Accelerated bone regenerative efficiency by regulating sequential

Subscriber access provided by Washington University | Libraries

Tissue Engineering and Regenerative Medicine

Accelerated bone regenerative efficiency by regulating sequential release of BMP-2 and VEGF and synergism with sulfated chitosan Shuang Zhang, Jie Chen, Yuanman Yu, Kai Dai, Jing Wang, and Changsheng Liu ACS Biomater. Sci. Eng., Just Accepted Manuscript • DOI: 10.1021/ acsbiomaterials.8b01490 • Publication Date (Web): 28 Feb 2019 Downloaded from http://pubs.acs.org on March 1, 2019

Just Accepted “Just Accepted” manuscripts have been peer-reviewed and accepted for publication. They are posted online prior to technical editing, formatting for publication and author proofing. The American Chemical Society provides “Just Accepted” as a service to the research community to expedite the dissemination of scientific material as soon as possible after acceptance. “Just Accepted” manuscripts appear in full in PDF format accompanied by an HTML abstract. “Just Accepted” manuscripts have been fully peer reviewed, but should not be considered the official version of record. They are citable by the Digital Object Identifier (DOI®). “Just Accepted” is an optional service offered to authors. Therefore, the “Just Accepted” Web site may not include all articles that will be published in the journal. After a manuscript is technically edited and formatted, it will be removed from the “Just Accepted” Web site and published as an ASAP article. Note that technical editing may introduce minor changes to the manuscript text and/or graphics which could affect content, and all legal disclaimers and ethical guidelines that apply to the journal pertain. ACS cannot be held responsible for errors or consequences arising from the use of information contained in these “Just Accepted” manuscripts.

is published by the American Chemical Society. 1155 Sixteenth Street N.W., Washington, DC 20036 Published by American Chemical Society. Copyright © American Chemical Society. However, no copyright claim is made to original U.S. Government works, or works produced by employees of any Commonwealth realm Crown government in the course of their duties.

Page 1 of 34 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

ACS Biomaterials Science & Engineering

Accelerated bone regenerative efficiency by regulating sequential release of BMP-2 and VEGF and synergism with sulfated chitosan Shuang Zhang‡, Jie Chen§, Yuanman Yu†, Kai Dai‡, Jing Wang*,†, and Changsheng Liu*,‡

†The

State Key Laboratory of Bioreactor Engineering, East China

University of Science and Technology, Shanghai 200237, PR China ‡Key

Laboratory for Ultrafine Materials of Ministry of Education, East China University of

Science and Technology, Shanghai 200237, PR China §Engineering

Research Center for Biomedical Materials of Ministry of Education, East China

University of Science and Technology, Shanghai 200237, PR China

Corresponding

Authors:

[email protected]

(Jing

Wang);

[email protected] (Changsheng Liu).

KEYWORDS: BMP-2, VEGF, sulfated chitosan, spatiotemporal delivery, osteogenesis, angiogenesis

ACS Paragon Plus Environment

ACS Biomaterials Science & Engineering 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

ABSTRACT: Emerging evidence suggests that successful healing of bone substitutes depends on the osteogenesis-angiogenesis interplay. Bone morphogenetic protein-2 (BMP-2) and vascular endothelial growth factor (VEGF) have been identified as key regulators of osteogenesis and angiogenesis during bone regeneration. While the importance of growth factors is now widely accepted, the impact and mechanisms of different releasing sequence on bone repair have not been fully understood. Here, a composite vehicle (Gel/PMs), constructed with hydrogels and microspheres, was developed, which is capable of achieving two distinct releasing modes: BMP-2 first release followed by VEGF release (B/V), and VEGF first release followed by BMP-2 release (V/B). In our results, B/V mode exhibited more extensive vascular network formation by up-regulating angiogenic genes during the bone remolding, thus facilitating rapid bone transformation which was confirmed by radiography. Further histological and immune-staining analysis revealed that fast release of BMP-2 made for rapidly initiating osteogenesis, while later VEGF release promoted persistent angiogenesis and mature bone formation. Moreover, interest arises from the introduction of 2-N,6-O-sulfated chitosan (SCS), a sulfonated heparin-like polysaccharide. It has synergistic effects with both BMP-2 and VEGF, which can further accelerate the bone healing by efficiently improving osteogenesis and angiogenesis. The results demonstrated that disparate releasing sequence of growth factors might influence regenerative efficiency. Such a strategy may provide insights toward designing bioactive materials and give promising application in tissue regeneration.

1. INTRODUCTION The reconstruction of large bone defects due to skeletal trauma, osteoporosis, arthritis,


Page 2 of 34

Page 3 of 34 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


or tumor resection remains a challenging clinical subject worldwide.1 It is reported that delayed union or nonunion of bone fragments, bone deformation, and loss of mobility occur in approximately 10% of patients with large bone defects, and bone regenerative procedures sometimes fail.2 Bone tissue engineering, which is a promising alternative strategy for tissue regeneration, has thus attracted considerable attention.3 However, current biomaterials often exhibit poor capacity in initiating endogenous bone regenerative process, and lead to low therapeutic efficacies.4 This is mainly due to insufficient osteogenic activity and poor angiogenic capability of biomaterials during the repair of injured bone.5-6 Osteogenesis, a sequential cascade with three phases, consists of migration and mitosis of mesenchymal stem cells (MSCs), differentiation of MSCs into chondrocytes, cartilage formation, and finally, replacement of cartilage by new bone and marrow.7-8 It is well-known that the classic regulator, BMP-2, which is approved by the US Food and Drug Administration (FDA) for clinical use, can induce bone formation via the enhancement of osteoprogenitors recruitment, angiogenesis, and the stimulation of the osteogenic differentiation of MSCs.9-10 Notably, angiogenesis and osteogenesis are highly coupled. It is reported that a certain capillary subtype in bone vasculature can generate a distinct metabolic and molecular microenvironment to mediate the growth of bone vasculature and to maintain perivascular osteoprogenitors.11-12 Representative pro-angiogenic factor VEGF, a master regulator of angiogenesis, also plays a critical role in bone repair. For example, loss of VEGF results in a delayed differentiation of hypertrophic chondrocytes, impaired vascularization during skeletal development, and a mineralization defect during bone repair.13-14 However, the expression level of endogenous cytokines during fracture healing is relatively low, which cannot fulfill the complete bone regeneration.15 Hence, it is essential to design a delivery system with the ability to load series exogenous growth factors, such as BMP-2 and VEGF, in order to mimic natural microenvironment for bone formation. Although extensive studies have been carried on the design of delivery system, it seems that using multiple cytokines delivery in a spatiotemporal manner can optimize bone



