nanoparticle-based complexes with controllable properties. This proposed biomodification platform has a number of important advantages: (i) it


4

Page 5 of 37 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


abolishes the chemical conjugation of nanoparticles with biomolecules, (ii) functional blocks are attached in an oriented manner to the surface of particles, (iii) the binding kinetics is very fast, and (iv) functional modules can be varied on demand, making this approach universal. To demonstrate the capabilities of the proposed method for nanoparticle biomodification, the selective labeling of different cells overexpressing the HER2/neu oncomarker with several nanoparticle types was carried out using different types of targeting molecules. These SiO2coated nanoparticles were coupled to a HER2/neu-specific protein using the SBP technology and the protein pair Barnase*Barstar, as schematically illustrated in Fig. 1.

Figure 1. A schematic diagram of the nanoparticle biomodification platform using SiO2-binding peptides and the Barnase*Barstar protein pair. (A) A SiO2-coated nanoparticle is surfacemodified by a fusion protein of SBP and Barstar, followed by its decoration with a fusion protein of Barnase with a targeting module. (B) The versatility of the proposed method capable of


5


Page 6 of 37

targeting different cancer cell receptor types (different colors) with different nanoparticle types (different colors and patterns) is artistically rendered. We used a Designed Ankyrin Repeat Protein (DARPin) scaffold as the HER2/neu recognition element

15

. DARPins are an emerging class of polypeptide recognition molecules of a non-

immunoglobulin origin that is commonly produced by the ribosome or phage display methods. Relatively small size of these proteins facilitates modular genetic-engineering design of large protein complexes with desired functionality. The cysteine-free structure of DARPins enables proper aggregation-free folding, and robust expression in bacterial hosts. DARPins are characterized by high affinity for receptors (down to picomolar concentrations)

16

in addition to

their excellent thermodynamic stability. Potential of the SBP + Barnase*Barstar method was demonstrated by coupling silica fluorescent and silica-coated magnetite nanoparticles with DARPin9.29 and selective labeling of HER2/neuoverexpressing cancer cells. The method application scope was extended to such complex biological fluids as whole blood. 2. Results 2.1. Design, purification and characterization of proteins DARPin was chosen as the targeting biomolecule capable for selective recognition of the extracellular subdomain I of HER2/neu receptor characterized by a dissociation constant KD = 3.8 nM, namely, DARPin9.29 15. The vector pET22(b+) was used for designing a genetic construct that encoded the fusion protein of DARPin9.29 and Barnase, yielding DARPin9.29-Bn (31.4 kDa). The nucleotide sequence


6

Page 7 of 37 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


encoding the gene of the targeting module with Barnase was mediated by the T7 promoter. These modules in the recombinant protein were linked via a flexible hydrophilic 16-amino acid linker, EFPKPSTPPGSSGGAP, from the hinge region of murine IgG immunoglobulin. The hinge allowed these two protein components to avoid steric hindrance and retained their functional properties. Since Barnase is a bacterial ribonuclease, its expression in prokaryotes is possible only with its inhibitor, i.e., Barstar. Thus, the Barstar gene was introduced in the plasmid under constitutive promoter control. The scheme of the described genetic construction is shown in Fig. 2A. As-synthesized plasmid pET22_DARPin9.29-Bn was used to express the fusion protein in E. coli [BL21(DE3) strain].

Figure 2. Recombinant protein characterization. (A) The genetic construction of the DARPin9.29-Bn protein. (B) The genetic construction of the SBP-Bs protein. (C) Enzymatic activity of Barnase and DARPin9.29-Bn fusion protein and inhibition of RNAse activity by SBPBs. The optical density, corresponding to the concentration of free mononucleotides and proportional to the RNAse activity (or inhibition of RNase activity) of the proteins, was measured at λ = 260 nm (OD260) and is presented in dependence from the concentrations of tested proteins. Error bars are SD (n = 3 for each data point). The functional modules in the fusion protein were characterized as follows. The dissociation constant of the complex from DARPin9.29-Bn and the extracellular domain of the HER2/neu


7


Page 8 of 37

receptor was measured by the surface plasmon resonance (SPR) method (using a BIAcore analyzer, GE Healthcare). To this end, the recombinant p185HER2-ECD antigen was immobilized on the surface of a CM-5 sensor chip with a density of 4100 resonance units. The dissociation constant was calculated to be 4.5 nM using the sensorgram data and BIAevaluation 4.1.1 software, and found slightly higher than that of pristine DARPin9.29 (3.8 nM 15). RNase activity retention in the fusion protein DARPin9.29-Bn was confirmed by detecting Barnase ribonuclease activity using acid-insoluble RNA precipitate method

17

. The RNase

activity of DARPin9.29-Bn was shown to be 68 ± 10% of that of the wild-type Barnase activity (Fig. 2C). Using the described procedure, we obtained a protein containing the targeting module capable to selectively recognize the extracellular domain of the HER2/neu receptor and Barnase, one of the Barnase*Barstar pair, for subsequent self-assembly of eukaryotic cell targeting nanostructures. Next, we obtained a bifunctional protein containing Barstar genetically fused to a polypeptide capable

of

SiO2

binding

–

SBP

[peptide

sequence

(VKTQATSREEPPRLPSKHRPG)4VKTQTAS] abbreviated as SBP-Bs. A schematic diagram of the genetic construction of SBP-Bs is shown in Fig. 2B. In analogy with DARPin9.29-Bn, the retention of the RNase inhibitor activity of the obtained fusion protein SBP-Bs is shown in Fig. 2C. The inhibition of RNase activity by SBP-Bs protein and hence its functionality was confirmed, thus making possible the use of proteinaceous Barnase*Barstar interface and peptide binding of the solid SiO2 phase for building a multifunctional nanoparticle-based complexes for targeted delivery.


8

Page 9 of 37 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


2.2. Nanostructure self-assembly for targeted delivery to cells The synthesized bifunctional proteins were used for demonstrating the effective biomodification of nanoparticles by using the SPB binding to SiO2-coated particle surfaces. To this aim, commercially available 30-nm SiO2-coated fluorescent nanoparticles were used – SFNPs (Sicastar®-redF 30 nm, Micromod, Germany). The excitation and emission spectra of SFNPs are presented in Fig. 3A. These nanoparticles were modified with targeting molecules DARPin9.29 via the peptide binding to SFNPs via Barnase*Barstar interface, as demonstrated in Fig. 1A. Particles were sequentially incubated with SBP-Bs and DARPin9.29-Bn with washing procedures, followed by every incubation step. Fig. 3B demonstrates the colloidal stability of nanoparticles processed as described above and measured by a dynamic light scattering system (DLS, Zetasizer Nano, Malvern, UK). The colloidal stability was also confirmed by visual inspection. Fig. 3B shows that the mean hydrodynamic particle diameter changed insignificantly as a result of the addition of DARPin9.29-Bn in the absence of the second component of the system (SBP-Bs) and was increased by 2 – 15 nm after incubation with SBP-Bs, followed by DARPin9.29-Bn (Table 1). As-obtained nanocomplexes were used for the selective visualization of cells overexpressing HER2/neu receptor. To this aim, we chose a human breast adenocarcinoma cell line SK-BR-3 (~106 HER2/neu molecules/cell) and Chinese hamster ovary cell line CHO deprived of any EGFR receptors. Firstly, HER2/neu expression was confirmed by labeling these cells with the established FITC-conjugated anti-HER2/neu antibody known as Trastuzumab broadly used in clinical procedures. FITC-conjugated polyclonal human IgG was used as a control for the interaction specificity (see Fig. 3C).


