Accelerated Bone Regeneration by Nitrogen-Doped Carbon Dots

Subscriber access provided by Stockholm University Library

Biological and Medical Applications of Materials and Interfaces

Accelerated Bone Regeneration by Nitrogen-doped Carbon Dots Functionalized with Hydroxyapatite Nanoparticles Deepak Kumar Khajuria, Vijay Bhooshan Kumar, Dana Gigi, Aharon Gedanken, and David Karasik ACS Appl. Mater. Interfaces, Just Accepted Manuscript • DOI: 10.1021/acsami.8b02792 • Publication Date (Web): 21 May 2018 Downloaded from http://pubs.acs.org on May 21, 2018

Just Accepted “Just Accepted” manuscripts have been peer-reviewed and accepted for publication. They are posted online prior to technical editing, formatting for publication and author proofing. The American Chemical Society provides “Just Accepted” as a service to the research community to expedite the dissemination of scientific material as soon as possible after acceptance. “Just Accepted” manuscripts appear in full in PDF format accompanied by an HTML abstract. “Just Accepted” manuscripts have been fully peer reviewed, but should not be considered the official version of record. They are citable by the Digital Object Identifier (DOI®). “Just Accepted” is an optional service offered to authors. Therefore, the “Just Accepted” Web site may not include all articles that will be published in the journal. After a manuscript is technically edited and formatted, it will be removed from the “Just Accepted” Web site and published as an ASAP article. Note that technical editing may introduce minor changes to the manuscript text and/or graphics which could affect content, and all legal disclaimers and ethical guidelines that apply to the journal pertain. ACS cannot be held responsible for errors or consequences arising from the use of information contained in these “Just Accepted” manuscripts.

is published by the American Chemical Society. 1155 Sixteenth Street N.W., Washington, DC 20036 Published by American Chemical Society. Copyright © American Chemical Society. However, no copyright claim is made to original U.S. Government works, or works produced by employees of any Commonwealth realm Crown government in the course of their duties.

Page 1 of 34 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

ACS Applied Materials & Interfaces

Accelerated

Bone

Regeneration

by

Nitrogen-doped

Carbon

Dots

Functionalized with Hydroxyapatite Nanoparticles Deepak Kumar Khajuria, (1) #*, Vijay Bhooshan Kumar (2) #, Dana Gigi, (1) Aharon Gedanken (2), David Karasik (1,3)* #

V.B.K and D. K.K have contributed equally to this work

(1) The Musculoskeletal Genetics Laboratory, The Azrieli Faculty of Medicine, Bar-Ilan University, Safed-1311502, Israel (2) Bar-Ilan Institute for Nanotechnology and Advanced Materials, Department of Chemistry, Bar-Ilan University, Ramat Gan-5290002, Israel (3) Institute for Aging Research, Hebrew Senior Life, and Harvard Medical School, Boston, MA 02131, USA. *Contact information: [email protected], [email protected], [email protected], [email protected]

*Corresponding authors: [email protected], [email protected]

ACS Paragon Plus Environment

ACS Applied Materials & Interfaces 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

ABSTRACT: We investigated the osteogenic potential of nitrogen doped carbon dots (NCDs) conjugated with hydroxyapatite (HA) nanoparticles on the MC3T3-E1 osteoblast cell functions and in a zebrafish (ZF) jaw bone regeneration (JBR) model. The NCDs-HA nanoparticles were fabricated by hydrothermal cum co-precipitation technique. The surface structures of NCDs-HA nanoparticles were characterized by XRD, FTIR, UV-Vis, and laser fluorescent spectroscopy, SEM, TEM, EDS, and NMR analysis. The TEM data confirmed that the NCDs are well conjugated on the HA nanoparticle surfaces. The fluorescent spectroscopy results indicated that the NCDs-HA exhibited promising luminescent emission in-vitro. Finally, we validated the chemical structure of NCDs-HA nanoparticles on the basis of FTIR, EDS and 31P NMR analysis and observed that NCDs are bound with HA by electrostatic interaction and H-bonding. Cell proliferation assay, alkaline phosphatase and Alizarin red staining were used to confirm the effect of NCDs-HA nanoparticles on MC3T3-E1 osteoblast proliferation, differentiation and mineralization, respectively. Reverse transcriptase polymerase chain reaction (RT-PCR) was used to measure the expression of the osteogenic genes like runt-related transcription factor 2, alkaline phosphatase, and osteocalcin. ZF-JBR model was used to confirm the effect of NCDsHA nanoparticles on bone regeneration. NCDs-HA nanoparticles demonstrated cell imaging ability, enhanced alkaline phosphatase activity, mineralization and expression of the osteogenic genes in osteoblast cells indicating possible theranostic function. Further, NCDs-HA nanoparticles significantly enhanced ZF bone regeneration and mineral density as compared to HA nanoparticles indicating a therapeutic potential of NCDs-HA nanoparticles in bone regeneration and fracture healing. KEYWORDS: hydroxyapatite; nitrogen doped carbon dots; nanoparticles; osteoblast cells; bone regeneration


Page 2 of 34

Page 3 of 34 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


INTRODUCTION Enormous research efforts have been focused on human bone regeneration.1–4 Hence, there is growing interest in the application of osteoconductive,osteoinductive, and osteogenic nanomaterials in order to significantly improve bone repair and regeneration.5 Recently, carbon based materials are emerged as a new area of research that show enormous potential for significant impact on biomaterials and medical engineering. Carbon derivatives like carbon dots (CDs), carbon nanotubes and graphene, are shown to augment stem cell differentiation.6–9 More recently, Shao et al., demonstrated that CDs promote osteogenic differentiation in rat bone marrow mesenchymal stem cells by upregulating the expression of osteoblast gene markers such as runt-related transcription factor 2 (RUNX2), alkaline phosphatase (ALP), osteocalcin (OCN), and bone sialoprotein (BSP) and by augmenting matrix mineralization.10 These results indicate that CDs may play a promising role in bone formation and regeneration. Study conducted by Hu et al, showed that nitrogen doped CDs (NCDs) are high performance CDs, which hold immense potential for biosensing, bioimaging, and theranostics.11 On the other hand, hydroxyapatite (HA, Ca10(PO4)6(OH)2) is one of the most popular biomaterials used in many biomedical applications. The organic part of human bone matrix is formed by collagen and other proteins.12 HA has outstanding biocompatibility, high porosity, high osteoconductivity, good cell adhesiveness and excellent biodegradability. 13 It has been reported that particle size, morphology, and crystal structure of synthetic HA particles can affect the biological response when introduced to osteoblast cells.14 Nano-sized synthetic HA particles closely resemble the HA crystals in human bone.15 Due to their resemblance to the inorganic component of bones and teeth, synthetic HA nanoparticles have demonstrated therapeutic effect when used as a functional scaffold for bone tissue engineering and implant material for bone



repair, bone tissue regeneration (osteogenesis) and dental applications.16–19 However, HA is not able to entirely meet the needs of regenerative medicine approaches for bone repair.20 Therefore, it is perilously important to design a first-rate HA with enhanced osteogenic properties for bone regeneration approaches. With this in mind, we developed multifunctional NCDs-HA nanoparticles with outstanding photoluminescence, biocompatibility and enhanced osteogenic properties for bone regeneration approaches. So far only limited attempts have been reported for the modification of HA nanomaterials with CDs.21 In this study, firstly we synthesized the NCDs from the bovine serum albumin (BSA) aqueous solution by hydrothermal reaction and secondly, we funtionalized NCDs with HA nanoparticles by one step co-precipitation method. We then evaluated the cell imaging ability as well as the osteogenic efficacy of NCDs-HA nanoparticles on the proliferation, differentiation, and mineralization of murine osteoblast cell line MC3T3-E1 in-vitro, while in parallel testing the bone regeneration ability of NCDs-HA nanoparticles in a zebrafish (ZF) jaw bone regeneration model in-vivo. Our results revealed that NCDs-HA nanoparticles enhanced the osteogenic differentiation in osteoblast cells and bone regeneration in ZF jaw bone regeneration model, which suggested that NCDs-HA nanoparticles could have a promising therapeutic role as bone regenerative medicine for the treatment of bone defects. RESULTS AND DISCUSSION Physical and chemical characterization of NCDs-HA nanoparticles. The schematic illustration for the synthetic route of NCDs-HA nanoparticles is shown in Scheme 1. Three compositions of NCDs-HA nanoparticles (containing 1%, 2% and 5% NCDs) were prepared using NCDs as the stabilizer. As shown in Figure S1, under normal light the aqueous solution as well as the dried HA nanoparticles are white in colour, NCDs are pale yellow in


Page 4 of 34

Page 5 of 34 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


colour, and NCDs-HA nanoparticles are creamish in colour, whereas under UV light (365 nm) a whitish blue emission is observed for NCDs and NCDs-HA nanoparticles. These results indicate that the synthesized NCDs-HA nanoparticles were highly fluorescent.