regeneration.16-18 A typical research by Peng et al found that VEGF release alone was not sufficient to heal critical-sized bone defects; it had a potent enhancing effect only after the osteogenic activation induced by BMP-2 release. These effects included increased recruitment of MSCs, enhanced cell survival and augmented cartilage formation in the early stage of endochondral bone formation.19 On the contrary, Diederik and co-workers found that during normal bone healing, VEGF expression was shown to peak in the early stage, whereas BMP-2 expression peaked at a later stage. In their experiments, the early release of VEGF followed by a sustained release of BMP-2 enhanced wound healing and tissue regeneration.20 Unfortunately, most studies focused on the advantages of dual growth factors.21-22 Up to now, few study pay attention to the disparity resulting from the various sequences and releasing patterns of exogenous BMP-2 and VEGF, and its influence on bone regenerative efficiency in vivo. On the other hand, the clinical application of exogenous cytokines faces a short biological half-life on account of their susceptibility to enzymatic and chemical denaturation in a physiological environment. Moreover, BMP-2 and VEGF administrated at a superphysiological dose may also lead to unfavorable side effects, including excessive bone formation, atherosclerotic plaque development, and adverse immune responses.23-25 In order to address these issues, some studies have evolved to utilize heparan sulfate glycosaminoglycans with capacity to bind growth factors for the purpose of optimizing their function. Our previous study has demonstrated that 2-N,6-O-sulfated chitosan (SCS), a highly sulfonated heparin-like polysaccharide, can be a potent enhancer for many cytokines.26-28 SCS is capable of improving the osteogenic and angiogenic effect of BMP-2 during the bone formation, and efficiently enhancing the VEGF-mediated angiogenesis; this implies the potential role of SCS in the field of bone regeneration. Therefore, in the present work, we have developed a simplified dual-loading system, which allowed transforming releasing modes of multiple growth factors expediently. Complex scaffold (Gel/PMs), consisting of a gelatin hydrogel and PLGA microspheres, was


Page 4 of 34

Page 5 of 34 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


designed to achieve different releasing patterns of BMP-2 and VEGF. Utilizing the disparate swelling and degradation features between hydrogels and microparticles, two types of sequential release of cytokines can be obtained: BMP-2 first release followed by VEGF release (B/V), as well as VEGF first release followed by BMP-2 release (V/B). Moreover, SCS was introduced into the optimized system. We hypothesized that SCS might act as a partner and have synergetic effects on both BMP-2 and VEGF due to their heparin-binding domains. Mouse ectopic bone formation model was adopted to evaluate the functionality of B/V and V/B in the process of bone regeneration. In the light of these findings, it was interesting to investigate the applicability of preparing optimized spatiotemporal delivery systems for enhancing pro-osteogenic and angiogenic potential (Scheme 1).

Scheme 1. Different sequential release of BMP-2 and VEGF was obtained by preparing V/B and B/V scaffolds. Better binding efficiency and sustained releasing dynamics were acquired in the S-B/V scaffold owing to the interaction between SCS and BMP-2-VEGF.

2. MATERIALS AND METHODS



2.1 Chemicals and materials Recombinant human VEGF was purchased from PeproTech (Rocky Hill, NJ, USA). Recombinant human BMP-2 was a gift from Rebone Biomaterials Co. Ltd. (Shanghai, China). Poly(lactic-co-glycolic acid) with a 50:50 monomer ratio and average molecular weight of 100 kDa was purchased from Jinan Dai Gang Biological Technology Co. Ltd. (Jinan, China). Mouse embryo osteoblast precursor cells (MC3T3-E1) were purchased from the American Type Culture Collection. Fetal bovine serum (FBS), trypsin, and Dulbecco’s modified Eagle’s medium (DMEM) were purchased from Gibco. Trizol reagent, PrimeScript RT reagent kit and SYBR Premix Ex TaqTM were from Takara Biotechnology Co. Ltd. (Dalian, China). 2-N,6-O-sulfated chitosan was prepared as previously described.29 All other chemicals and reagents were products of Sigma. 2.2 Preparation of BMP-2 and VEGF containing scaffolds 2.2.1 Preparation of PLGA microspheres In this study, PLGA microspheres were prepared via a double-emulsion-solvent evaporation technique (water-in-oil-in-water, w/o/w).30 200 μL of BMP-2 (10 μg) solution was added dropwise to a solution of 3 mL of methylene chloride containing 300 mg amount of PLGA under sterile conditions, followed by sonication to form the water-in-oil (w/o) emulsion. The emulsion was then added to 100 mL of 0.5% PVA aqueous solution (w/v) under intense stirring to form the water-in-oil-in-water (w/o/w) double emulsion. The BMP-2-loaded microspheres were collected by centrifugation, washed twice with deionized water and vacuum dried into a free flowing powder. The VEGF-loaded microspheres, containing 100 ng VEGF, can also be prepared by the same method. 2.2.2 Fabrication of the composite scaffold The photocrosslinked hydrogels were synthesized as described previously.31 Briefly, 300 mg BMP-2-loaded PLGA microspheres were mixed with gelatin (150 mg/mL), 1 mM [RuII(bpy)3]2+ and 20 mM sodium persulphate (SPS) in the phosphate-buffered saline (PBS)


Page 6 of 34

Page 7 of 34 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


under pH=7.4. The mixture were then dispensed into a Teflon mould (10 mm in diameter and 4 mm in height) and irradiated for 30 s at room temperature with a LED dental curing lamp (460 nm, 1200 mW/cm2 at source, 3 M Epilar FreeLight 2) from a distance of 150 mm. After lyophilized, 200 μL of VEGF (100 ng) solution were adsorbed to the products through the dripping method. Then, the samples were lyophilized again and the resulting scaffolds were stored at -20 °C with desiccant for further application. As to the SCS-modified scaffold, it was obtained via using 2 μg/mL SCS solution instead of PBS during the preparation of gelatin solution. Four study groups of scaffolds were prepared: (1) BMP-2 loaded PLGA microspheres, photopolymerisable hydrogel encapsulated with VEGF (V/B); (2) BMP-2 loaded PLGA microspheres, photopolymerisable hydrogel encapsulated with VEGF and incorporating SCS (S-V/B); (3) VEGF loaded PLGA microspheres, photopolymerisable hydrogel encapsulated with BMP-2 (B/V); (4) VEGF loaded PLGA microspheres, photopolymerisable hydrogel encapsulated with BMP-2 and incorporating SCS (S-B/V). 2.3 Morphology observations To observe the morphology of PLGA microspheres and scaffolds, the samples were examined under a scanning electron microscope (SEM; S-3400, Hitachi, Tokyo, Japan) operated at 15 kV. After lyophilization, specimens were broken in liquid nitrogen to expose inner structure. The uniformly dispersed microspheres and the cross-sections of the scaffolds were sputter coated with gold for 60 s before scanning. 2.4 Loading efficiency and encapsulation efficiency of BMP-2 and VEGF Lyophilized composite scaffolds were swelled in PBS and vortexed for 30 min. The mixture was then centrifuged at 15000 rpm for 20 min at room temperature to extract encapsulated BMP-2 and VEGF. The amount of growth factors actually loaded within the gelatin hydrogels and microspheres were analyzed through measuring BMP-2 and VEGF content in the supernatants using ELISA kit (Neobioscience Technology, Shanghai, China). Each sample was assayed in quintuplicate (n=5). The protein loading efficiency and