9


Page 10 of 37

Figure 3. Specific HER2/neu-positive cell targeting using silica fluorescent nanoparticles (SFNPs) via SBP-Bs*DARPin9.29-Bn interface. (A) Fluorescence excitation and emission spectra of SFNPs. (B) Hydrodynamic particle size distribution by intensity of pristine SFNPs and nanocomplexes acquired using the dynamic light scattering technique. (C) HER2/neu overexpression on the surface of SK-BR-3 cells confirmed by fluorescence microscopy. Top


10

Page 11 of 37 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


panels – bright-field images of SK-BR-3 (HER2/neu-positive) and CHO (HER2/neu-negative) cells, bottom panels – fluorescence images of cells stained with Trastuzumab-FITC. The cell staining with Human IgG-FITC was used as a negative control. Scale bars – 25 µm. (D) Normalized flow cytometry histograms confirming the specific labeling of SK-BR-3 cells with DARPin9.29-Bn-FITC. Excitation laser – 488 nm, emission filter – 530/30 nm. (E) Fluorescence microscopy images confirming the specific labeling of SK-BR-3 cells with SFNP*SBPBs*DARPin9.29-Bn. Top panels – bright-field images of SK-BR-3 cells, bottom panels – fluorescence images of cells stained with SFNPs (excitation – 545/30 nm, emission – 610/75 nm). Scale bars – 75 µm. (F) SFNPs and nanocomplexes quantity bound with SK-BR-3 and CHO cells. Error bars are SD (n = 3 for each data point). (G) Normalized flow cytometry histograms showing specific labeling of SK-BR-3 with SFNP*SBP-Bs*DARPin9.29-Bn. Excitation laser – 561 nm, emission filter – 615/20 nm. Table 1. Mean hydrodynamic diameters (̅ ) and polydispersity index (PDI) of silica fluorescence nanoparticles (SFNP) and nanocomplexes. Nanocomplex SFNP SFNP + DARPin9.29-Bn SFNP*SBP-Bs SFNP*SBP*DARPin9.29-Bn SMNP SMNP + DARPin9.29-Bn SMNP*SBP-Bs SMNP*SBP-Bs*DARPin9.29-Bn

(nm) 35 38 53 55 89 94 114 123

PDI (nm) 14 14 23 24 33 34 47 49


11


Page 12 of 37

Next, we confirmed the selectivity of the binding of DARPin9.29-Bn to HER2/neu on the SKBR-3 cell surface by conjugating DARPin9.29-Bn with FITC, labeling cells with DARPin9.29Bn-FITC and running a flow-cytometry assay (Fig. 3D). SK-BR-3 cells were labeled with nanocomplexes SFNP*SPB-Bs*DARPin9.29-Bn and analyzed using fluorescence microcopy. As it is shown in Fig. 3E, only SFNP*SPB-Bs*DARPin9.29-Bn were immobilized predominantly and selectively on HER/neu-positive SK-BR-3 cells, while the other (negative control) SFNP nanocomplexes displaying negligible labeling. In order to quantify the binding specificity, fluorescence spectroscopy and flow cytometry methods were employed. The cells labeled with SFNP*DARPin9.29-Bn*SBP-Bs were placed into wells of a 96-well plate with equal cell densities, the fluorescence signals were measured by a microplate reader and calibrated according to the known number of SFNP allowing to quantify SFNP bound to cells (Fig. 3F). The interaction selectivity was confirmed by the data presented in Fig. 3F, corresponding to the quantity of SFNP and nanocomplexes in bulk cell samples. The results of the flow cytometry measurements corresponding to individual cell fluorescence are presented in Fig. 3G, and strongly support the high specificity of SFNP*DARPin9.29-Bn*SBP-Bs to HER2/neu-positive cells. 2.3. Versatility of the proposed nanoparticle surface bioengineering method The proposed method of coupling biomolecules to silica-coated nanoparticles via SBP + Barnase*Barstar proteinaceous interface appeared universal in terms of the nanoparticle type. To demonstrate this universality, we synthesized several nanoparticle types, including core/shell magnetic nanoparticles (SMNPs) of the respective structure Fe3O4/SiO2 (see Materials and Methods, section 5.17 for details of the synthesis). As-synthesized nanoparticles were imaged by


12

Page 13 of 37 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


using transmission electron microscopy (JEM-2100, JEOL Ltd.), using an accelerating voltage of 200 kV (Fig. 4A), followed by their morphological analysis, showing their predominantly spheroidal shape with a mean diameter and standard deviation of 78 ± 19 nm (Fig. 4B).

Figure 4. (A) A bright-field transmission electron microscopy (TEM) image of core/shell silica magnetic nanoparticles (SMNPs) deposited on a lacey carbon film grid. (B) SMNP size distribution obtained from TEM imaging and image analysis. (C) Hydrodynamic particle size distribution of SMNP and nanocomplexes (SMNP*SBP-Bs, SMNP*SBP-Bs*DARPin9.29-Bn and mixture of SMNP and DARPin9.29-Bn denoted as “SMNP + DARPin9.29-Bn”) acquired by


13


Page 14 of 37

DLS. (D) Bar plots of the binding efficiency of the fluorescently labeled SBP-Bs (SBP-Bs-FITC) and DARPin9.29-Bn (DARPin9.29-Bn-DyLight650) to SMNP particles measured by fluorescence spectroscopy and presented in terms of the bound protein per 1 mg of SMNP particles. Excitation/emission wavelengths of 492/516 and 657/672 nm were used for SBP-BsFITC and DARPin9.29-Bn-DyLight650, respectively. Measurements were performed after RT and 1 h at +50 °C of SMNP*SBP-Bs-FITC*DARPin9.29-Bn-DyLight650 incubation. Error bars are SD (n = 3 for each data point). (E) Histograms of the binding efficiency of SMNPs, CMNPs and their nanocomplexes to SK-BR-3 and CHO cells measured by MPQ-cytometry and presented in terms of femtograms of bound nanocomplexes per cell. Error bars are SD (n = 3 for each data point). (F) Confocal microscopy images of cells stained with SMNP*SBPBs*DARPin9.29-Bn-DyLight650 nanocomplexes. At +4 °C nanocomplexes are presented on the cell membrane, and after 1h of +37 °C incubation nanocomplexes internalized into cells. Top panel, merge of bright field and fluorescence images, bottom panel – confocal fluorescence images. Excitation laser – 640 nm, emission filter – 647LP nm. SFNPs and nanocomplexes quantity bound with SK-BR-3 and CHO cells. Error bars are SD (n = 3 for each data point). (G) Flow cytometry data showing the retention of the specificity of the interaction of SFNP*SBPBs*DARPin9.29-Bn with HER2/neu on the cell surface in whole blood. Histograms corresponding to blood cells mixed with SK-BR-3 or CHO cells (with a fixed blood cell number and different SK-BR-3 and CHO cell numbers) and labeled with the SFNP*SBPBs*DARPin9.29-Bn structures. Excitation laser – 561 nm, emission filter – 615/20 nm.