Scheme 1. Schematic illustration of the synthetic route of NCDs-HA nanoparticles and possible binding mechanism of NCDs with HA nanoparticles. As shown in Figure 1, the fluorescence spectra for HA, NCDs, and NCDs-HA nanoparticles were recorded at different excitation wavelengths (330, 350, 370, 390, 410, 430, 450, 470, and 490 nm) and emission was observed in the range of 440-610 nm. Figure 1(a) shows the typical22 fluorescence spectra obtained from the NCDs, revealing that NCDs are highly fluorescent. HA nanoparticles showed no fluorescence (Figure 1(b)) whereas NCDs-HA nanoparticles containing 1% (Fig. 1c), 2% (Fig. S2 in the ESM) and 5% (Figure 1(d)) NCDs showed fluorescence slightly lower than pristine NCDs. The reduction of the fluorescence intensity is an indirect evidence for the deposition of NCDs on HA nanoparticles. The fluorescence intensity of NCDs-HA nanoparticles increased with the increase in the % deposition of NCDs on HA nanoparticles, as



indicated by higher fluorescence intensity of 5% NCDs-HA nanoparticles as compared to 1% or 2% NCDs-HA nanoparticles. Therefore, for further cellular studies we selected high fluorescent NCDs-HA (5% NCDs on HA) nanoparticles.

Figure 1. Fluorescence and UV/VIS spectroscopy of the NCDs-HA nanoparticles. The fluorescence spectra of (a) NCDs, (b) HA, (c) 1% NCDs-HA, and (d) 5% NCDs-HA with sample images taken under day light and UV-light, (e) UV/Vis absorption spectra of water, NCDs in


Page 6 of 34

Page 7 of 34 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


water, NCDs-HA in water, HA in water, and (f) UV/Vis absoption spectra of NCDs-HA with different percentage (1%, 2% and 5%) of NCDs. The successful decoration of the NCDs-HA nanoparticles was also demonstrated by the UV/Vis absorption spectra and FTIR spectra. The UV/Vis absorption spectra of the HA, NCDs, and NCDs-HA nanoparticles is shown in Figure 1(e). NCDs-HA nanoparticles showed two clear absorption peaks at approximately 286 and at 355 nm which indicates the presence of NCDs

22

on HA nanoparticles. Further, different compositions of NCDs-HA nanoparticles showed almost similar absorption peaks which indicates the deposition of NCDs on HA nanoparticles (Figure 1(f)). The FTIR spectra for the HA, NCDs, and NCDs-HA nanoparticles are shown in Figure 2(a). The prominent peaks of pure HA nanoparticles were observed at 890-1180 cm-1 and 490610 cm-1 and are related to the internal vibrations of the phosphate (PO4) group. This vibration of tetrahedral PO4 is assigned to as symmetric stretch, bending mode, and anti-symmetric stretching vibrations. The bands at 3550 and 3643 cm-1 are attributed to the stretching of OH groups vibration in Ca(OH)2. This peak may be due to the excess Ca2+ ions on the sample that binds with OH- ion from water or due to the CaO produced from the decomposition of CaNO3. The less intense bands at 1626 and 3429 cm-1 are related to the adsorbed H2O molecules.13 For the NCDs spectrum, there is strong band from –COOH groups at 1722 cm−1 and –CH groups at 3200–3300 cm−1 (Figure 2(a)). The FTIR spectra for three compositions of NCDs-HA nanoparticles (containing 1%, 2% and 5% NCDs) is depicted in Figure 2(b). In the FTIR spectra of NCDs-HA nanoparticles, –COOH groups disappeared and –COO– groups (1555 cm−1) appeared, and the intensity of –CH groups becomes weak.23 These results indicates that all – COOH groups and few –CH groups on NCDs reacted with the HA nanoparticles to form NCDsHA hybrid nanoparticles. The presence of –COO– groups gives overt evidence to confirm this



reaction. No significant differences were observed in the FTIR spectra of NCDs-HA (containing 1%, 2% and 5% NCDs) nanoparticles.

Figure 2. Characterization of NCDs-HA nanoparticles by FTIR and NMR Spectroscopy. FTIR spectroscopy analysis for (a) HA, NCDs and NCDs-HA, (b) different amount of NCDs deposition on HA nanoparticles. (c) 31P NMR spectra of HA, and NCDs-HA with different %, (d) is the magnification of 31P NMR from (c), (e) Solid state 31P NMR spectra of HA, and NCDsHA, and (f) scheme of possible chemical interaction of NCDs with HA nanoparticles.


Page 8 of 34

Page 9 of 34 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Further, the HA and NCDs-HA nanoparticles were analyzed by 31P NMR. The pure HA showed two intense peaks at 0 ppm and -12 ppm (Figure 2(c,d)). The 0 ppm peak corresponds to the presence of phosphorous in the form of phosphate,24 and peak at -12 ppm corresponds to phosphorous atom having rich electron cloud on the surface of HA nanoparticles. In case of NCDs-HA nanoparticles, the peak intensity at -12 ppm is decreased, which indicates a strong electrostatic interaction between NCDs and HA nanoparticles and formation of hydrogen bond between NCDs and HA nanoparticles (Figure 2(f)). The same information was obtained by solid state NMR (Fig. 2e). Further, we observed no additional peak in 31P NMR spectra of NCDs-HA nanoparticles, which provides evidence that there were no impurities present in the sample of NCDs-HA nanoparticles. The crystal structures of HA and NCDs-HA nanoparticles was determined by XRD and presented in Figure 3 (i,j). XRD pattern of pure HA nanoparticles showed the peaks at 2θ =12.76, 22.83, 25.66 and 35.05 ± 0.2°, characteristic of HA.25 The XRD pattern of NCDs-HA nanoparticles showed a good correlation with the XRD pattern of stoichiometric HA (JCPDS 09-0432 card).13 There was a small shift of the XRD pattern of the product to higher angles, probably due to slight reduction of d-spacing because of the deposition of NCDs on HA nanoparticles. Further, we observed that the diffraction peaks of NCDs-HA nanoparticles were similar to the HA nanoparticles, which indicates that deposition of NCDs caused no change in the crystalline structure of HA nanoparticles.14,

36

No additional peaks were observed in the XRD spectra of

NCDs-HA nanoparticles (containing 1%, 2% and 5% NCDs), most likely because detection of such small percentages of NCDs is not possible within the sensitivity limit of XRD. The shape of the most intense broad peak reflects the ordered packing of the NCDs-HA nanoparticle. In addition, after calcination at 350 °C for 4 h the diffraction peaks of HA and NCDs-HA



Page 10 of 34

nanoparticles (containing 1%, 2% and 5% NCDs) became more intense indicating the excellent crystalline quality of HA as well as NCDs-HA nanoparticles (Figure 3 (j)).