encapsulation efficiency were calculated by the following equations: Protein loading efficiency (%) = Pa/Mt × 100 Protein encapsulation efficiency (%) = Pa/Wt × 100 where, Pa is the actual amount of BMP-2 or VEGF encapsulated into gelatin hydrogels or microspheres, and Wt is the theoretical amount of BMP-2 or VEGF; Mt is the weight of gelatin hydrogels or microspheres. 2.5 In vitro releasing measurement To quantify the release of VEGF and BMP-2 from the scaffold in vitro, the VEGF and BMP-2-loaded samples were put into 1 mL of pH 7.4 PBS in a 24-well plate, and maintained at 37 °C in a humidified atmosphere of 5% CO2 partial pressure, with constant agitation at 15 rpm. The release medium was collected at a series of predetermined time points and replenished using the same volume of fresh buffer. The VEGF and BMP-2 concentrations in the collected medium were assayed using a VEGF and BMP-2 ELISA kit (Neobioscience Technology, Shanghai, China) according to the manufacturer's instructions. Each sample was performed in triplicate for each time point (n=5). Cumulative release is expressed as a percentage of the total loaded protein. 2.6 Biocompatibility 2.6.1 Cell Viability on scaffolds Prior to the cell culture work, the vacant scaffolds were sterilized under UV, followed by immersion in the basal culture medium (DMEM with 10% fetal bovine serum) containing 1% penicillin-streptomycin at 37 °C, 5% CO2 partial pressure, in a humidified environment overnight. MC3T3-E1 cells were seeded onto the gelatin scaffolds (Gel) and the complex scaffolds (Gel/PMs) at a density of 2 × 104 cells/mL. Cell viability was visualized using a live/dead assay kit (Abcam, Cambridge, U.K.) after MC3T3-E1 cells culturing on the scaffolds for 24 h, following the standard protocol provided by the manufacturer. In brief, scaffolds and cells were firstly washed twice with sterile PBS, then incubated in standard


Page 8 of 34

Page 9 of 34 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


working reagent at 37 °C for 20 min. The Gel and Gel/PMs scaffolds were finally washed twice with PBS and studied under the confocal laser scanning microscopy (CLSM, A1, Nikon, Japan). 2.6.2 Cell Adhesion and Morphology. Cell attachment and spreading were visualized using confocal laser scanning microscopy. MC3T3-E1 cells were seeded into scaffolds in a 24-well plate at a density of 5 × 104 cells/mL. After 12 h incubation, samples were washed with PBS twice and fixed with 2.5% glutaraldehyde, and permeabilized with 0.1% Triton X-100. Cytoskeleton was stained with FITC-labeled phalloidin for 35 min. The samples were washed with PBS twice, and then DAPI solution was added to stain cell nuclei for 15 min (n=5). 2.7 Ectopic bone formation study in vivo 2.7.1 Scaffold implantation and surgical procedure All procedures were approved and performed in accordance with the guidelines of the Institutional Animal Care and Use Committee of National Tissue Engineering Center (Shanghai, China) and the guide for the Care and Use of Laboratory Animals. 5-week-old male C57BL/6 mice (Silaike Inc. Shanghai, China) with an average weight of 20 g were used in ectopic bone formation. To investigate the effect of different delivery sequences of BMP-2-VEGF and SCS incorporation on angiogenesis and osteogenesis, three groups were prepared after optimization: (I) BMP-2-loaded PLGA microspheres, gelatin encapsulated with VEGF (V/B); (II) VEGF-loaded PLGA microspheres, gelatin encapsulated with BMP-2 (B/V); (III) VEGF-loaded PLGA microspheres, gelatin encapsulated with BMP-2 and SCS (S-B/V). The specific experimental dose is shown in Table 1. Implants were placed in the muscle pouches of both hind limbs of each mouse. In brief, after anesthesia with an intraperitoneal injection of sodium pentobarbital, a 5-mm longitudinal incision along the hind limb was made, and a 4-mm deep pocket was created by separating muscle fibers within biceps femoris. Scaffolds were implanted into the created



Page 10 of 34

muscle pouches.

Table.1 Experimental groups for in vivo bone formation Group

PLGA microspheres

Gelatin

V/B

10 μg BMP-2

100 ng VEGF

B/V

100 ng VEGF

10 μg BMP-2

S-B/V

100 ng VEGF

10 μg BMP-2 + 10 μg SCS

2.7.2 Radiological examination To track the new bone formation process, X-ray images were collected using an in vivo imaging system (Animal Heater OUS, Bruker, USA) after 7, 14 and 28 days of implantation. Bone mineral density of regenerated tissue was calculated using the grey scale which is displayed automatically by the digital X-ray imaging system. Bone mineral density of ectopic bone was normalized to the bone mineral density of autogenous bone. The mice (replicates of 5 from each group) were euthanized at scheduled times, and the implants were retrieved to investigate ectopic bone formation. At each scheduled time, three specimens from each group were weighed for both wet bone and ash content (incinerated in a muffle furnace, 800 °C, 4 h). 2.7.3 Quantitative real-time polymerase chain reaction (qRT-PCR) analysis Osteogenic and angiogenic-related gene expressions of the ectopic bone were measured by a real-time quantitative reverse transcription-polymerase chain reaction (qRT-PCR) system (BioRad, Hercules, CA, USA). Briefly, after removing the surrounding soft tissue, the explants were frozen by liquid nitrogen and ground into powder by a grinding rod in RNase-free crucibles as soon as possible. The powder was then been lysed by using RNAiso plus (Takara, Tokyo, Japan). The total messenger RNA (mRNA) was extracted from the lysed solution according to the manufacturer's protocol, and subsequently complementary


Page 11 of 34 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


DNA (cDNA) was synthesized with PrimeScript RT reagent Kit (Takara). Then diluted cDNA was mixed with SYBR Premix Ex Taq™ (Takara, Tokyo, Japan), forward and reverse primers and RNase free water to perform qRT-PCR. Osteogenic differentiation markers: bone sialoprotein (BSP), alkaline phosphatase (ALP), and angiogenesis-related markers: platelet endothelial cell adhesion molecule (PECAM; also known as CD31), von Willebrand factor (vWF) were evaluated. The housekeeping gene glyceraldehyde-3-phosphate dehydrogenase (GAPDH), a template-free negative control, was included in each experiment. The forward and reverse primer sequences used in this study are listed in Table 2. All the samples were assayed in triplicate. Table.2 Quantitative real-time RT-PCR primer sets Gene

Direction

Sequence (5’-3’)