As-synthesized nanoparticles were modified by a targeting molecule DARPin9.29 using SBP + Barnase*Barstar pair and employing a biomodification protocol as described above. The


14

Page 15 of 37 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


resultant nanocomplexes SMNP-SBP-Bs*DARPin9.29-Bn exhibited excellent colloidal stability confirmed by DLS (Fig. 4C), with no visual signs of aggregation and sedimentation. Fig. 4C shows an increase of the mean hydrodynamic diameter of SMNP*SBP-Bs and SMNP*SBPBs*DARPin9.29-Bn by 9 and 20 nm, respectively, in comparison with that of pristine SMNP. At the same time, an addition of DARPin9.29-Bn to pristine SMNPs resulted in no significant. In order to quantify components of the proposed system bound to the investigated nanoparticle, we performed fluorescent labeling of these components. More specifically, SBP-Bs was labeled with fluorescein isothiocyanate (to produce a fluorescently labeled SBP-Bs-FITC) and DARPin9.29-Bn was labeled with DyLight650 (to produce a fluorescently labeled DARPin9.29Bn-DyLight650). Excitation and emission spectra of these compounds were recorded, and peak excitation and emission wavelengths were determined to be: 492/516 nm for SBP-Bs-FITC and 657/672 nm for DARPin9.29-Bn-DyLight650 in phosphate buffered saline. These proteins were sequentially incubated with SMNP, while the respective control experiments were also carried out.

Next,

fluorescent

signals

of

as-produced

nanocomplexes

SMNP*SBP-Bs-

FITC*DARPin9.29-Bn-DyLight650 were acquired at wavelengths corresponding to the fluorescence emission band of FITC and DyLight650. Using the calibration curve corresponding to the known quantity of the fluorescent proteins SBP-Bs-FITC and DARPin9.29-BnDyLight650, the quantity of proteins bound to SMNP was calculated and presented in terms of ng protein per 1 mg of SMNP and the results are presented in Fig. 4D. It was shown that 230 ± 4 ng of SBP-Bs-FITC and 9.2 ± 1.0 ng of DARPin9.29-Bn-DyLight650 was bound per 1 mg of SMNP. From the point of view of biological applications of synthesized complexes (such as, for example, tumour hyperthermia, when tissues are heated up to 41-47 °C

18

due to relaxation


15


Page 16 of 37

processes of magnetic nanoparticles), it is interesting to investigate their stability upon heating. To this end, we measured quantity of SMNP-bound proteins after 1-h heating at 50 °C and triple washing from the potentially dissociated components. However, it was shown (see Fig. 4D) that SBP-Bs-FITC and DARPin9.29-Bn-DyLight650 did not dissociate from the surface of nanoparticle after such treatment. The labeling selectivity of SMNPs and bioengineered nanocomplexes was investigated using HER2/neu positive and negative cells, as described in Materials and Methods (Section 5.14), with the results presented in Fig. 4. The number of cell-bound nanoparticles per cell was measured by a MPQ-cytometry method (Magnetic Particle Quantification based cytometry) reported by us 19 and is presented in terms of femtograms per cell. As it is shown in Fig. 4E, only fully assembled nanocomplexes SMNP*SBP-Bs*DARPin9.29-Bn were selectively bound to HER2/neu-positive SK-BR-3 cells. In order to trace the fate of nanoparticles after cell binding, we performed a confocal microscopy imaging of cell labeled with fluorescent nanocomplexes SMNP*SBP-Bs*DARPin9.29-Bn-DyLight650 (the fluorescence is due to DyLight650 in the protein DARPin9.29-Bn). We showed that immediately after incubation of the nanocomplexes with SK-BR-3 cell at +4 °C, they were selectively present on the HER/2neu positive cell membrane (see Fig. 4F, left panel) and after 1 h at +37 °C incubation, the nanocomplexes were internalized into cells (see Fig. 4F, middle panel). The process of the internalization was most likely due to receptor-mediated endocytosis (we have previously shown

20 21 22 23 24

that

DARPin9.29-based molecules and nanoparticles internalized into the cell via receptor-mediated endocytosis). Therefore, the proposed system of the nanoparticle modification can be successfully used for design of both visualizing and therapeutic agents, when drugs must be delivered directly into the cell.


16

Page 17 of 37 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Moreover, we demonstrated that the proposed surface bioengineering method was superior over the

state-of-the-art

bioconjugation

carbodiimide

chemistry,

employing

1-ethyl-3-(3-

dimethylaminopropyl) carbodiimide (EDC) and N-hydroxysulfosuccinimide (sulfo-NHS) as the crosslinking agents. To this aim, we synthesized superparamagnetic iron oxide nanoparticles coated with carboxymethyl-dextran (CMNPs) to obtain nanoparticles with –COOH surface groups available for protein binding. The mean hydrodynamic diameter of CMNPs was 105 ± 31 nm and appeared similar to that of SMNPs. DARPin9.29 was conjugated to CMNPs, and the number of cell-bound conjugates (CMNP–DARPin9.29) per cell was determined by MPQcytometry

19

and presented in Fig. 4E. At the same time, a full-size IgG antibody Trastuzumab

recognizing extracellular domain of HER2/neu receptor was used to benchmark the selectivity of its

CMNP-coupled

derivative

to

the

tested

CMNP–DARPin9.29

and

SMNP*SBP-

Bs*DARPin9.29-Bn. CMNPs were covalently conjugated with Trastuzumab antibodies by using the EDC/sulfo-NHS protocol to yield CMNP*Trastuzumab. The quantity of CMNP– Trastuzumab nanocomplexes bound per cell is also presented in Fig. 4E. Whereas the nanoparticles conjugated with a sufficiently large protein – Trastuzumab (150 kDa) – selectively interact with the target, direct carbodiimide conjugation of nanoparticles with a small protein, e.g., DARPin9.29 (16 kDa), leads to virtually complete loss of the functional activity of the conjugated molecule. We also demonstrated that the specificity of assembled nanocomplexes was preserved in a more complex biological fluid, such as whole blood. For this purpose, heparinized mouse whole blood was mixed with SK-BR-3 and CHO cells in different proportions with a fixed number of blood cells. These samples were incubated with assembled fluorescent SFNP*DARPin9.29-Bn*SBPBs nanocomplexes and assayed using the flow cytometry. Fig. 4G shows the histograms


17


Page 18 of 37

corresponding to the fluorescence of as-obtained samples in a channel matching the emission of the nanoparticles. The second peak of the histogram corresponding to the cells stained with nanoparticles can be observed only for the samples with HER2/neu+ cells (SK-BR-3), and the peak height is shown to be proportional to the cell number. Next, in order to demonstrate the versatility of the proposed method of coupling biomolecules to silica-coated nanoparticles via SBP + Barnase*Barstar proteinaceous interface in terms of the targeting molecules as well as targeting strategies, we demonstrated several additional schemes of nanoparticle targeted delivery to HER2/neu-positive cells, as shown in Fig. 5.