Figure 3. Characterization of NCDs-HA nanoparticles by SEM, TEM and XRD studies. SEM image showing the surface morphology of (a) HA, (b) 1% NCDs-HA, (c) 2% NCDs-HA, (d) 5% NCDs-HA. TEM images showing (e) pure HA, (f) 1% NCDs on HA, (g) 2% NCDs on HA, (h) 5% NCDs on HA. (i) XRD pattern of pure HA, NCDs-HA (containing 1%, 2% and 5% NCDs) without calcination and (j) after heat treatment at 350 °C for 4 h. The TEM images of NCDs show, a narrow size distribution of the monodispersed particles with an average size of ~3-8 nm (Figure S3) which is in reasonable agreement with our previous study.26 The morphology of HA and NCDs-HA nanoparticles was analyzed by electron microscopy (SEM and TEM) and is depicted in Figure 3 (a-h). The shape of the pure HA


Page 11 of 34 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


nanoparticles are of irregular polygons (Figure 3 (a, f)). SEM images of NCDs-HA (containing 1%, 2% and 5% NCDs) successfully yielded uniform nanosized particles with a size of ~85 nm in width and 100–200 nm in length (Figure 3 (b-d)), whereas HA particles were larger in size with respect to NCDs-HA nanoparticles (Figure 3 (a)). Similar trend was observed in TEM images, Figure 3 (f-h) shows uniform and well-dispersed NCDs-HA nanoparticles (containing 1%, 2% and 5% NCDs) whereas pure HA nanoparticles shown in Figure 3 (e) are coagulated and irregular or spherical in shape. Further, TEM image of NCDs-HA clearly showed the deposition of NCDs on HA nanoparticles (Figure 3 (f-h)). The EDS analysis of HA nanoparticles showed the presence of calcium, phosphate, and oxygen, whereas NCDs-HA nanoparticles showed the presence of calcium, phosphate, oxygen, carbon, and nitrogen elements which further confirms the presence of NCDs in NCDs-HA nanoparticles (Figure S4). Further, the fluorescence spectra of NCDs-HA nanoparticles was collected at various pH conditions (Figure S5). NCDs-HA nanoparticles were found to be photo stable over a wide range of pH (3.0 - 10.5). Cell proliferation assay. In order to evaluate the osteoblast cell proliferation capability of HA and NCDs-HA nanoparticles, we performed cell proliferation assay by using IncuCyte Live-Cell Imaging System. As shown in Figure 4 (a-b), there was no obvious difference between the MC3T3-E1 osteoblast cells samples after culturing with HA and 5% NCDs-HA nanoparticles for one day. However, after three days of cell culture with different concentrations of HA and 5% NCDs-HA (10, 20, 30, 40, 50, and 100 μg∙mL−1) nanoparticles there were differences in proliferation of the cells. The nanoparticles dosages used in our study were selected from previous studies on CDs conjugated with nanohydroxyapatite.21 HA and NCDs-HA (30, 40 and 50 μg∙mL−1) nanoparticles significantly stimulated the most rapid cell proliferation as compared to the



control. Thus, osteoblast cells cultured with 30, 40, and 50 μg∙mL−1 of HA nanoparticles showed a significantly higher confluency percentage as compared to the confluency percentage of control cells (p < 0.0001). Likewise, the osteoblast cells cultured with 30, 40, and 50 μg∙mL−1 of 5% NCDs-HA nanoparticles showed a confluency percentage which was significantly higher than the confluency percentage of control cells (p < 0.0001). However, cells cultured with concentrations of 100 μg∙mL−1 of HA and 5% NCDs-HA nanoparticles showed pronounced cell proliferation inhibition. These results indicate that NCDs-HA nanoparticles have high cytocompatibility to osteoblast cells. This is consistent with the previous reports on colloidal semiconductor quantum dots/HA nanocomposites in MC3T3-E1 osteoblast cells27. NCDs-HA nanoparticles promote osteoblast differentiation. We examined the effect of our HA and NCDs-HA nanoparticles on osteoblast differentiation using MC3T3-E1 osteoblast cells (Figure 4 (c-e)). To assess the ability of HA and NCDs-HA nanoparticles to promote osteoblast differentiation, ALP activity was determined by measuring the staining intensity and size of the stained area. The results from the ALP staining assay demonstrated that both HA as well as NCDs-HA nanoparticles significantly induced ALP activity (Figure 4(f)). Mineralization analysis. Calcium accumulation in the extracellular matrix is a phenotypic marker of the final stages of osteoblast differentiation.28 Therefore, to examine whether our HA and NCDs-HA nanoparticles promote calcium accumulation, MC3T3-E1 osteoblast cells treated with HA and NCDs-HA nanoparticles at dose of 30 μg∙mL−1 were subjected to Alizarin red S staining assays. Calcium accumulation in cells cultured for 21 days in the presence of HA and NCDs-HA nanoparticles is shown in Figure 4 (g-i). Calcium deposition was significantly increased by the HA and NCDs-HA nanoparticles treatment at dose of 30 μg∙mL−1. It is also noteworthy to mention that calcium accumulation in osteoblast cells treated with NCDs-HA was


Page 12 of 34

Page 13 of 34 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


significantly higher than the HA treated osteoblast cells (p< 0.001) (Figure 4(j)). We speculate that in addition to HA, mild calcium accumulating activity can also be attributed to presence of NCDs.

Figure 4. Effects of NCDs-HA and HA nanoparticles on MC3T3-E1 osteoblast cell proliferation, differentiation and mineralization. In-vitro cell proliferation assay of MC3T3-E1 osteoblast cells incubated with (a) 5% NCDs-HA and (b) HA nanoparticles at different concentrations (10, 20, 30, 40, 50, and 100 μg∙ml−1) for 72 h. (c-f) Confirmation of osteogenic differentiation by alkaline phosphatase (ALP) staining. (c) Control group; (d) HA group; (e) NCDs-HA group; scale bar (c-e) = 2 mm; (f) ALP activity in MC3T3-E1 cells treated with NCDs-HA and HA nanoparticles (30μg∙ml−1). (g-i) Determination of calcium accumulation using Alizarin red staining in cells cultured for 21 days with NCDs-HA and HA nanoparticles (30 μg∙ml−1). (g) Control group; (h) HA group; (i) NCDs-HA group; scale bar (g-i) = 500 µm; (j) Osteoblast mineralization with NCDs-HA and HA nanoparticles (30μg∙ml−1). Data are shown as the mean ± SD, evaluated by one-way ANOVA followed by Tukey’s multiple comparisons test. *p < 0.05; **p < 0.01; ***p < 0.001, compared to control group; bp< 0.001 compared to HA group.



Gene expression. Previously, a small number of studies have reported the effects of colloidal semiconductor quantum dots-HA composite nanoparticles and CDs-HA nanohybrid on osteoblast proliferation and ALP activity in MC3T3-E1 and MG-63 osteoblast cell lines, respectively.27,29 However, the effects of NCDs-HA nanoparticles on osteoblast cell differentiation, mineralization as well as the detailed mechanisms involved in these processes are not well understood. Therefore, in order to explore the regulation mechanism of NCDs-HA nanoparticles on MC3T3-E1 osteoblast cell differentiation, we examined mRNA expression of RUNX2, ALP and OCN using RT-PCR. Osteogenesis related genes such as RUNX2, ALP and OCN are well-known to be specifically required for osteoblast differentiation.30 RUNX2 is the main regulator of osteogenic gene expression and osteoblast differentiation.31 ALP is considered to play a significant part in processes leading to mineral formation in bone tissues. The expression level of OCN, which is a non-collagenous component of the bone extracellular matrix, can suggest the degree of bone extracellular matrix mineralization,32 which is an indication of osteoblast differentiation. As shown in Figure 5, our results indicate that there was significantly higher expression in osteoblast cells of RUNX2, ALP and OCN after treatment with 30 μg∙mL−1 NCDs-HA nanoparticles as compared to control. However, there was no significant difference between HA (30 μg∙mL−1) and NCDs-HA nanoparticles treated osteoblast cells, even though the expression level of OCN and RUNX2 was higher in NCDs-HA nanoparticles treated osteoblast cells as compared to HA treated osteoblast cells. In view of these findings, we surmise that RUNX2 induced ALP at early time followed by expression of OCN and mineralization.33 Combined with our Alizarin staining results, these results suggest that higher expression of OCN in NCDs-HA nanoparticles treated osteoblast cells stimulates more mineralization in the culture.