ALP

Forward

CCAACTCTTTTGTGCCAGAGA

Reverse

GGCTACATTGGTGTTGAGCTTTT

Forward

CTCGGGTGTAACAGC

Reverse

CGTTCAGAAGGACAGCT

Forward

ACGCTGGTGCTCTATGCAAG

Reverse

TCAGTTGCTGCCCATTCATCA

Forward

CTTCTGTACGCCTCAGCTATG

Reverse

GCCGTTGTAATTCCCACACAAG

Forward

ACTTTGTCAAGCTCATTTCC

Reverse

TGCAGCGAACTTTATTGATG

BSP

PECAM

vWF

GAPDH

2.7.4 Histological staining The extracted bones were fixed with 4% paraformaldehyde, decalcified in 14% w/v EDTA at 4 °C, dehydrated in a graded series of alcohol, paraffin embedded and sectioned



(4.5 μm thickness). Serial sections were deparaffinized, and stained with hematoxylin/ eosin (HE) and masson's trichrome, respectively. For the tissue structure analysis, the stained sections were examined under a light inverted microscope (TE2000U, Nikon, Japan). 2.7.5 Immunohistochemical (IHC) staining Immunostaining for CD31 was performed on the sections to identify blood vessels. Briefly, paraffin sections were dewaxed in a series of xylene and rehydrated in gradient ethanol. Then, the rehydrated slides underwent antigen retrieval using 0.01 M sodium citrate solution (pH=6.0). Next, 5% BSA blocking solution was added, and the excessive liquid was abandoned after incubation for 10 min at 4 °C. The sections were incubated with the primary antibody against CD31 (1 : 100 dilution; Abcam, Cambridge, UK) at 4 °C overnight, followed by incubating with a HRP conjugated secondary antibody (1 : 250 dilution; Abcam, Cambridge, UK) at 37 °C for 40 min. The sections were then stained with a DAB kit (AR1022, Boster, China) at room temperature, and treated with hematoxylin. The positive expressions for CD31 were observed under a light inverted microscope (TE2000U, Nikon, Japan) and manually counted using Image J. 2.8 Statistical analysis All quantitative data were expressed as the mean ± SD (standard deviation) and analyzed with Origin 8.5 (OriginLab Corp., Northhampton, MA, USA). Statistical comparisons were carried out using one-way analysis of variance (ANOVA). Statistical significance was attained at greater than the 95% confidence level (p < 0.05).

3. RESULTS AND DISCUSSION 3.1 Morphology observation of microsphere and scaffold The SEM and bright field images of PLGA microspheres are shown in Fig. 1A and B. The microspheres, with smooth surfaces, possessed the regular spherical particles with diameters of about 20 μm and had a good dispersion in the gelatin solution. The dynamic laser light scattering further revealed that the size distribution of the microspheres was mainly


Page 12 of 34

Page 13 of 34 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


in the range of 15 to 25 μm. SEM analysis on the cross sections of the composite scaffold confirmed that the gelatin hydrogel, in the dry state, had a porous microstructure with pore size of about 100 μm as well as smooth pore walls (Fig. 1C). It is observed from the Fig. 1D that PLGA microspheres, encapsulated into the gelatin, had a good spatial distribution, suggesting that the microspheres and dissolved gelatin blended well. On the other hand, the microspheres showed well-preserved, rounded individual particles without aberrant shapes; this indicated an excellent stability.

Fig. 1. Analysis of the micro-morphology characteristics on PLGA microspheres and Gel/PMs scaffolds. SEM (A) and optical micrographs (B) of PLGA microspheres. Scale bar equals 20 μm. (C) Fracture morphology shows macroporous structure of Gel/PMs scaffold; scale bar equals 100 μm. (D) A higher magnification, of the selected area (red dotted rectangle), exhibits residence of PLGA microspheres in the gelatin hydrogel; scale bar equals 20 μm.

3.2 In vitro releasing behaviors of VEGF and BMP-2 Based on the calculation, the BMP-2 and VEGF loading efficiencies of gelatin hydrogel were 0.15 ± 0.02% and 0.0026 ± 0.0003%, respectively, and the encapsulation efficiencies were 97 ± 1.51% and 98 ± 1.16%, respectively. Also, the loading efficiencies of BMP-2 and VEGF from PLGA microspheres were 0.8 ± 0.03% and 0.009 ± 0.0005%, respectively, and the encapsulation efficiencies were 84 ± 3.07% and 88 ± 2.26%, respectively. This result implies that the Gel/PMs scaffold has a relatively superior encapsulation ability of growth factor. Furthermore, the release profiles of BMP-2 and VEGF from the Gel/PMs scaffold



loaded with BMP-2, VEGF and/or SCS in vitro were investigated using the corresponding ELISA kits. Fig. 2A reflects the cumulative release of two growth factors from the V/B group and S-V/B group when incubated in vitro. Group V/B showed an obviously burst release of VEGF at about 42% during the initial stage (the first day); and the release was nearly 80% of total VEGF after 14 days. In contrast, the overall release of BMP-2 from the PLGA microspheres was comparatively slow; a less burst release, 10% of total BMP-2 release, was identified for the first day, and the BMP-2 was sustained release for as long as four weeks. On the eighth day, approximately 70% of VEGF was released from the V/B scaffold, whereas the remaining percent of BMP-2 was more than 50%. By this token, the growth factors, loading in the different locations, can achieve the different release rates. This is mainly because the carrier materials have different properties. In the early days, the gelatin hydrogel rapidly swelled in an aqueous environment at body temperature, and exhibited abrupt and fast release of VEGF. During the later stage, the release of VEGF primarily depended on the degradation of gelatin hydrogel, thus slowing down the burst release of VEGF. Due to a low wettability of PLGA microspheres, the encapsulated BMP-2 was releasing mainly through the degradation and disintegration of microspheres, significantly reducing the burst release of BMP-2. This result indicates that the composite scaffold can realize the sequential release of two growth factors. Based on our previous study, SCS, a sulfonated heparin-like polysaccharide, can bind to cytokine possessing a heparin binding site via spatially matching electrostatic interactions.32 Compared to group V/B, the release rate of VEGF and BMP-2 was slowed down in the S-V/B group due to the addition of SCS; on day four, the release of VEGF was decreased by 10%, and the releasing percent of BMP-2 on day ten was reduced to around 12%. This change suggests that decelerated diffusion and promoted local retention of growth factors were successfully realized via introduction of SCS. By exchanging the loaded position of two growth factors, the corresponding release profiles from the composite hydrogel were plotted in Fig. 2B. As expected, the B/V group showed an initial burst release of BMP-2 during the


Page 14 of 34

Page 15 of 34 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


first 24 h, and the VEGF loaded in the PLGA microspheres exhibited marked sustained-release property. Just like group S-V/B, the incorporation of SCS could further lower the growth factors release.

Fig. 2. Cumulative releasing profiles of BMP-2 and VEGF from different systems. (A) V/B and S-V/B scaffolds; (B) B/V and S-B/V scaffolds.