Figure 5. The versatility of the method of coupling biomolecules to silica-coated nanoparticles via SBP + Barnase*Barstar proteinaceous interface. Specific HER2/neu-positive cell targeting using silica magnetic nanoparticles (SMNPs) was realized in “one-step” mode (top panel) and “two-step” mode (bottom panel). HER2/neu specific binding was achieved through three different targeting molecules fused with Barnase: DARPin9.29-Bn-Bn (left), 4D5-Bn-4D5 (middle), 4D5-Bn-Bn (right). Histograms of the binding efficiency of SMNPs and their nanocomplexes to SK-BR-3 (HER2/neu positive), BT-474 (HER2/neu positive) and CHO


18

Page 19 of 37 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


(HER2/neu negative) cells measured by MPQ-cytometry and presented in terms of femtograms of the bound nanocomplexes per cell. Error bars are SD (n = 3 for each data point). For this purpose, we synthesized three other HER2/neu-specific proteins genetically fused with Barnase, namely: DARPin9.29 fused with two molecules of Barnase (DARPin9.29-Bn-Bn), scFv mini-antibody 4D5 fused with two molecules of Barnase (4D5-Bn-Bn), and two molecules of scFv mini-antibody 4D5 fused with Barnase (4D5-Bn-4D5). We previously showed that a miniantibody of scFv format (single chain variable fragments) 4D5 was capable of highly specific HER2/neu binding to the surface of cancer cells14 and was effective for versatile nanoparticle targeted delivery25,26. Targeted nanoparticles based on these recognizing molecules (DARPin9.29-Bn-Bn, 4D5-Bn-Bn, 4D5-Bn-4D5) were obtained using a protocol, as described above for SMNP*SBP-Bs*DARPin9.29-Bn complexes. However, we performed not only “onestep” targeting when fully assembled complex (e.g., SMNP*SBP-Bs*4D5-Bn-Bn) let binding to cells, but also “two-step” targeting, when cells were pre-incubated with specific protein (e.g., 4D5-Bn-Bn), followed by SMNP*SBP-Bs complex addition to cells. Moreover, one more HER2/neu overexpressing cancer cell line, namely, ductal carcinoma BT-474, was used for this experiment in order to demonstrate the versatility of the proposed method in terms of target cells. The quantity of cell-bound SMNP was determined by MPQ-cytometry. As it is shown in Fig. 5, only fully assembled nanocomplexes SMNP*SBP-Bs*DARPin9.29-Bn-Bn, SMNP*SBPBs*4D5-Bn-Bn and SMNP*SBP-Bs*4D5-Bn-4D5 were selectively bound to HER2/neu-positive cells, namely SK-BR-3 and BT-474, in contrast to a negative control, including CHO cell line, regardless of whether this was a pre-assembly of nanoparticles (a top panel of Fig. 5) or a twostep assembly on the surface of the cells (the bottom panel of Fig. 5). However, in all cases, the


19


Page 20 of 37

two-step delivery seems to be more efficient in comparison with the one-step delivery in terms of the number of nanocomplexes specifically associated with cells. 3. Discussion It has been recently recognized that surface engineering of nanomaterials endows them with new chemical identities, which can be converted to desirable multifunctional biological property by a process of biomodification. For example, the targeting properties are often realized by decorating the nanoparticle surface with different targeting moieties: antibodies, aptamers, folic acid, etc., using chemical conjugation by e.g. EDC/sulfo-NHS as a preferred option. However, the direct chemical conjugation method has the following serious drawbacks. (i) Functional surface moieties must be present and sterically accessible for the chemical conjugation to occur correctly. For example, EDC/sulfo-NHS method requires the nanoparticle surface decoration with –COOH groups. (ii) Most existing bioconjugation methods allow poor control over the orientation of biomolecules being coupled to the nanoparticle surface. (iii) Low-molecularweight molecules bioconjugated to a nanoparticle suffer from steric hindrance during the target recognition. (iv) Partial denaturation of bioconjugated proteins via several functional groups (for example, by several ε-amino groups of lysines) can occur, leading to partial or complete loss of the functional activity. (v) The problem of the preferential conjugation of only one of the components from several components being conjugated can occur because of the different physico-chemical properties of the components (like pI, protein globularity, size of molecules, hydrophobicity/hydrophilicity, etc.). (vi) The multi-step chemical conjugation process is cumbersome and time-consuming (oftentimes, taking up to several hours). (vii) The loss of the colloidal stability can occur at intermediate stages of the bioconjugation because of changing of the nanoparticle surface charge. There is an urgent need for developing new approaches for


20

Page 21 of 37 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


efficient, selective and rapid attachment of biomolecules with the appropriate orientation to the surface of nanoparticles. The proposed approach based on silica-binding peptide combined with Barnase*Barstar allows coupling biomolecules to nanoparticles within several minutes maintaining control over the number and ratio of biomolecules to be attached while retaining their orientation and activity. We demonstrated the method capability to preserve the activity of small proteins attached to nanoparticles, whereas the state-of-the-art EDC/sulfo-NHS method failed, leading to complete loss of the protein functional activity. The use of proteinaceous Barnase*Barstar appeared to be essential. Firstly, unlike silica-binding peptide alone characterized by high positive charge

27

, SBP-Bs renders the nanoparticle surface

stable in aqueous buffers and biological fluids, such as serum and whole blood, thus reinstating the value of SBP technology. Barnase and Barstar proteins are small, hydrophilic and do not significantly alter the architecture of the designed structures. Moreover, these proteins are not expressed in mammals, in contrast to e.g. Streptavidin*Biotin pair widely used for bioconjugation: endogenous biotin can compete for binding sites in different in vivo systems 28. Furthermore, we have previously performed a detailed study regarding the stability of the structures obtained via self-assembly using the proteinaceous Barnase*Barstar interface, showing that such structures exhibit unique stability under extreme conditions (such as 8 M GdmHCl, 8 M Urea, 5 M NaCl, or pH 2). Thus, this type of chemical bond is not inferior to covalent bonds in terms of strength 29. The versatility of the proposed surface bioengineering approach was tested on fluorescent and magnetic nanoparticles coupled to two types of HER2/neu-specific biomolecules (DARPin9.29