Page 14 of 34

Page 15 of 34 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Figure 5. Effect of treatment by NCDs-HA and HA nanoparticles on osteoblastogenesis-related gene expression. MC3T3-E1 osteoblast cells were exposed for 96 h to 50 μg∙mL−1 NCDs-HA and HA nanoparticles in MC3T3-E1 osteoblast cell induction conditions. (a) ALP, (b) OCN, and (c) RUNX2 mRNAs were analyzed. Data are shown as the mean ± SD, evaluated by one-way ANOVA followed by Tukey’s multiple comparison test. *p < 0.05; **p < 0.01; ***p < 0.001, compared to control group. NCDs-HA nanoparticles can serve as a luminesence platform for cell imaging. We demonstrated previously the long-lasting fluorescence effect of NCDs when applied for imaging of human osteosarcoma cells34 and developmental zebrafish model.35 It is noteworthy to mention that several functional groups (C=O, NH2, COOH, OH, etc) are present on the edge of the NCDs. It is believed that the quenching of fluorescence of NCDs is due to damage to these functional groups in the solution.23,36 Based on the excellent green emission of NCDs under 488 nm excitation,37 the NCDs-HA nanoparticles were used for the bio-imaging of MC3T3-E1 osteoblast cells. After culturing osteoblast cells with 30 μg∙mL−1 of HA and NCDs-HA nanoparticles for 24 h, phase contrast, bright field and fluorescence images of osteoblast cells obtained by Leica



DMI6000 B inverted fluorescent microscope are shown in Figure 6. These figures show the phase contrast as well as bright field images of osteoblast cells after being cultured with HA (Figure 6 (A-A3, B-B3)) and NCDs-HA (Figure 6(C-C3, D-D3), Figure S6) nanoparticles and show the typical morphology of osteoblast cells. Figure 6 (C1 and D1) shows the fluorescent images under 488 nm excitation light, and most of NCDs-HA nanoparticles appear endocytosed by osteoblast cells, which made the morphology of the cells clearly visualized by fluorescence microscopy. The merged images (Figure 7(C3) and (D3)) clearly confirm that the bright luminescence was localized in the cytosol region rather than merely staining the osteoblast cell membrane surface. The areas of osteoblast cells from which the strong fluorescence was emitted reflected the presence of NCDs-HA nanoparticles, which were present in the cell membrane, cytoplasm and around the cell nucleus. Notably, no morphological damage to the osteoblast cells was observed even after co-incubation for 48 h (data not shown). Therefore, these results indicate that the NCDs-HA nanoparticles can serve as luminescence nanoplatforms for long-term targeted biological therapy or drug delivery. There is a growing interest in "theranostic" nanoparticles which can be used in various therapeutic applications and also as biological probes in diagnostics.38 HA nanoparticles lack fluorescence properties, which makes it impossible for the researchers to track the location of these nanoparticles in cells or tissues during cell imaging, drug targeting and delivery applications in-vitro23. However, reports suggest that nanoparticles due to their small size exhibit strong interactions with normal human cells. Chemically modified nanoparticles with various bioconjugate moieties are used for selective diagnosis and treatment.39 In this study, the surface chemistry of HA nanoparticles was modified by us through NCDs bearing discrete functional groups (C=O, NH2, COOH, OH), which provided fluorescence to HA nanoparticles as well as


Page 16 of 34

Page 17 of 34 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


enhanced osteogenesis by modulating osteoblast cell proliferation, differentiation and mineralization. This "theranostic" property of NCDs-HA nanoparticles may trigger future breakthroughs in the field of bone research.

Figure 6. Microscopic images of MC3T3-E1 osteoblast cells after HA and NCDs-HA nanoparticles treatment. (A-A3) The phase contrast and fluorescence images, (B-B3) bright field and fluorescence images merged with the corresponding fluorescence images of osteoblast cells incubated with 30 μg∙mL−1 of HA nanoparticles. (C-C3) The phase contrast and fluorescence images, (D-D3) bright field and fluorescence images merged with the corresponding fluorescence images of MC3T3-E1 cells incubated with 30 μg∙mL−1 of NCDs-HA nanoparticles. Scale bar, (A-A3, C-C3) = 100 μm; (B-B3, D-D3) = 30 μm.



Therapeutic potential of NCDs-HA nanoparticles for Bone regeneration in ZF model. We then investigated the in-vivo therapeutic potential of HA and NCDs-HA nanoparticles in a adult ZF jaw bone regeneration model. The micro-CT images (lower-upper jaw and whole body) were quantified for measuring bone volume and BMD at day 0, 14, 28 and 35 after ZF jaw bone resection surgery (Figure 7(a-d)). Bone micro-CT confirmed extensive lower jaw bone repaired by 14 days post-resection (dpr) in NCDs-HA nanoparticle treated groups as compared to control group (Figure 7(j)). We also observed enhanced bone repaired by 28 dpr in response to HA nanoparticles as compared to control groups (Figure 7(g)). Analysis of jaw bone regeneration in control ZF revealed that in 35 dpr, bone matrix fully spanned the lesion in all test animals, with bone attaining the distintictive appearance of the lower jaw (Figure 7(d)). Strikingly, the ZF jaw bone volume after 14, 28 and 35 days post-resection was statistically superior in the NCDs-HA 20 mg/kg (p < 0.01), NCDs-HA 40 and 80 mg/kg (p < 0.001), HA 40 and 80 mg/kg (p < 0.05) treated groups as compared to the control group (Figure 7(m)). Likewise, the BMD of ZF lower-upper jaw (Figure 8 (a)) and whole body (Figure 8 (b)) after 14, 28 and 35 dpr was statistically superior in the NCDs-HA 20 mg/kg (p < 0.01), NCDs-HA 40 and 80 mg/kg (p < 0.001), HA 40 and 80 mg/kg (p < 0.05) treated groups as compared to the control group. Besides that, it is noteworthy to mention that the ZF lower jaw bone volume and whole body BMD in NCDs-HA (80 mg/kg) group was statistically superior to HA (20, 40 and 80 mg/kg) groups (p < 0.05) after 14, 28 and 35 dpr (Figure 7 (m), 8 (b)). These observation indicate the intriguing therapeutic potential of NCDs-HA nanoparticles for bone repair; these nanoparticles seem especially important for quicker bone regeneration. Finally, we showed that in-vivo NCDs-HA nanoparticles have the capacity to enhance BMD in ZF, suggesting their potential application as anti-osteoporotic agents.


Page 18 of 34

Page 19 of 34 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Figure 7. Evaluation of in-vivo jaw bone regeneration in adult ZF after NCDs-HA and HA nanoparticles treatment. (a−h) The micro-CT images are analyzed to visualize and quantify bone regeneration in untreated control (a-d) versus HA 80 mg/kg (e-h) versus NCDs-HA HA 80 mg/kg nanoparticles treated ZF (Red arrows: day 0 – resection boundaries). The 3D images are reconstructed to illustrate the lower jaw regenerated bone tissue (yellow arrows) after 14, 28 and 35 days post-resection. (m) The amount of new bone generated after NCDs-HA and HA nanoparticles treatment is evaluated by new bone volume in lower jaw bone after 14, 28 and 35 days post-resection from the projected area of the micro-CT images. Data are shown as the mean ± SD, evaluated by one-way ANOVA followed by Tukey’s multiple comparison test. *p < 0.05; **p < 0.01; ***p < 0.001, compared to untreated control group; ; #p< 0.05 compared to HA (20, 40, and 80 mg/kg) groups.



Figure 8. BMD after NCDs-HA and HA nanoparticles treatment in lower-upper jaw bone (a) and whole ZF body (b) after 14, 28 and 35 days post-resection. Data are shown as the mean ± SD, evaluated by one-way ANOVA followed by Tukey’s multiple comparison test. *p < 0.05; **p < 0.01; ***p < 0.001, compared to untreated control group; ; #p< 0.05 compared to HA (20, 40, and 80 mg/kg) groups. In-vivo evaluation of the toxicity, biodistribution, retention, and pharmacokinetics profiles of novel nanoparticles is essential for their possible clinical applications.40 The results of our study identified no negative impact of NCDs-HA nanoparticles exposure on the general toxicology endpoints tested (data not shown) while positively impacting bone. Study carried out by Pravin and Mandal investigated the toxicity, biodistribution and clearance profiles of NCDs in mice


Page 20 of 34

Page 21 of 34 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


model. Results from this study showed that NCDs were cleared within 6 days post intravenous injection without accumulating in any tissues or vital organs.40 Study carried out by Huang et al., also showed that CDs have high in-vivo stability and rapid renal clearance after three different injection routes.41 Based on the existing knowledge and our findings we concluded that our NCDs-HA nanoparticles are non-toxic with quick clearance efficiency.