3.3 Cell affinity The cell viability of the singular gelatin scaffold (Gel), the complex scaffold (Gel/PMs) and SCS modified complex scaffold (S-Gel/PMs) were evaluated by visible cellular responses of MC3T3-E1 cells co-cultured with different scaffolds according to the live/dead assay. As displayed in Fig. 3A, more live cells (stained green) could be observed on Gel/PMs and S-Gel/PMs scaffolds than that on Gel scaffold, and the dead cells (stained red) on scaffold S-Gel/PMs were fewer. This implies that the composite scaffold has a good ability to support cell survival and growth. Cell attachment is the first step of the cell-biomaterial interaction, which could be directly affected by the surface of the substrate, and further exerts effects on cell fate. Fig. 3B displays representative microscopy images of MC3T3-E1 cells seeded on the surface of Gel/PMs scaffold after cultured for 12 h. It could be seen that large number of cells were attached onto the Gel/PMs scaffolds. What is more, MC3T3-E1 cells on the Gel/PMs scaffold were elongated and well-spread with significant outstretched filopodia extensions and lamellipodia protrusions, as displayed in the magnified images. This might be attributed to a desirable cell adhesive ability of porous topography. A porous surface makes for mechanical interlocking between the implant and surrounding cells. Moreover, interconnected



macroporous structure facilitates cell migration, nutrient delivery, bone ingrowth and vascularization.33 This further suggests that the composite hydrogel (Gel/PMs) has a promising potential for cell adhesion and excellent biocompatibility.

Fig. 3. Cell viability and attachment of MC3T3-E1 cells on the Gel/PMs scaffolds. (A) Live/dead images of MC3T3-E1 cells cultured on Gel, Gel/PMs and S-Gel/PMs scaffolds for 24 h showing merge of live and dead cells (left) and dead cells only (right) (white arrow, dead cells), scale bar equals 200 μm. (B) Cell attachment and morphology of MC3T3-E1 cells on the Gel/PMs scaffolds after 12 h of culture. The cytoskeleton stained with FITC-Phalloidin (green) and the nuclei stained with DAPI (blue). Scale bar equals 20 μm.


Page 16 of 34

Page 17 of 34 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


3.4 Osteogenesis and angiogenesis of ectopic bone in vivo 3.4.1 Evaluations of ectopic bone formation We serially evaluated in vivo ectopic bone formation induced by the V/B, B/V and S-B/V implants placed in the thigh muscle pouches of mice 1, 2, and 4 weeks post-implantation. As shown in Fig. 4, since tissue blocks enwrapping residual implant formed no bone structure in week one, there was no significant difference in bone wet weight and ash content between the three groups. In week two, the formation of bone-like tissue was found in each group, but the B/V group (0.378 ± 0.03 g and 0.0344 ± 0.003 g, respectively) exhibited higher wet weight and ash weight than the V/B group (0.266 ± 0.03 g and 0.0254 ± 0.003 g, respectively). This indicates that a rapid release of BMP-2 in the early stage facilitates new bone formation. With the scaffold gradually showed its advantage in the capacity of controlled release of BMP-2, the bone formation content in the V/B group was significantly increasing. In week four, compared to datum of two weeks ago, bone wet weight and ash weight increased by 36% and 30% in the V/B group (0.346 ± 0.04 g and 0.0345 ± 0.0035 g), which close to the B/V group. In order to further optimize the delivery system, the effect of introducing SCS on osteogenesis in vivo was evaluated via preparing group S-B/V. As intuitively seen from Fig. 4, in week two, bone wet weight and ash weight in the S-B/V group (0.3965 ± 0.0401 g and 0.0349 ± 0.0039 g, respectively) were slightly higher than that in the B/V group. It is mentionable that although group B/V released more active protein than group S-B/V at this time point, the S-B/V group exhibited higher wet weight and ash weight than the B/V group. Consistent with our previous study, the bone forming effect of BMP-2 was enhanced by the addition of SCS.26 In week four, bone wet weight and ash weight were significantly elevated in group S-B/V (0.421 ± 0.0369 g and 0.0564 ± 0.00268 g, respectively) compared with that in group B/V. This result implies that the enhancing effect of SCS involves improvement of the outcome of bone regeneration stimulated by BMP-2 in vivo.



Fig. 4. (A) Wet weight and (B) ash weight of ectopic bone induced by V/B, B/V and S-B/V scaffolds in week one, week two and week four. The asterisk (*) and dollar symbol ($) denote significant differences (p < 0.05) compared to V/B group and B/V group, respectively.

To monitor mineralization in the implanted scaffolds, all the mice were observed under in vivo imaging system (IVIS) machine at various time-points (Fig. 5A). As early as week one, the cartilage-like tissue had been formed in the S-B/V group, whereas in the V/B and B/V groups, the osteoid tissue did not appear at this time point; this suggested the accelerative effect of SCS on inducing cartilage formation. In the following week, the obvious ossification was detected in both B/V and S-B/V groups from X-ray scanning, while mineralized bone was less in the V/B group. Four weeks post implantation, the mineralized amount was elevated in the V/B group, but it was still at a lower level than the other two groups. Moreover, group S-B/V had a highest density of newly mineralized bone in all groups from the image gray-scale value, showing as extensive mineralization as that of autogenous bone (Fig. 5B). These data indicate that the rapid induction of mineralized bone formation can be obtained by the prior release of BMP-2 in the B/V group; in addition, introducing SCS has a prominent effect on enhancing pro-osteogenesis efficiency of BMP-2.


Page 18 of 34

Page 19 of 34 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Fig. 5. (A) X-ray images of ectopic bone of mice one week, two weeks, and four weeks post-implantation, and evaluation of the extent of ossification. (B) Bone mineral density of ectopic bone was normalized to the bone mineral density of autogenous bone. Asterisks (*) and dollar symbols ($) denote significant differences (p < 0.05) compared to V/B group and B/V group, respectively.

3.4.2 Angiogenic and osteogenic genes expression of the ectopic bone To further understand the effect of different release sequences of BMP-2-VEGF on a genetic level, and the enhancing process of SCS, we isolated mRNA from the ectopic bones and examined the expression levels of several osteogenesis and angiogenesis related genes (Fig. 6). The catalytic activity of ALP is closely related to the calcification of bone;34 BSP, serving as a matrix-associated signal, can directly promote osteoblast differentiation, and