21


Page 22 of 37

and 4D5 mini-antibody) and targeted delivery of self-assembled nanocomplexes to HER2/neupositive cells in one-step or two-step modes. HER2/neu is a member of the EGFR family and is overexpressed in 20-30% cases of breast cancers, however, this receptor is much less expressed in many types of healthy human cells

19

. So, precise quantification of HER2/neu receptors on

cancer cells is clinically important, relying on rapid, accurate and high-throughput in vitro and in vivo assaying techniques. An emerging class of DARPin protein scaffolds, in particular, DARPin9.29 proved to offer efficient HER2/neu targeting means15. These molecules are usually obtained by screening libraries of ankyrin repeat proteins using ribosomal or phage display technologies. The DARPin structure includes a varied number of ankyrin repeats (usually, 4 – 6) forming a recognition domain. One ankyrin repeat usually consists from 33 amino acids that form a β-turn and two antiparallel α-helices. Because of their parallel orientation to each other, ankyrin repeats form a right-wound solenoid with a hydrophobic core and a hydrophilic surface accessible to the solvent. These proteins exhibit high stability, good water solubility, and size ~10-fold smaller than that of immunoglobulins (14-20 kDa vs 150 kDa). They are characterized by facile biotechnological production in prokaryotic expression systems. These properties classify DARPins as a promising alternative to full-size and mini-antibodies for targeted drug delivery 30. 4. Conclusion We report a facile, versatile method of nanoparticle surface engineering based on a silica-binding peptide (SBP) and protein adaptor system Barnase*Barstar. Coupling of a target protein to nanomaterial of choice is realized by coating the nanomaterial with SiO2, fusing the protein with Barnase by a genetic engineering procedure, and mixing nanomaterial-SiO2 with SBP-Bs and


22

Page 23 of 37 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Bn-protein.

The

procedure

yields

a

nanomaterial-SiO2*SBP-Bs*Bn-protein

hybrid

nanocomplexes owing to the strong affinities of SiO2*SBP and Barnase*Barstar pairs. The introduced bioengineering platform is rapid (minutes-scale), preserves the protein functionality and orientation, and enables excellent control over the number and ratio of attached molecules. Capabilities of the proposed method were demonstrated by coupling fluorescent silica and silicacoated magnetite nanoparticles with HER2/neu oncomarker recognizing protein (DARPin9.29) and selective immunotargeting of HER2/neu-positive cancer cells. Unlike the state-of-the-art EDC/sulfo-NHS method, the proposed method retained the targeting functionality DARPin9.29modified nanoparticles even in such complex biological fluid as whole blood. 5. Materials and Methods 5.1. Plasmid pET22_DARPin9.29-Bn construction. The gene encoding DARPin9.29 was obtained

with

PCR

using

the

following

primers:

DARP9.29_Nde:

5’-

tattccatatggacctgggtaagaaactg, with the site of cleavage by the restriction enzyme NdeI and DARP9.29_EcoR: 5’-cgccgaattcttgcaggatttcagccag, with the site of cleavage by the restriction enzyme EcoRI. As the matrix DARPin9.29 was used

15

. PCR-product and plasmid pET22(b+)

were restricted by NdeI and EcoRI, and DNA fragments were isolated from agarose gel and ligated. The correctness of the obtained plasmid pET22_DARPin9.29 was confirmed by restriction mapping and sequencing. The gene encoding Barnase was isolated from plasmid pSD_4D5-Bn-His by the restriction enzyme EcoRI and partial restriction with HindIII. Plasmid pET22_DARPin9.29 was also digested by the restriction enzymes EcoRI and HindIII. DNA fragments were isolated from agarose gel and ligated. The correctness of the obtained plasmid pET22_DARPin9.29-Bn was confirmed by restriction mapping. In the obtained construction, the


23


Page 24 of 37

gene encoding the DARPin9.29-Bn protein is under the control of the strong T7 RNA polymerase promoter and the lac-operator. 5.2. DARPin9.29-Bn expression and purification. For the expression of the recombinant protein DARPin9.29-Bn, competent E. coli cells (strain BL21(DE3)) were transformed with plasmid pET22_DARPin9.29-Bn. Cells were cultivated in LB medium (with 100 µg/mL ampicillin) with vigorous stirring at 37 °С until the optical density had reached OD = 0.8 and inducted with 1 mM IPTG. After induction, the cells were grown for 10 h at 37 °С. Next, the cells were cooled to 4 °С and centrifuged at 6000 g for 10 min. The cell pellet was resuspended in buffer I (5 mM Tris-HCl, 40 mM K2HPO4, 500 mM NaCl, pH 8.0), cells were disrupted in an ice bath using an ultrasonic disintegrator. The cell debris was removed through centrifugation at 50000 g for 60 min. The supernatant was adjusted to pH 8.0 and then was filtered through a 0.22 µm membrane. The filtrate was applied to a Ni2+–NTA column (GE Healthcare). For DARPin9.29-Bn*Bs complex dissociation and protein of interest expression, the column was washed with 6 M GdmHCl (in buffer I). The protein was renatured with a smooth gradient of GdmHCl from 6 М to 0 М (in buffer I), the column was washed with buffer I supplemented with 15 mM imidazole and 0.2% Triton X-100, and the protein was eluted by buffer I with 250 mM imidazole. Next, the protein was applied to a Q-sepharose column (GE Healthcare) in buffer II (5 mM Tris-HCl, 40 mM K2HPO4, pH 7.5) with 50 mM NaCl, the column was washed with buffer II with 50 mM NaCl, and the protein was eluted from the column by buffer II with a NaCl gradient from 50 mM to 250 mM. 5.3. Plasmid pET22_SBP-Bs-His construction. The SBP was attached to the N-terminus of Barstar via a small flexible hinge region (EFPKPSTPPGSSGGAP) 14 to prevent any obstruction


24

Page 25 of 37 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


of the binding functions of both the SBP and Barstar. To achieve this, the gene encoding Barstar (with an N-terminal hinge region and C-terminal His-tag) was designed and synthesized with flanking restriction sites (BamHI and HindIII) for in-frame ligation to the 5’ end of the SBP gene contained within the plasmid pET22_NtermSBP, resulting in the expression plasmid pET22_SBP-Bs-His. Gene synthesis was carried out by GeneArt (Life Technologies). E. coli αSelect (Bioline) cells were used as a propagation host for general gene cloning. All DNA preparations, manipulations and digestions were performed according to 31. 5.4. SBP-Bs expression and purification. For the expression of SBP-Bs, E. coli (BL21 (DE3)) cells were transfected with the plasmid pET22_SBP-Bs-His. Cells were grown in LB medium (with 50 mg/mL carbenicillin) and incubated at 37 °С with shaking until the OD was within 0.71.0. The incubation temperature was then reduced to 27 °С, and protein synthesis was induced by the addition of 0.4 mM IPTG. After a further 16 h of cultivation, the cells were harvested by centrifugation at 10000 g for 30 min at 4 °C. The His-tagged SBP-Bs was then extracted and purified by Ni-NTA affinity chromatography. Briefly, cells were resuspended in ice-cold lysis buffer (50 mM Na-phosphate, pH 7, 300 mM NaCl) supplemented with 1 mg/mL lysozyme and sonicated on ice. Cellular debris was then removed by centrifugation for 30 min at 10000 g at 4 °C. The resulting supernatant was filtered through a 0.22 µm membrane and loaded onto a NiNTA agarose column (Qiagen) and washed with lysis buffer. Purified SBP-Bs was eluted from the column using elution buffer (50 mM Na2HPO4, 500 mM imidazole, 300 mM NaCl, pH 7), and then dialyzed (molecular weight cut-off: 3 kDa) against PBS (pH 7.4) for 24 h at 4 °C. 5.5. 4D5-Bn-4D5, 4D5-Bn-Bn and DARPin9.29-Bn-Bn expression and purification.