Figure 9. Schematic depicting the possible molecular mechanism for enhanced osteogenesis by NCDs-HA nanoparticles by activation of BMP signaling pathway as well as internalization into the osteoblast cells Based on the existing knowledge and our findings, a putative molecular mechanism for NCDsHA nanoparticles induced osteogenesis was suggested (Figure 9), where the NCDs-HA nanoparticles enhance osteogenic differentiation by a dual mechanism: first by activation of bone morphogenetic protein (BMP) signaling pathway; second by activation of autophagy and releasing NCDs-HA nanoparticles in a morphology-dependent manner to facilitate the



expression of the osteogenic differentiation genes, such as RUNX2, ALP and OCN. Significantly, the in-vivo application of NCDs-HA nanoparticles improved bone metabolism effectively in ZF jaw bone regeneration model by enhancing the bone volume and BMD. To our knowledge this is the first study to evaluate the effects of NCDs-HA nanoparticles in ZF jaw bone regeneration model. This suggests the possibility that a similar approach may be effective in hastening bone repair in humans. However, owing to the so-far limited investigations on NCDs-HA nanoparticles, more powered targeted studies deciphering the mechanisms of cellular uptake of NCDs-HA nanoparticles by accurate evaluation of internalization using flow cytometry and confocal microscopy, as well as the role of angiogenesis and bone formation during skeletal development and fracture healing are needed so as to better understand the properties of the NCDs-HA nanoparticles. Further, the detailed signalling mechanism as well as a molecular cascade involved in osteogenic differentiation and bone regeneration in both in-vitro and in-vivo models after exposure to NCDs-HA nanoparticles remains to be studied. CONCLUDING REMARKS In summary, we successfully engineered NCDs-HA nanoparticles by hydrothermal cum coprecipitation method. The synthesized NCD-HA nanoparticles were highly dispersible, stable and uniformly sized. The physical and chemical characterization of NCDs-HA confirmed the formation of fluorescent NCDs-HA with controlled nanoscale particle size. Our findings in this work demonstrated that NCDs-HA nanoparticles induced osteoblast differentiation and proliferation. Further, this study affirms the advanced bone regeneration ability of NCD-HA nanoparticles in a ZF jaw bone regeneration model. Our findings suggest that NCD-HA nanoparticles could represent a promising lead in the field of bone tissue engineering, bone regeneration, biomedicine, and drug delivery.


Page 22 of 34

Page 23 of 34 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


EXPERIMENTAL SECTION Chemicals. Bovine serum albumin (BSA), ammonium hydroxide, calcium nitrate tetrahydrate, di-ammonium hydrogen phosphate and quinine sulphate, were purchased from Sigma–Aldrich (St. Louis, MO, USA). The ethanol, acetone, isopropanol were obtained from Remical Pvt. Ltd. (Jerusalem, Israel). Deionized water (DI) (18.3 MU) was used throughout the experiments. NCDs preparation and characterization. The preparation of water-soluble NCDs was achieved via a modified hydrothermal method using aqueous BSA described previously.34 Briefly, 0.30 g BSA (66.5 kD) was dissolved in 50 mL of ultrapure water and stirred for 10 min at room temperature to prepare a homogeneous BSA aqueous solution. The resulting solution was transferred into 100 mL Teflon-lined autoclave and heated at 195 °C for 6 hours in a hot-air oven. After completion, the reaction was quenched by cooling the autoclave in water. The large carbide slag was removed from the product solution via centrifugation at 12,000 rpm for 10 min. The pale yellow-brown solution obtained was analyzed by physico-chemical techniques. Synthesis of HA and NCDs-HA nanoparticles. HA nanoparticles were synthesized via a modified co-precipitation method as described previously.25 We used calcium nitrate tetrahydrate (Ca(NO3)2·4H2O) as calcium ion source and di-ammonium hydrogen phosphate ((NH3)2·HPO4) as as the phosphorus precursor. Ammonium hydroxide (NH4OH) solution was used for pH adjustment. The stoichiometric molar ratio of calcium/phosphorus was maintained at 1.67. The resulting product was then centrifugally washed with DI water (until the pH of the solution become neutral) and lyophilized. 1% NCDs-HA nanoparticles were synthesized using novel hydrothermal cum co-precipitation method. Firstly, an aqueous solution of 0.5 M calcium nitrate tetrahydrate (23.6 g in 180 ml DI water) was vigorously stirred in a 500 ml beaker at 24 °C. Secondly, to calcium nitrate tetrahydrate



solution, NCDs (5 mg/mL, 20 ml) aqueous solution was added drop wise with continuous stirring for 15 min. The pH of the resultant solution was adjusted to 9.0 by the addition of 25% ammonia hydroxide, which was poured into the reactor equipped with inlets for argon and a magnetic stirrer. Finally, 0.3 M of di-ammonium hydrogen phosphate (7.92 g in 200 ml DI water) was added into the reactor solution within 20 seconds for the synthesis of the spherical NCDsHA nanoparticles. The final solution was stirred for another 12 h at 24 °C in argon atmosphere. The resulting product was then centrifugally washed with DI water and ethanol (until the pH of the solution becomes neutral) and lyophilized. Subsequently, the dried powder was manually grounded into fine powder with a corundum mortar and pestle. Similar procedure was followed to synthesize 2 % and 5 % NCDs-HA nanoparticles. Analytical techniques. The visual information of the HA, NCDs, NCDs-HA nanoparticles was obtained with the help of high-definition camera in the presence of normal and UV-light. The fluorescence of the NCDs-HA nanoparticles was measured by a fluorescence spectrophotometer (Varian Cary Eclipse, Varian GmbH, Darmstadt, Germany). UV-vis absorption spectra of the NCDs-HA nanoparticles were measured using a Cary 100 spectrophotometer (Varian), operated by Lab Sphere software. Scanning electron microscopy (SEM) was performed using an Inspect FEI microscope (FEI Israel Thermofisher, Rehovot, Israel). The samples were prepared by placing a small portion of the dried nanoparticles on a sample holder coated with carbon tape. For SEM analysis, the sample surfaces were coated with a thin evaporated carbon layer for conductivity. The morphology and crystalline properties of NCDs-HA nanoparticles were analyzed by high-resolution transmission-electron microscopy (HR-TEM) using a JEOL 2100 (JEOL USA, Inc., Peabody, MA, USA) microscope that was operated at 200 kV. The samples for the HR-TEM analysis were prepared by adding a few drops of NCDs-HA nanoparticles to 5


Page 24 of 34

Page 25 of 34 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


mL of isopropanol and by bath sonication for 2 min. The resultant mixture was dropped on a silicon-coated copper grid and then dried under vacuum at 25 °C for 12 h. A Bruker D8 Advance (Bruker AXS GmbH, Karlsruhe, Germany) and a Philips PW1050 X-ray diffractometer (Cu K radiation, operating at 40 kV/30 mA with a 0.0019 step size and a 0.5 s step) were used for X-ray diffraction (XRD) measurements. The chemical structure of NCDs-HA nanoparticles as analyzed by phosphorous nuclear magnetic resonance (31P NMR) in D2O solvent. Cell culture. Murine MC3T3-E1 pre-osteoblast (MC3T3-E1, ATCC CRL-2594) cells were used to evaluate the cell imaging ability as well as cytocompatibility with NCDs-HA nanoparticles. Cells were cultured in the Dulbecco's modified Eagle’s medium alpha (DMEM) (Biological industries, Beit Haemek, Israel) with 10% fetal bovine serum (FBS) and penicillin (100 IU/mL)/streptomycin (100 mg/mL) solution ("Pen-strep", Biological industries). Reaching 90% confluence, cells were trypsinized (0.02% trypsin, 0.02% EDTA, Trypsin EDTA Solution B, Biological industries) for 2-3 min at 37 °C in a humidified atmosphere of 5% CO2, followed by centrifugation for 5 min at 1500 rpm, and expanded. For osteoblast differentiation, cells after three successful passages were trypsinized and subsequently suspended in the osteogenic induction DMEM medium supplemented with 10 % FBS, 50 mg/mL L-ascorbic acid 2phosphate, and 10 mM β-glycerophosphate (Sigma-Aldrich). Cell proliferation assay. The effect of NCDs-HA and HA nanoparticles on MC3T3-E1 osteoblast cell proliferation was measured by using a label-free, non-invasive cellular confluence assay by IncuCyte Live-Cell Imaging System (Essen Bioscience, Ann Arbor, MI, USA). Cells (1×103 cells/well) were seeded overnight on a 96-well plate, placed in an XL-3 incubation chamber maintained at 37 °C and were photographed using a 10x objective. This system enables collection of live cell images at 3-h intervals over several days. The IncuCyte generates real-time