result in the increased production of mineralized bone.35 One week post implantation, the expression levels of ALP and BSP genes were significantly up-regulated in the B/V group compared to group V/B. PECAM (also known as CD31), as a regulator of endothelial junctional integrity, can significantly promote endothelial cell mitosis and sprouting, increase vascular permeability, and play an important role in pro-angiogenesis, as well as the repair process of tissue injury.36 vWF is also an important angiogenesis regulator, which can modulate normal angiogenesis.37 The V/B group exhibited a higher expression of these two genes than the B/V group at this time point. This is mainly due to the first release of BMP-2 (VEGF) from the B/V group (the V/B group), which promotes the expression of genes related to osteogenesis and angiogenesis, respectively. In week two, ALP and BSP expressions were further increased in the B/V group, marking the mineralization of osteoblasts; then dropped in week four, because of almost finished release totally of BMP-2 from the hydrogel. Correspondingly, with the gradual release of VEGF from the PLGA microspheres in scaffold B/V, the expressions of both PECAM and vWF were upraised in week two, and kept increasing till week four. This confirmed that the composite scaffold stimulated the osteogenic differentiation and vascularization in a sequential release manner of BMP-2 and VEGF during the ectopic bone formation. We also observed the changes of osteogenesis and angiogenesis-related genes when SCS was introduced. The expressions of ALP and BSP were further up-regulated in the S-B/V group compared to the B/V group. Especially one week post implantation, the expression of ALP was upraised more than two-fold when SCS was added. This change indicates that incorporation of SCS could amplify the ALP signaling potency. As above mentioned, BSP has been reported to be closely associated with osteocalcin synthesis of osteoblast lineage cells. In addition, BSP is also considered to possess the capability of angiogenesis,38 suggesting that at the early stage, in the case of BMP-2 release alone, the addition of SCS enhances the pro-angiogenic effect of BMP-2. Moreover, our previous study had shown that SCS could enhance the angiogenic effect of BMP-2 through elevating endogenous VEGF


Page 20 of 34

Page 21 of 34 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


secretion as well.27 Hence, the gene expressions of PECAM and vWF were also upraised at this time point when SCS was added. In week four, BMP-2 from the gelatin hydrogel had been completely released both in B/V and S-B/V groups, which only released VEGF at this time point. We found that PECAM and vWF expressions were significantly up-regulated with SCS treatment compared to group B/V. Fluctuations in these molecules imply that the presence of SCS positively influenced VEGF induced angiogenesis.

Fig. 6. Quantitative real-time PCR analysis of both angiogenesis-related and osteogenesis-related gene expressions in the ectopic bone in week one, week two and week four post-implantation. GAPDH was used as a housekeeping gene. Asterisks (*) denote a significant difference (p < 0.05) as compared to the V/B group; pound symbols (#) denote p < 0.05 as compared to the B/V group.

3.4.3 Histological findings in ectopic bone



Histologically, ectopic bone is thought to develop via the process of endochondral ossification involving four stages: inflammation, chondrogenesis, osteogenesis, and maturation.39 Varieties of cells participate in ectopic bone formation, including tissue resident mesenchymal, vascular, circulating, hematopoietic, and bone marrow-derived cells modulated by intricate signaling pathways.40 HE staining was performed on the sections of ectopic bones (Fig. 7). As early as day three, blood cells, which may be related to inflammation, invaded into the inner part of the material, and all of the groups were surrounded by fibrous tissue (data not shown). One week after implantation, the cartilage structure, as a precursor of bone, could be observed in the S-B/V group, but there was no significant bone tissue development in the other two groups. In the following week, new bone was visible in both B/V and S-B/V groups, almost no cartilage left; especially in the S-B/V group, the bone trabeculae structure was more salient. By comparison, a substantial amount of cartilage still remained in the V/B group, suggesting a slow cartilage removal in the V/B group in contrast to the other two groups. A previous study indicated that only application of exogenous VEGF did not promote bone regeneration when endogenous VEGF levels were normal.14 Hence, the early VEGF release, preceding the BMP-2-activated osteogenesis, may contribute little to the enhanced bone formation. Four weeks after implantation, group B/V and group S-B/V exhibited larger area of transformed lamellar bone than the V/B group, and the S-B/V group showed the most extensive, mature and thickest lamellar bone. Angiogenesis is also perceptible at this time point, and its number is greater in group B/V than that in group V/B. Abundant blood vessels with blood cells inside are developed. In contrast to the other two groups, the vascular architecture produced in group S-B/V is apparently more mature, indicating an extensive and complete formation of microvascular network.


Page 22 of 34

Page 23 of 34 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Fig. 7. Histological evaluation of ectopic bone sections one week, two weeks, and four weeks post-implantation for V/B, B/V and S-B/V by HE staining. (F: fibrous capsule, CC: chondrocytes, NB: new bone, BC: blood cell, LB: lamellar bone, yellow arrow: bone trabeculae, black arrow: capillary and black circle: mesenchymal cell).

Masson's trichrome staining was also performed to gain more comprehensive details of the new bone (Fig. 8). The basic results, regarding the time point of cartilage emergence, bone formation, and angiogenic responses, were consistent with HE staining; furthermore, additional information was also obtained. In week one, obvious vascular structure started to appear in the V/B group because of the fast release of VEGF at preliminary stage. Notably, we also found salient blood vessels invasion in the S-B/V group; this confirmed the enhancing effect of SCS on the angiogenesis of BMP-2. By week two, compared to the B/V group, much more trabecular bone and bone marrow rich in blood cells were clearly observable in the S-B/V group, with completely integrated bone structure established. However, the V/B group remained as cartilage turnover phase devoid of pronounced bone structure formation. This is mainly due to the fact that endochondral ossification, beginning from avascular cartilage anlagen, is extensively vascularized only during the subsequent bone



transformation, which means that the endochondral healing of bone defects is less dependent on an initial vascular supply.12, 41 In week four, in the B/V group, randomly oriented woven bone was gradually translated into compact and stress oriented lamellar bone, and a medullar cavity was formed. Particularly, the S-B/V group exhibited the most mature lamellar bone tissue and bone marrow cavity with abundant mature red and yellow marrow, including medulla ossium flava and medulla ossium rubra. In the V/B group, none of these structures were fully constructed, with little mature bone structure formation.

Fig. 8. Masson trichrome staining of ectopic bone sections. (F: fibrous capsule, CC: chondrocytes, NB: new bone, LB: lamellar bone, yellow arrow: bone trabeculae, black arrow: capillary, yellow circle: medulla ossium flava, green circle: medulla ossium rubra).

In summary, although bone wet weight and ash weight, at a later stage, had no significant difference between B/V and V/B groups, the B/V group induced more rapid formation of ectopic bone during the early stage, implying the expedite effect of incipiently fast releasing of BMP-2. Moreover, compared to the V/B group, more rapid induction of mineralized bone formation and higher mineralized bone amount could be found in the B/V group through X-ray imaging. In addition, the data, obtained from the qRT-PCR study in vivo,