25


Page 26 of 37

HER2/neu binding proteins 4D5-Bn-4D5 and 4D5-Bn-Bn was isolated and purified as described in detail by us previously14. DARPin9.29-Bn-Bn was cloned into pET22 plasmid similarly to that of 4D5-Bn-Bn gene and expressed in E. coli cells (strain BL21(DE3)) followed with purification using Ni-NTA agarose column (Qiagen). 5.6. KD-determination by surface plasmon resonance (SPR). The dissociation constant (KD) was determined by SPR with a BIAcore analyzer instrument (GE Healthcare, USA). CM-5 sensor chips were coated with 1300 resonance units of p185HER-2-ECD recombinant antigen. DARPin9.29-Bn at concentrations of 10, 20, 30 nM was injected in a final volume of 30 µl on the chips. The dissociation rate constant was calculated from the sensorgram using BIAevaluation 4.1.1 software (GE Healthcare, USA). 5.7. RNAse activity test. Protein solution in 40 µl buffer III (0.125 M Tris-HCl, pH 8.5) was mixed with 160 µl of yeast RNA at 2 g/L and incubated at 37 °C for 15 min. The RNAse reaction was stopped by adding 200 µl of 6% HClO3 and incubating at +2 °C for 15 min. The undigested RNA was separated by centrifugation at 16000 g for 10 min at +2 °C. The optical density corresponding to the concentration of free mononucleotides was measured at λ = 260 nm (OD260). According to 17, this value is proportional to the RNAse activity of the tested protein. The inhibition of RNase activity by SBP-Bs was determined in a similar manner: SBP-Bs at different concentrations was preincubated with Barnase (to get a final concentration of Barnase 250 nM) and the enzymatic activity of the mixtures was measured as described above 5.8. Particle assembly. SiO2-coated nanoparticles (100 µg) were incubated with 3 µg of SBP-Bs in Tris buffer (10 mM Tris, 150 mM NaCl, pH 7) for 10 min at room temperature. Then, the nanoparticles were washed to remove unbound protein by triple centrifugation for 3 min at 3000


26

Page 27 of 37 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


g in PBS (137 mM NaCl, 2.7 mM KCl, 4.77 mM Na2HPO4·2H2O, 1.7 mM KH2PO4, pH 7.4) with 1% Tween-20. Next, the nanoparticles were incubated with DARPin9.29-Bn (or DARPin9.29-Bn-Bn, 4D5-Bn-4D5, 4D5-Bn-Bn) at a concentration of 10 µg/ml in PBS with 1% BSA for 10 min, separated from unbound protein by double centrifugation for 3 min at 3000 g in PBS with 1% Tween-20 and finally resuspended in PBS with 1% BSA. 5.9. Dynamic light scattering (DLS) measurements. The hydrodynamic sizes of the nanoparticles and nanocomplexes were determined using a Zetasizer Nano ZS (Malvern Instruments Ltd, UK) analyzer in Tris buffer (10 mM Tris, 150 mM NaCl, pH 7.0) at 25 °C. All measurements were performed in triplicate. 5.10. Cell lines and incubation conditions. The human breast adenocarcinoma SK-BR-3 (HTB30™; ATCC), ductal carcinoma BT-474 BT-474 (HTB-20™; ATCC) and Chinese hamster ovary CHO cell lines (Russian Cell Culture Collection) were maintained in RPMI-1640 medium (HyClone) supplemented with 10% fetal calf serum (HyClone) and 2 mМ L-glutamine (PanEko). Cells were incubated in a humidified atmosphere with 5% CO2 at 37 °C. 5.11. FITC conjugation. FITC-labeled proteins were prepared as described previously

19

with

following modifications: 100x, 50x and 10x molar excess of FITC molecules was used for preparing FITC-labeled antibodies (Trastuzumab and polyclonal Human IgG), DARPin9.29-Bn and SBP-Bs, respectively. 5.12. DyLight650 conjugation. DyLight650-labeled DARPin9.29-Bn was prepared by the rapid mixing of 50 µl of 2 g/L protein in PBS with 5 µl of 7 g/L DyLight650 NHS ester in DMSO and subsequent dialysis with Zeba Spin Desalting columns, 7k MWCO.


27


Page 28 of 37

5.13. Fluorescence and confocal microscopy. To evaluate the antibody labeling, cells were stained with FITC-labeled antibodies at a concentration of 2 µg/mL in PBS with 1% BSA for 30 min and analyzed using a protocol reported by us 19 for labeling with nanoparticles. For SFNPs visualization, cell suspensions were labeled by nanocomplexes as described above, washed three times with PBS with 1% BSA and dropped onto the surface of a microscope glass. The cells were analyzed with a Leica DMI6000B epifluorescence microscope (Leica Microsystems, Germany) in a fluorescence channel with 545/30 nm excitation and 610/75 nm emission filter cube. For SMNPs visualization by confocal microscopy, cells were seeded using the same procedure as that of the fluorescence microcopy, and stained with DyLight650-labeled SMNPs in PBS with 1% BSA for 30 min at 4 °C and analyzed with Leica DMI6000B (Leica Microsystems, Germany) microscope equipped with Confocal Microscopy Upgrade (Thorlabs, USA), with an excitation laser at a wavelength of 641 nm and emission filter 647LP. 5.14. Cell labeling. Cells harvested from a culture dish (by 2 mM EDTA solution without using trypsin to prevent enzymatic receptor cleavage) were washed with PBS, resuspended in PBS with 1% BSA at a concentration of 106 cells/ml and incubated with nanocomplexes for 10 min at a concentration of 37.5 µg/mL for the fluorescent particles and 100 µg/mL for magnetic particles. 5.15. Fluorescence spectroscopy. The cell suspensions were labeled with nanocomplexes as described above, washed three times with PBS with 1% BSA, placed into the wells of 96-well flat-bottomed transparent Costar plates at a density of 106 cells per well and allowed to sediment.