cell confluence data on the basis of segmentation of high definition phase contrast images.42 Cell confluence was calculated using IncuCyte ZOOM 2016A software. ALP enzyme staining. For ALP staining, MC3T3-E1 osteoblast cells were seeded in a 96-well plate at a density of 1×103 cells per well and treated with NCDs-HA and HA nanoparticles (30 μg∙ml−1). After 5 days of culture, the medium was removed, and the cells were washed gently with phosphate buffered saline (PBS) and fixed with PBS-formaldehyde (3.6 %). The cells were then stained with BCIP/NBT (5-Bromo-4-chloro-3-indolyl phosphate/Nitro blue tetrazolium) tablet solution (Sigma–Aldrich) for 1 h at 37 °C and images were visualized with a bright field optical microscope (Zeiss Primo Vert Inverted Microscope, Oberkochen, Germany).43 ALP activity was determined by measuring the staining intensity and stained area by image processing software Image-J. Mineralization analysis. MC3T3-E1 osteoblast cells were seeded in a 24-well plate at a density of 2 × 103 cells/well and cultured with continuous exposure to various concentrations of NCDsHA and HA nanoparticles (30 μg∙ml−1) for 21 days. After 21 days of exposure to NCDs-HA and HA nanoparticles, the cells were washed with PBS and fixed with PBS-formaldehyde (3.6%) for 1 h at 4°C, then stained with 40 mM Alizarin red (Sigma-Aldrich) solution for 30 min. The cells were rinsed with water to remove non-specific Alizarin red.44 Osteoblast cell mineralization was evaluated by the microscopy and quantified using software Image-J. Osteogenic expression by reverse transcriptase-polymerase chain reaction (RT-PCR). The expression levels of osteogenesis-related genes were measured using the quantitative RT-PCR. The MC3T3-E1 osteoblast cells were seeded at a density of 1 × 104 cells/flask (T-75), cultured for 96h, and then harvested using NucleoSpin RNA isolation kit (Macherey-Nagel, Duren, Germany) to extract RNA. An equivalent amount of RNA from each sample was reverse-


Page 26 of 34

Page 27 of 34 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


transcribed into complementary DNA (cDNA) using the Superscript II first-strand cDNA synthesis kit (Invitrogen). The RT-PCR analysis of genes including alkaline phosphatase (ALP), osteocalcin (OCN), and Runt-related transcription factor 2 (RUNX2), was performed on the ViiA 7 RT-PCR System (Thermo Fisher Scientific) using the Quantitect Sybr Green Kit (Qiagen,

Quanta, France). The primers for the target genes are listed in Table 1. The defined Ct values of target genes were normalized by the Ct values of the beta-actin housekeeping gene to obtain the defined ΔCt values. These values were then subtracted by the Ct value of the cells cultured on the blank disks to obtain the ΔCt values. Table 1. Primer sequences and product sizes for real-time PCR reactions Target

Sense and anti-sense sequences

bp

ALP

5′AACCCAGACACAAGCATTCC 5′ GAGAGCGAAGGGTCAGTCAG 5′AGAGTCAGATTACAGATCCCAGG 5′ TGGCTCTTCTTACTGAGAGAGG 5′TGCTTGTGACGAGCTATCAG 5′ GAGGACAGGGAGGATCAAGT 5′TCTTGGGTATGGAATCCTGTG 5′ AGGTCTTTACGGATGTCAACG

151

RUNX2 OCN Beta-actin

238 149 81

In-vitro bio-imaging of NCDs-HA nanoparticles. To demonstrate the osteoblast cell imaging performance of NCDs-HA nanoparticles as compared to HA nanoparticles, MC3T3-E1 osteoblast cells were co-cultured with NCDs-HA and HA nanoparticles, and tracked by fluorescence microscopy. For imaging, cells (1 × 104 cells/dish) were incubated with 30 μg∙ml−1 of NCDs-HA nanoparticles and HA nanoparticles in cell culture dishes with glass bottom (35 mm, one compartment; Cell ViewTM, Greiner Bio-One Gmbh, Frickenhausen, Germany) at 37 °C for 24 h. Further, the cells were washed with PBS to remove the excess NCDs-HA or HA nanoparticles. The cells were fixed with 250 μL of PBS-formaldehyde (3.6%) at room temperature for 15 min. The formaldehyde was then removed, and the cells were washed twice



with PBS followed by staining with 250 μL PBS plus 6 μM DAPI (4′,6-Diamidine-2′phenylindole dihydrochloride (Sigma–Aldrich) for 5 min at room temperature. Afterwards, DAPI was removed and the cells were rinsed with PBS. Finally, the cell culture dishes were filled with PBS, and the fluorescence intensity was read with a multi-wavelength fully automated Leica DMI6000 B inverted fluorescent microscope with adaptive focus control. The fluorescence imaging of cells loaded with NCDs-HA and HA nanoparticles was done under Ex488/Em535 for NCDs-HA nanoparticles (green)44 and Ex340/Em460 for DAPI (blue). Bone regeneration in a ZF jawbone resection model. In-house bred healthy ZF age 12 months were included in this experiment. ZF were cultured and maintained, as explained previously35. The experiments were conducted as per the approved protocol of Institutional Animal Care and Use Committee (IACUC) of Bar-Ilan University (No. 55-07-2017). The ZF were pre-medicated with oxytetracycline hydrochloride (20mg/L; Sigma-Aldrich) for 24 h before jawbone resection surgery. Before surgery, the ZF were anesthetized with tricaine methanesulfonate (0.016 mg/mL; Sigma-Aldrich). ZF jawbone resections were performed on anesthetized ZF using sterile surgical blade number 11 (Bar-Naor Ltd., Ramat Gan, Israel) using a high resolution binocular loupes (Heine HR 2.5x, Herrsching, Germany). Using the modified protocol from45, we removed approximately half (2 mm) of the distal lower jawbone of the ZF, starting from the insertion point of the maxillary barbell. After surgery, the ZF were kept in recovery tank for 30 min before returning to their tanks. To prevent post-surgical infection, the ZF were treated with oxytetracycline hydrochloride (20 mg/L) for 24 h with no feeding after jawbone resection surgery. We observed no adverse effects after lower jaw resection surgery in ZF (data not shown).


Page 28 of 34

Page 29 of 34 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


After ZF jaw resection surgery, ZF were divided into 7 groups of 20 fish each. Three experimental diets each of NCDs-HA or HA nanoparticles were designed with a concentration of 20,

40,

and

80

mg/kg

in the ZF

feed

TetraMin

(Tetra,

Blacksburg,

and control group without any nanoparticles for the whole duration of the experiemnt.

VA) Five

fishes from each group were euthanized on day 0, 14, 30 and 35 after jawbone resection surgery. Euthanized fish from each group were fixed in 3.7% formaldehyde in PBS for 24 h and stored in 70% ethanol until micro-computed tomography (micro-CT) scanning. Micro-CT analysis. ZF samples were immobilized with Kimwipes (Kimtech Science, Roswell, GA, USA) wrapping in a 8 mm diameter sample tube and scanned in 70% ethanol using a SkyScan 1172 micro-CT scanner (Bruker, Kontich, Belgium). For detailed analysis, whole ZF skeleton was imaged at 9.3µm voxel size. The applied X-ray voltage was 50kV, a current of 100 μA, and a power source of 10 W, with 0.25mm aluminum filtration. Scans were over 360° with a 0.45° rotation step. A three-dimensional (3D) reconstruction was generated with NRecon software for three skeletal sites of ZF (lower-upper jaw, head and whole body) from all the set of scans. A region of interest was traced around individual lower-upper jaw, head, and whole body of all set of reconstructed images by using CTAn software. Bone mineral density (BMD) was estimated by comparing with calibration phantoms of known BMD (0.25 and 0.75 g/cm3 hydroxyapatite), scanned at the same time as the ZF samples. Further, 3D tomography images and movies of ZF head and whole body were generated using CTvox software. Statistical analysis. Quantitative data obtained from in-vivo and in-vitro experiments were expressed as the mean ± standard deviation (SD). For all the data, comparisons between different treatments were analyzed by one-way analysis of variance (ANOVA) followed by Tukey's multiple comparison tests. The level of significance was taken as p < 0.05.