Page 24 of 34

Page 25 of 34 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


showed the fluctuations of osteogenic and angiogenic genes. In the early stage, especially week two, expressions of ALP and BSP in the B/V group were all higher than that in the V/B group, which is unsurprising given the large release of BMP-2 in group B/V. As commonly accepted, VEGF played an important role in the signaling of angiogenic effect. Group B/V had less VEGF release than group V/B at this time point, while the expression levels of both PECAM and vWF were similar in these two groups. This meant group B/V had high angiogenic genes expression in the case of less VEGF release. We attributed this up-regulating expression of angiogenic genes to the angiogenic capacity of BMP-2 itself. Histopathological analysis further indicated that although significant vasculogenesis was observed at early stage through the priority release of VEGF, the density of blood vessels in ectopic bone gradually decreased after the complete VEGF release, which led to the slow bone developing process. However, the prior release of BMP-2 at the initial stage could not only earlier activate the osteogenic differentiation and facilitate rapid bone regeneration, but also promote vascularization response; the sustained release of VEGF during the later stage assisted sufficient angiogenesis and promoted mature bone formation. Furthermore, SCS could facilitate rapid bone transformation by BMP-2 and enhance the angiogenic effect of BMP-2 and VEGF during the tissue regeneration, achieving a higher efficiency of bone regeneration. 3.4.4 Immunohistochemistry examination To evaluate the degree of angiogenesis in and around the ectopic bone, the total vessel density and percentage area occupied by vessels were measured using immunochemical staining anti-CD31 (Fig. 9). One week post implantation, compared to the other groups, a dense network of microvascularization tubular structure could be observed in the V/B group due to the prior release of VEGF. Furthermore, at this time point, the S-B/V group showed a significantly higher positive expression of CD31 than the B/V group, suggesting that the angiogenic effect of BMP-2 was improved when SCS was involved. In week two, the S-B/V group showed a higher density of blood vessels interspersed in the ectopic bone than the B/V



group. This enhancement persisted throughout the noted period, which further confirmed the improved angiogenic invasion of SCS. Compared to the S-B/V groups, the vessel density and area showed an opposite results in the V/B group at this time point (Fig. 9B and C), which meant that with the complete release of VEGF in the V/B group, the original blood vessels exhibited mature, whereas a smaller number of neo-blood vessels formed. In week four, the B/V group had a 1.6-fold increase in vessel density and 1.5-fold increase in vessel area relative to the V/B group, respectively. This phenomenon was due to a sustained release of VEGF from the B/V scaffold in the later stage, resulting in an elevated blood vessel invasion. As a result, the B/V group can continuously induce neo-blood vessels formation in vivo and maintain a rich vascular network, providing sufficient oxygen and nutrients to facilitate growth, differentiation, and tissue functionality; this is of particular importance for bone regeneration. In addition, introducing SCS could further improve the vessel system of the generated bone and achieve a rapid angiogenic invasion.


Page 26 of 34

Page 27 of 34 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Fig. 9. (A) Immunohistochemistry anti-CD31 staining of ectopic bone section. The statistical analysis of blood vessels: quantification of vessel density (B) and average vessel area (C). Asterisks (*) and dollar symbols ($) denote significant differences (p < 0.05) compared to V/B group and B/V group, respectively.

4. CONCLUSION In the present study, we designed a composite scaffold (Gel/PMs) as a model with the capability to investigate the sequential release of dual growth factors expediently. Two important bone formation-related growth factors, BMP-2 and VEGF, were incorporated in disparate vehicles to acquire two distinct releasing patterns: B/V and V/B. In vivo osteogenesis and angiogengsis effectiveness were evaluated via ectopic bone formation in



Page 28 of 34

mice. The results showed that prior release of BMP-2 at the initial stage followed by sustained release of VEGF during the later stage (B/V mode) was better for rapid bone regeneration. Fast releasing of BMP-2 made for rapid initiation of osteogenesis; while later VEGF release guaranteed persistent angiogenesis, which played an important role in the new bone formation and maturation. Moreover, introducing SCS was confirmed to accelerate the endochondral ossification and promote angiogenesis. Thus, this work affords a new sight to design bone-repairing biomaterials with high regenerative efficiency. Moreover, the composite vehicle constructed with hydrogels and microspheres can supply a valid tool to assess the spatio-temporal effect of multi cytokines during regeneration. Future studies are required to optimize the spatio-temporal distribution of BMP-2 and VEGF to augment bone regeneration under more efficient and safe dose.

ACKNOWLEDGEMENTS The authors wish to express their gratitude to the financial supports from the National Natural Science Foundation of China (No.31330028, No.31470923, and 31870953), National Natural Science Foundation of China for Innovative Research Groups (No. 51621002), International Cooperation Project and Research Project of Shanghai Science and Technique Committee (15520711100, 15DZ1942502). This study is also supported by 111 Project (B14018).

AUTHOR INFORMATION Corresponding Authors * East China University of Science and Technology, No 130, Meilong Road, Shanghai 200237,

P.R.

China.

Tel.:

+86-20-64251358.

Fax:

+86-21-64251358.

Email:

[email protected] (Jing Wang); [email protected] (Changsheng Liu).

REFERENCES (1) Dimitriou, R.; Jones, E.; McGonagle, D.; Giannoudis, P. V. Bone regeneration: current


Page 29 of 34 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


concepts and future directions. Bmc Medicine 2011, 9 (1), 66. DOI: 10.1186/1741-7015-9-66 (2) Gomez-Barrena, E.; Rosset, P.; Lozano, D.; Stanovici, J.; Ermthaller, C.; Gerbhard, F. Bone fracture healing: cell therapy in delayed unions and nonunions. Bone 2015, 70, 93-101. DOI: 10.1016/j.bone.2014.07.033 (3) Agarwal, R.; Garcia, A. J. Biomaterial strategies for engineering implants for enhanced osseointegration and bone repair. Advanced Drug Delivery Reviews 2015, 94, 53-62. DOI: 10.1016/j.addr.2015.03.013 (4) Anderson, J. M.; Patterson, J. L.; Vines, J. B.; Javed, A.; Gilbert, S. R.; Jun, H.-W. Biphasic peptide amphiphile nanomatrix embedded with hydroxyapatite nanoparticles for stimulated osteoinductive response. Acs Nano 2011, 5 (12), 9463-9479. DOI: 10.1021/nn203247m (5) Fernandez-Yague, M. A.; Abbah, S. A.; McNamara, L.; Zeugolis, D. I.; Pandit, A.; Biggs, M. J. Biomimetic approaches in bone tissue engineering: integrating biological and physicomechanical strategies. Advanced Drug Delivery Reviews 2015, 84, 1-29. DOI: 10.1016/j.addr.2014.09.005 (6) Saran, U.; Piperni, S. G.; Chatterjee, S. Role of angiogenesis in bone repair. Archives of Biochemistry and Biophysics 2014, 561, 109-117. DOI: 10.1016/j.abb.2014.07.006 (7) Chen, G.; Deng, C.; Li, Y.-P. TGF-beta and BMP signaling in osteoblast differentiation and bone formation. International Journal of Biological Sciences 2012, 8 (2), 272-288. DOI: 10.7150/ijbs.2929 (8) Nombela-Arrieta, C.; Ritz, J.; Silberstein, L. E. The elusive nature and function of mesenchymal stem cells. Nature Reviews Molecular Cell Biology 2011, 12 (2), 126-131. DOI: 10.1038/nrm3049 (9) Oryan, A.; Alidadi, S.; Moshiri, A.; Bigham-Sadegh, A. Bone morphogenetic proteins: a powerful osteoinductive compound with non-negligible side effects and limitations. Biofactors 2014, 40 (5), 459-481. DOI: 10.1002/biof.1177 (10) Rutkovskiy, A.; Stenslokken, K.-O.; Vaage, I. J. Osteoblast differentiation at a glance.