28

Page 29 of 37 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Next, samples were examined, as described by us

19

using the excitation/emission wavelengths:

560/580 nm, respectively. 5.16. Flow cytometry. To determine DARPin9.29-Bn specificity, the harvested cells were washed twice with PBS, resuspended in 500 µL of PBS with 1% BSA at a concentration of 106 cells per mL, labeled with DARPin9.29-Bn-FITC at 2 µg/mL, washed and analyzed similarly to a procedure of the antibodies labeling as described in

19

, using Accuri C6 flow cytometer (BD,

USA). To determine the activity of SFNP*SBP-Bs*DARPin9.29-Bn in whole blood, 50 µl of fresh heparinized mouse blood was mixed with SK-BR-3 or CHO cells (ranging from 300*103 to 38*103 cells per sample), labeled with SFNP*SBP-Bs*DARPin9.29-Bn for 10 min and subjected to a lysis procedure. Next, the samples were analyzed with a Novocyte cytometer (Acea, USA). The data were analyzed using CFlow Plus, Novoexpress and FlowJo software. 5.17. SiO2-coated magnetic nanoparticle (SMNP) synthesis. First, superparamagnetic iron oxide nanoparticles were synthesized by the precipitation of iron (II) and iron (III) chloride under alkaline conditions. The nanoparticles (5 mg) were peptized by HNO3, washed with water and mixed with 50 g/L of sodium citrate at 80 °C. After 10 min, the nanoparticles were removed by magnetic separation and added to 10 ml of ethanol in a sonication bath. After 10 min, 500 µL of water and 800 µL of tetraethyl orthosilicate were added while sonicating, and after another 10 min, 30% ammonium hydroxide was added as a catalyst to promote the condensation reaction. Then, the nanoparticles were mixed at a room temperature for a day and finally were separated from the reagents in MilliQ water by magnetic separation.


29


Page 30 of 37

5.18. MPQ-cytometry. The cell suspensions were labeled by modified nanoparticles as described above, washed three times with PBS with 1% BSA, resuspended in 30 µl of PBS, and analyzed with MPQ-reader 19. 5.19. Carboxymethyl-dextran-coated iron oxide nanoparticle (CMNP) synthesis. CMNPs were synthesized according to our previously reported procedure 19. 5.20. CMNP conjugation. Proteins were covalently coupled to CMNPs using the carbodiimide chemistry, as reported elsewhere 19. 5.21. Blood lysis procedure. Heparinized blood samples mixed with tested cells (SK-BR-3 or CHO) were mixed with 400 µl of erythrocyte lysis buffer (150 mM NH4Cl, 0.1 mM Na2EDTA, 10 mM NaHCO3, pH 7.3) and incubated for 10 min at room temperature. Then, the samples were centrifuged for 10 min at 100 g and +4 °C. The supernatant was discarded, and the erythrocyte lysis procedure was repeated. Finally, the cells were resuspended in 100 µl PBS with 1% BSA and analyzed with flow cytometry.


30

Page 31 of 37 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


AUTHOR INFORMATION Corresponding Authors 1

Victoria O. Shipunova

16/10 Miklukho–Maklaya Street, Moscow, 117997, Russia e-mail: [email protected] 2

Andrey V. Zvyagin

Sydney, New South Wales, 2109, Australia e-mail: [email protected] Author Contributions The manuscript was written through contributions of all authors. All authors have given approval to the final version of the manuscript. VS, SD and AZ designed the study; VS, AC, AS performed the experiments; all authors analyzed data; VS, AZ and SD wrote the manuscript. Funding Sources The work was supported by the Russian Science Foundation grant (project No. 17-74-20146). ACKNOWLEDGMENT Authors acknowledge support from the MEPhI Academic Excellence Project (Contract No. 02.a03.21.0005). Authors acknowledge support from the IBCH сore facility. Experiments were partially carried out using equipment provided by the IBCH сore facility (CKP IBCH, supported by Russian Ministry of Education and Science, grant RFMEFI62117X0018). ABBREVIATIONS Bn, Barnase; Bs, Barstar; BSA, bovine serum albumin; CMNP, carboxymethyl-dextran coated superparamagnetic iron oxide nanoparticle; DARPin, Designed Ankyrin Repeat Protein; EDC, 1-


31


ethyl-3-(3-dimethylaminopropyl)carbodiimide;

EGFR,

human

Page 32 of 37

epidermal

growth

factor

receptors; FITC, fluorescein isothiocyanate; HER2/neu, human epidermal growth factor receptor 2; MPQ, Magnetic Particle Quantification; PBS, phosphate buffered saline; SBP, SiO2-binding peptide; scFv, single chain variable fragments; SMNP SiO2-coated magnetic nanoparticle; SFNP, SiO2-coated fluorescent nanoparticle; sulfo-NHS, N-hydroxysulfosuccinimide.

References (1) Kakkar, A.; Traverso, G.; Farokhzad, O. C.; Weissleder, R.; Langer, R. Evolution of Macromolecular Complexity in Drug Delivery Systems. Nat. Rev. Chem. 2017, 1 (8), 63. (2) Nikitin, M. P.; Shipunova, V. O.; Deyev, S. M.; Nikitin, P. I. Biocomputing Based on Particle Disassembly. Nat. Nanotech. 2014, 9 (9), 716–722. (3) Khaydukov, E. V.; Mironova, K. E.; Semchishen, V. A.; Generalova, A. N.; Nechaev, A. V.; Khochenkov, D. A.; Stepanova, E. V.; Lebedev, O. I.; Zvyagin, A. V.; Deyev, S. M.; Panchenko, V. Y. Riboflavin Photoactivation by Upconversion Nanoparticles for Cancer Treatment. Scientific Reports 2016, 6, 35103. (4) Grebenik, E. A.; Kostyuk, A. B.; Deyev, S. M. Upconversion Nanoparticles and Their Hybrid Assemblies for Biomedical Applications. Russ. Chem. Rev. 2016, 85 (12), 1277–1296. (5) Torchilin, V. P. Multifunctional, Stimuli-Sensitive Nanoparticulate Systems for Drug Delivery. Nature reviews. Drug Discovery 2014, 13 (11), 813–827. (6) Jong, W. H. de; Borm, P. J. A. Drug Delivery And Nanoparticles:Applications And Hazards. Int. J. Nanomedicine 2008, 3 (2), 133–149.