Acknowledgments The authors are grateful to the experimental assistance (fluorescence microscopy) and advice (Image-J software) of Tetiana Makhnii (PhD student) from Cell Migration and Invasion Laboratory, The Azrieli Faculty of Medicine, Bar-Ilan University, Safed, Israel. Authors gratefully acknowledge the Council for Higher Education (VATAT) Israel for granting Postdoctoral Fellowship (vat/bat/cyc5/102) to the first author. DK was supported by a generous gift from the Samson Family (South Africa). Supporting information: Supplementary material (including images of HA, NCDs, NCDs-HA nanoparticles in day light and UV-light, fluorescence spectra of 2% NCDs-HA nanoparticles, EDS analysis (graph) of (a) HA and (b) 5% NCDs-HA, is available in the online version of this article. References (1)

(2)

(3)

(4)

(5) (6)

(7)

Min, J.; Choi, K. Y.; Dreaden, E. C.; Padera, R. F.; Braatz, R. D.; Spector, M.; Hammond, P. T. Designer Dual Therapy Nanolayered Implant Coatings Eradicate Biofilms and Accelerate Bone Tissue Repair. ACS Nano 2016, 10 (4), 4441–4450. Zhang, X.; Zhang, C.; Lin, Y.; Hu, P.; Shen, Y.; Wang, K.; Meng, S.; Chai, Y.; Dai, X.; Liu, X.; Liu, Y.; Mo, X.; Cao, C.; Li, S.; Deng, X.; Chen, L. Nanocomposite Membranes Enhance Bone Regeneration Through Restoring Physiological Electric Microenvironment. ACS Nano 2016, 10 (8), 7279–7286. Lewis, E. E. L.; Wheadon, H.; Lewis, N.; Yang, J.; Mullin, M.; Hursthouse, A.; Stirling, D.; Dalby, M. J.; Berry, C. C. A Quiescent, Regeneration-Responsive Tissue Engineered Mesenchymal Stem Cell Bone Marrow Niche Model via Magnetic Levitation. ACS Nano 2016, 10 (9), 8346–8354. Xavier, J. R.; Thakur, T.; Desai, P.; Jaiswal, M. K.; Sears, N.; Cosgriff-Hernandez, E.; Kaunas, R.; Gaharwar, A. K. Bioactive Nanoengineered Hydrogels for Bone Tissue Engineering: A Growth-Factor-Free Approach. ACS Nano 2015, 9 (3), 3109–3118. Gong, T.; Xie, J.; Liao, J.; Zhang, T.; Lin, S.; Lin, Y. Nanomaterials and Bone Regeneration. Bone Res. 2015, 3 (August). Chen, H.; Wang, L.; Fu, H.; Wang, Z.; Xie, Y.; Zhang, Z.; Tang, Y. Gadolinium Functionalized Carbon Dots for Fluorescence/Magnetic Resonance Dual-Modality Imaging of Mesenchymal Stem Cells. J. Mater. Chem. B 2016, 4 (46), 7472–7480. Xu, B.; Ju, Y.; Cui, Y.; Song, G. Carbon Nanotube Array Inducing Osteogenic Differentiation of Human Mesenchymal Stem Cells. Mater. Sci. Eng. C. Mater. Biol. Appl. 2015, 51, 182–188.


Page 30 of 34

Page 31 of 34 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


(8)

(9)

(10)

(11)

(12)

(13) (14)

(15)

(16)

(17)

(18) (19) (20)

(21)

(22)

Lee, J.-H.; Shim, W.; Choolakadavil Khalid, N.; Kang, W.-S.; Lee, M.; Kim, H.-S.; Choi, J.; Lee, G.; Kim, J.-H. Random Networks of Single-Walled Carbon Nanotubes Promote Mesenchymal Stem Cell’s Proliferation and Differentiation. ACS Appl. Mater. Interfaces 2015, 7 (3), 1560–1567. Park, J.; Kim, B.; Han, J.; Oh, J.; Park, S.; Ryu, S.; Jung, S.; Shin, J. Y.; Lee, B. S.; Hong, B. H.;Choi, D.; Kim , B.S. Graphene Oxide Flakes as a Cellular Adhesive: Prevention of Reactive Oxygen Species Mediated Death of Implanted Cells for Cardiac Repair. ACS Nano 2015, 9 (5), 4987–4999. Shao, D.; Lu, M.; Xu, D.; Zheng, X.; Pan, Y.; Song, Y.; Xu, J.; Li, M.; Zhang, M.; Li, J.; Chi, G.; Chen, L.; Yang, B. Carbon Dots for Tracking and Promoting the Osteogenic Differentiation of Mesenchymal Stem Cells. Biomater. Sci. 2017, 5 (9), 1820–1827. Hu, Y.; Geng, X.; Zhang, L.; Huang, Z.; Ge, J.; Li, Z. Nitrogen-Doped Carbon Dots Mediated Fluorescent on-off Assay for Rapid and Highly Sensitive Pyrophosphate and Alkaline Phosphatase Detection. Sci. Rep. 2017, 7 (1), 1–9. Nudelman, F.; Pieterse, K.; George, A.; Bomans, P. H. H.; Friedrich, H.; Brylka, L. J.; Hilbers, P. A. J.; De With, G.; Sommerdijk, N. A. J. M. The Role of Collagen in Bone Apatite Formation in the Presence of Hydroxyapatite Nucleation Inhibitors. Nat. Mater. 2010, 9 (12), 1004–1009. Feng, P.; Niu, M.; Gao, C.; Peng, S.; Shuai, C. A Novel Two-Step Sintering for NanoHydroxyapatite Scaffolds for Bone Tissue Engineering. Sci. Rep. 2014, 4, 5599. Zhao, M.; Li, H.; Liu, X.; Wei, J.; Ji, J.; Yang, S.; Hu, Z.; Wei, S. Response of Human Osteoblast to N-HA/PEEK—Quantitative Proteomic Study of Bio-Effects of NanoHydroxyapatite Composite. Sci. Rep. 2016, 6 (February), 22832. Haider, A.; Haider, S.; Han, S. S.; Kang, I.-K. Recent Advances in the Synthesis, Functionalization and Biomedical Applications of Hydroxyapatite: A Review. RSC Adv. 2017, 7 (13), 7442–7458. Khajuria, D. K.; Razdan, R.; Mahapatra, D. R. Development, in Vitro and in Vivo Characterization of Zoledronic Acid Functionalized Hydroxyapatite Nanoparticle Based Formulation for Treatment of Osteoporosis in Animal Model. Eur. J. Pharm. Sci. 2015, 66, 173–183. Lee, J. H.; Shin, Y. C.; Lee, S.-M.; Jin, O. S.; Kang, S. H.; Hong, S. W.; Jeong, C.-M.; Huh, J. B.; Han, D.-W. Enhanced Osteogenesis by Reduced Graphene Oxide/Hydroxyapatite Nanocomposites. Sci. Rep. 2015, 5 (November), 18833. Okada, M.; Matsumoto, T. Synthesis and Modification of Apatite Nanoparticles for Use in Dental and Medical Applications. Jpn. Dent. Sci. Rev. 2015, 51 (4), 85–95. Huebsch, N.; Mooney, D. J. Inspiration and Application in the Evolution of Biomaterials. Nature 2009, 462 (7272), 426–432. Gao, P.; Zhang, H.; Liu, Y.; Fan, B.; Li, X.; Xiao, X.; Lan, P.; Li, M.; Geng, L.; Liu, D.; et al. Beta-Tricalcium Phosphate Granules Improve Osteogenesis in Vitro and Establish Innovative Osteo-Regenerators for Bone Tissue Engineering in Vivo. Sci. Rep. 2016, 6 (March), 1–14. Zhao, Y.; Shi, L.; Fang, J.; Feng, X. Bio-Nanoplatforms Based on Carbon Dots Conjugating with F-Substituted Nano-Hydroxyapatite for Cellular Imaging. Nanoscale 2015, 7 (47), 20033–20041. Kumar, V. B.; Porat, Z.; Gedanken, A. Facile One-Step Sonochemical Synthesis of Ultrafine and Stable Fluorescent C-Dots. Ultrason. Sonochem. 2016, 28, 367–375.



(23)

(24)

(25)

(26)

(27)

(28)

(29)

(30)

(31)

(32)

(33)

(34)

(35)

(36)

Ma, B.; Zhang, S.; Liu, R.; Qiu, J.; Zhao, L.; Wang, S.; Li, J.; Sang, Y.; Jiang, H.; Liu, H. Prolonged Fluorescence Lifetime of Carbon Quantum Dots by Combining with Hydroxyapatite Nanorods for Bio-Applications. Nanoscale 2017, 9 (6), 2162–2171. Filek, U.; Mucha, D.; Hunger, M.; Sulikowski, B. Novel Gallium and Indium Salts of the 12-Tungstophosphoric Acid: Synthesis, Characterization and Catalytic Properties. Catal. Commun. 2013, 30, 19–22. Mondal, S.; De Anda Reyes, M. E.; Pal, U. Plasmon Induced Enhanced Photocatalytic Activity of Gold Loaded Hydroxyapatite Nanoparticles for Methylene Blue Degradation under Visible Light. RSC Adv. 2017, 7 (14), 8633–8645. Khajuria, D. K.; Kumar, V. B.; Karasik, D.; Gedanken, A. Fluorescent Nanoparticles with Tissue-Dependent Affinity for Live Zebrafish Imaging. ACS Appl. Mater. Interfaces 2017, 9 (22). Hsieh, M.-F.; Li, J. K.-J.; Lin, C.-A. J.; Huang, S.-H.; Sperling, R. A.; Parak, W. J.; Chang, W. H. Tracking of Cellular Uptake of Hydrophilic CdSe/ZnS Quantum Dots/Hydroxyapatite Composites Nanoparticles in MC3T3-E1 Osteoblast Cells. J. Nanosci. Nanotechnol. 2009, 9 (4), 2758–2762. Twine, N. A.; Chen, L.; Pang, C. N.; Wilkins, M. R.; Kassem, M. Identification of Differentiation-Stage Specific Markers That Define the Ex Vivo Osteoblastic Phenotype. Bone 2014, 67, 23–32. Gogoi, S.; Kumar, M.; Mandal, B. B.; Karak, N. A Renewable Resource Based Carbon Dot Decorated Hydroxyapatite Nanohybrid and Its Fabrication with Waterborne Hyperbranched Polyurethane for Bone Tissue Engineering. RSC Adv. 2016, 6 (31), 26066–26076. Granéli, C.; Thorfve, A.; Ruetschi, U.; Brisby, H.; Thomsen, P.; Lindahl, A.; Karlsson, C. Novel Markers of Osteogenic and Adipogenic Differentiation of Human Bone Marrow Stromal Cells Identified Using a Quantitative Proteomics Approach. Stem Cell Res. 2014, 12 (1), 153–165. Yang, M.; Arai, A.; Udagawa, N.; Hiraga, T.; Lijuan, Z.; Ito, S.; Komori, T.; Moriishi, T.; Matsuo, K.; Shimoda, K.; Zahalka, A. H.; Kobayashi, Y.; Takahashi, N.; Mizoguchi, T. Osteogenic Factor Runx2 Marks a Subset of Leptin Receptor-Positive Cells That Sit Atop the Bone Marrow Stromal Cell Hierarchy. Sci. Rep. 2017, 7 (1), 4928. Perez, R. A.; Seo, S. J.; Won, J. E.; Lee, E. J.; Jang, J. H.; Knowles, J. C.; Kim, H. W. Therapeutically Relevant Aspects in Bone Repair and Regeneration. Mater. Today 2015, 18 (10), 573–589. Liu, D.; Zhang, J.; Yi, C.; Yang, M. The Effects of Gold Nanoparticles on the Proliferation, Differentiation, and Mineralization Function of MC3T3-E1 Cells in Vitro. Chinese Sci. Bull. 2010, 55 (11), 1013–1019. Kumar, V. B.; Sheinberger, J.; Porat, Z.; Shav-Tal, Y.; Gedanken, A. A Hydrothermal Reaction of an Aqueous Solution of BSA Yields Highly Fluorescent N Doped C-Dots Used for Imaging of Live Mammalian Cells. J. Mater. Chem. B 2016, 4, 2913–2920. Khajuria, D. K.; Kumar, V. B.; Karasik, D.; Gedanken, A. Fluorescent Nanoparticles with Tissue-Dependent Affinity for Live Zebrafish Imaging. ACS Appl. Mater. Interfaces 2017, 9 (22), 18557–18565. Chen, Y.; Zheng, M.; Xiao, Y.; Dong, H.; Zhang, H.; Zhuang, J.; Hu, H.; Lei, B.; Liu, Y. A Self-Quenching-Resistant Carbon-Dot Powder with Tunable Solid-State Fluorescence and Construction of Dual-Fluorescence Morphologies for White Light-Emission. Adv.


Page 32 of 34

Page 33 of 34 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


(37) (38) (39) (40)

(41)

(42)

(43)

(44)

(45)

Mater. 2016, 28 (2), 312–318. Zhang, J.; Yu, S. H. Carbon Dots: Large-Scale Synthesis, Sensing and Bioimaging. Mater. Today 2016, 19 (7), 382–393. Hunter, P. Next Generation Nanotech Meds. EMBO Rep. 2017, 18 (1), 25–27. Fan, Z.; Fu, P. P.; Yu, H.; Ray, P. C. Theranostic Nanomedicine for Cancer Detection and Treatment. Journal of Food and Drug Analysis. Elsevier Masson SAS 2014, pp 3–17. Parvin, N.; Mandal, T. K. Synthesis of a Highly Fluorescence Nitrogen-Doped Carbon Quantum Dots Bioimaging Probe and Its in Vivo Clearance and Printing Applications. RSC Adv. 2016, 6 (22), 18134–18140. Huang, X.; Zhang, F.; Zhu, L.; Choi, K. Y.; Guo, N.; Guo, J.; Tackett, K.; Anilkumar, P.; Liu, G.; Quan, Q.; Choi, HS.; Niu, G.; Sun, Y.P.; Lee, S.; Chen, X. Effect of Injection Routes on the Biodistribution, Clearance, and Tumor Uptake of Carbon Dots. ACS Nano 2013, 7 (7), 5684–5693. Cheng, G.; Zielonka, J.; McAllister, D.; Tsai, S.; Dwinell, M. B.; Kalyanaraman, B. Profiling and Targeting of Cellular Bioenergetics: Inhibition of Pancreatic Cancer Cell Proliferation. Br. J. Cancer 2014, 111 (1), 85–93. Kim, B. S.; Kang, H.-J.; Park, J.-Y.; Lee, J. Fucoidan Promotes Osteoblast Differentiation via JNK- and ERK-Dependent BMP2–Smad 1/5/8 Signaling in Human Mesenchymal Stem Cells. Exp. Mol. Med. 2015, 47 (1), e128. Hwang, J.-H.; Cha, P.-H.; Han, G.; Bach, T. T.; Min, D. S.; Choi, K.-Y. Euodia Sutchuenensis Dode Extract Stimulates Osteoblast Differentiation via Wnt/β-Catenin Pathway Activation. Exp. Mol. Med. 2015, 47 (3), e152. Paul, S.; Schindler, S.; Giovannone, D.; de Millo Terrazzani, A.; Mariani, F. V.; Crump, J. G. Ihha Induces Hybrid Cartilage-Bone Cells during Zebrafish Jawbone Regeneration. Development 2016, 143 (12), 2066–2076.



TOC-Graphics


Page 34 of 34

Accelerated Bone Regeneration by Nitrogen-Doped Carbon Dots

Recommend Documents