32

Page 33 of 37 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


(7) Algar, W. R.; Prasuhn, D. E.; Stewart, M. H.; Jennings, T. L.; Blanco-Canosa, J. B.; Dawson, P. E.; Medintz, I. L. The Controlled Display of Biomolecules on Nanoparticles: a Challenge Suited to Bioorthogonal Chemistry. Bioconjugate Chemistry 2011, 22 (5), 825–858. (8) Cannon, J. G. Bioconjugate Techniques by Greg T. Hermanson. Academic Press, San Diego, CA. 1996. J. Med. Chem. 1997, 40 (4), 631. (9) Sarikaya, M.; Tamerler, C.; Jen, A. K.-Y.; Schulten, K.; Baneyx, F. Molecular Biomimetics: Nanotechnology through Biology. Nat. Mat. 2003, 2 (9), 577–585. (10) Seker, U. O. S.; Demir, H. V. Material Binding Peptides for Nanotechnology. Molecules (Basel, Switzerland) 2011, 16 (2), 1426–1451. (11) Sengupta, A.; Thai, C. K.; Sastry, M. S. R.; Matthaei, J. F.; Schwartz, D. T.; Davis, E. J.; Baneyx, F. A Genetic Approach for Controlling the Binding and Orientation of Proteins on Nanoparticles. Langmuir : the ACS journal of surfaces and colloids 2008, 24 (5), 2000–2008. (12) Care, A.; Bergquist, P. L.; Sunna, A. Solid-Binding Peptides: Smart Tools for Nanobiotechnology. Trends Biotechnol. 2015, 33 (5), 259–268. (13) Bharti, C.; Gulati, N.; Nagaich, U.; Pal, A. Mesoporous Silica Nanoparticles in Target Drug Delivery System: A Review. Int. J. Pharma Investig. 2015, 5 (3), 124-133. (14) Deyev, S. M.; Waibel, R.; Lebedenko, E. N.; Schubiger, A. P.; Pluckthun, A. Design of Multivalent Complexes Using the Barnase*Barstar Module. Nat. Biotech. 2003, 21 (12), 1486– 1492. (15) Steiner, D.; Forrer, P.; Plückthun, A. Efficient Selection of Darpins with Sub-Nanomolar Affinities Using SRP Phage Display. J. Mol. Biol. 2008, 382 (5), 1211–1227.


33


Page 34 of 37

(16) Boersma, Y. L.; Plückthun, A. Darpins and Other Repeat Protein Scaffolds: Advances in Engineering and Applications. Curr. Opin. Biotechnol. 2011, 22 (6), 849–857. (17) Rushizky, G. W.; Greco, A. E.; Hartley, R. W.; Sober, H. A. Studies on B. Subtilis Ribonuclease. I. Characterization of Enzymatic Specificity. Biochemistry 1963, 2 (4), 787–793. (18) Cole, A. J.; Yang, V. C.; David, A. E. Cancer Theranostics: The Rise of Targeted Magnetic Nanoparticles. Trends Biotechnol. 2011, 29 (7), 323–332. (19) Shipunova, V. O.; Nikitin, M. P.; Nikitin, P. I.; Deyev, S. M. MPQ-Cytometry: A Magnetism-Based Method for Quantification of Nanoparticle-Cell Interactions. Nanoscale 2016, 8 (25), 12764–12772. (20) Deyev, S.; Proshkina, G.; Ryabova, A.; Tavanti, F.; Menziani, M. C.; Eidelshtein, G.; Avishai, G.; Kotlyar, A. Synthesis, Characterization, and Selective Delivery of Darpin–Gold Nanoparticle Conjugates to Cancer Cells. Bioconjugate Chem. 2017, 28 (10), 2569–2574. (21) Mironova, K. E.; Chernykh, O. N.; Ryabova, A. V.; Stremovskiy, O. A.; Proshkina, G. M.; Deyev, S. M. Highly Specific Hybrid Protein Darpin-MCherry for Fluorescent Visualization of Cells Overexpressing Tumor Marker HER2/Neu. Biochemistry Moscow 2014, 79 (12), 1391– 1396. (22) Proshkina, G. M.; Shilova, O. N.; Ryabova, A. V.; Stremovskiy, O. A.; Deyev, S. M. A New Anticancer Toxin Based on HER2/Neu-Specific Darpin and Photoactive Flavoprotein Minisog. Biochimie 2015, 118, 116–122. (23) Sokolova, E.; Proshkina, G.; Kutova, O.; Shilova, O.; Ryabova, A.; Schulga, A.; Stremovskiy, O.; Zdobnova, T.; Balalaeva, I.; Deyev, S. Recombinant Targeted Toxin Based on


34

Page 35 of 37 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


HER2-Specific Darpin Possesses a Strong Selective Cytotoxic Effect in Vitro and a Potent Antitumor Activity in Vivo. J. Control. Release 2016, 233, 48–56. (24) Proshkina, G. M.; Kiseleva, D. V.; Shilova, O. N.; Ryabova, A. V.; Shramova, E. I.; Stremovskiy, O. A.; Deyev, S. M. Bifunctional Toxin DARP-Lope Based on the Her2-Specific Innovative Module of a Non-Immunoglobulin Scaffold as a Promising Agent for Theranostics. Mol. Biol. 2017, 51 (6), 865–873. (25) Shipunova, V. O.; Nikitin, M. P.; Mironova, K. E.; Deyev, S. M.; Nikitin, P. I. Complexes of Magnetic Nanoparticles and Scfv Antibodies for Targeting and Visualizing Cancer Cells. In 2015 IEEE 15th International Conference on Nanotechnology (IEEE-NANO); 13–16. (26) Nikitin, M. P.; Zdobnova, T. A.; Lukash, S. V.; Stremovskiy, O. A.; Deyev, S. M. ProteinAssisted Self-Assembly of Multifunctional Nanoparticles. PNAS 2010, 107 (13), 5827–5832. (27) Sunna, A.; Chi, F.; Bergquist, P. L. A Linker Peptide with High Affinity Towards SilicaContaining Materials. New Biotechnology 2013, 30 (5), 485–492. (28) Sreenivasan, Varun K. A.; Kelf, T. A.; Grebenik, E. A.; Stremovskiy, O. A.; Say, J. M.; Rabeau, J. R.; Zvyagin, A. V.; Deyev, S. M. A Modular Design of Low-Background Bioassays Based on a High-Affinity Molecular Pair Barstar:Barnase. Proteomics 2013, 13 (9), 1437–1443. (29) Aghayeva, U. F.; Nikitin, M. P.; Lukash, S. V.; Deyev, S. M. Denaturation-Resistant Bifunctional Colloidal Superstructures Assembled via the Proteinaceous Barnase-Barstar Interface. ACS Nano 2013, 7 (2), 950–961.


35


Page 36 of 37

(30) Deyev, S. M.; Lebedenko, E. N.; Petrovskaya, L. E.; Dolgikh, D. A.; Gabibov, A. G.; Kirpichnikov, M. P. Man-Made Antibodies and Immunoconjugates with Desired Properties: Function Optimization Using Structural Engineering. Russ. Chem. Rev. 2015, 84 (1), 1–26. (31) Sambrook, J.; Russell, D. W. Molecular Cloning: A Laboratory Manual, 3rd ed.; Cold Spring Harbor Laboratory Press: Cold Spring Harbor,N.Y., 2001.


36

Page 37 of 37 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


TOC picture 35x15mm (300 x 300 DPI)


A versatile platform for nanoparticle surface bioengineering based on

Recommend Documents