Medical science monitor basic research 2016, 22, 95-106. DOI: 10.12659/MSMBR.901142 (11) Kaigler, D.; Krebsbach, P. H.; West, E. R.; Horger, K.; Huang, Y. C.; Mooney, D. J. Endothelial cell modulation of bone marrow stromal cell osteogenic potential. Faseb Journal 2005, 19 (1), 665-667. DOI: 10.1096/fj.04-2529fje (12) Sivaraj, K. K.; Adams, R. H. Blood vessel formation and function in bone. Development 2016, 143 (15), 2706-2715. DOI: 10.1242/dev.136861 (13) Yang, Y.-Q.; Tan, Y.-Y.; Wong, R.; Wenden, A.; Zhang, L.-K.; Rabie, A. B. M. The role of vascular endothelial growth factor in ossification. International Journal of Oral Science 2012, 4 (2), 64-68. DOI: 10.1038/ijos.2012.33 (14) Hu, K.; Olsen, B. R. Osteoblast-derived VEGF regulates osteoblast differentiation and bone formation during bone repair. Journal of Clinical Investigation 2016, 126 (2), 509-526. DOI: 10.1172/JCI82585 (15) Einhorn, T. A.; Gerstenfeld, L. C. Fracture healing: mechanisms and interventions. Nature Reviews Rheumatology 2015, 11 (1), 45-54. DOI: 10.1038/nrrheum.2014.164 (16) Kolambkar, Y. M.; Boerckel, J. D.; Dupont, K. M.; Bajin, M.; Huebsch, N.; Mooney, D. J.; Hutmacher, D. W.; Guldberg, R. E. Spatiotemporal delivery of bone morphogenetic protein enhances functional repair of segmental bone defects. Bone 2011, 49 (3), 485-492. DOI: 10.1016/j.bone.2011.05.010 (17) Kim, S.; Kang, Y.; Krueger, C. A.; Sen, M.; Holcomb, J. B.; Chen, D.; Wenke, J. C.; Yang, Y. Sequential delivery of BMP-2 and IGF-1 using a chitosan gel with gelatin microspheres enhances early osteoblastic differentiation. Acta Biomaterialia 2012, 8 (5), 1768-1777. DOI: 10.1016/j.actbio.2012.01.009 (18) Basmanav, F. B.; Kose, G. T.; Hasirci, V. Sequential growth factor delivery from complexed microspheres for bone tissue engineering. Biomaterials 2008, 29 (31), 4195-4204. DOI: 10.1016/j.biomaterials.2008.07.017 (19) Peng, H. R.; Wright, V.; Usas, A.; Gearhart, B.; Shen, H. C.; Cummins, J.; Huard, J. Synergistic enhancement of bone formation and healing by stem cell-expressed VEGF and


Page 30 of 34

Page 31 of 34 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


bone morphogenetic protein-4. Journal of Clinical Investigation 2002, 110 (6), 751-759. DOI: 10.1172/JCI200215153 (20) Kempen, D. H. R.; Lu, L.; Heijink, A.; Hefferan, T. E.; Creemers, L. B.; Maran, A.; Yaszemski, M. J.; Dhert, W. J. A. Effect of local sequential VEGF and BMP-2 delivery on ectopic and orthotopic bone regeneration. Biomaterials 2009, 30 (14), 2816-2825. DOI: 10.1016/j.biomaterials.2009.01.031 (21) Farokhi, M.; Mottaghitalab, F.; Shokrgozar, M. A.; Ou, K.-L.; Mao, C.; Hosseinkhani, H. Importance of dual delivery systems for bone tissue engineering. Journal of Controlled Release 2016, 225, 152-169. DOI: 10.1016/j.jconrel.2016.01.033 (22) Patel, Z. S.; Young, S.; Tabata, Y.; Jansen, J. A.; Wong, M. E. K.; Mikos, A. G. Dual delivery of an angiogenic and an osteogenic growth factor for bone regeneration in a critical size defect model. Bone 2008, 43 (5), 931-940. DOI: 10.1016/j.bone.2008.06.019 (23) Carragee, E. J.; Hurwitz, E. L.; Weiner, B. K. A critical review of recombinant human bone morphogenetic protein-2 trials in spinal surgery: emerging safety concerns and lessons learned. Spine Journal 2011, 11 (6), 471-491. DOI: 10.1016/j.spinee.2011.04.023 (24) Lee, K.; Silva, E. A.; Mooney, D. J. Growth factor delivery-based tissue engineering: general approaches and a review of recent developments. Journal of the Royal Society Interface 2011, 8 (55), 153-170. DOI: 10.1098/rsif.2010.0223 (25) Chung, Y.-I.; Kim, S.-K.; Lee, Y.-K.; Park, S.-J.; Cho, K.-O.; Yuk, S. H.; Tae, G.; Kim, Y. H. Efficient revascularization by VEGF administration via heparin-functionalized nanoparticle-fibrin complex. Journal of Controlled Release 2010, 143 (3), 282-289. DOI: 10.1016/j.jconrel.2010.01.010 (26) Cao, L.; Wang, J.; Hou, J.; Xing, W.; Liu, C. Vascularization and bone regeneration in a critical sized defect using 2-N,6-O-sulfated chitosan nanoparticles incorporating BMP-2. Biomaterials 2014, 35 (2), 684-698. DOI: 10.1016/j.biomaterials.2013.10.005 (27) Pan, Y.; Chen, J.; Yu, Y.; Dai, K.; Wang, J.; Liu, C. Enhancement of BMP-2-mediated angiogenesis and osteogenesis by 2-N,6-O-sulfated chitosan in bone



Page 32 of 34

regeneration. Biomaterials Science 2018, 6 (2), 431-439. DOI: 10.1039/c7bm01006k (28) Yu, Y.; Chen, R.; Sun, Y.; Pan, Y.; Tang, W.; Zhang, S.; Cao, L.; Yuan, Y.; Wang, J.; Liu, C. Manipulation of VEGF-induced angiogenesis by 2-N, 6-O-sulfated chitosan. Acta Biomaterialia 2018, 71, 510-521. DOI: 10.1016/j.actbio.2018.02.031 (29) Zhou, H.; Qian, J.; Wang, J.; Yao, W.; Liu, C.; Chen, J.; Cao, X. Enhanced bioactivity of bone morphogenetic protein-2 with low dose of 2-N, 6-O-sulfated chitosan in vitro and in vivo. Biomaterials 2009, 30 (9), 1715-1724. DOI: 10.1016/j.biomaterials.2008.12.016 (30) Li, B.; Yoshii, T.; Hafeman, A. E.; Nyman, J. S.; Wenke, J. C.; Guelcher, S. A. The effects of rhBMP-2 released from biodegradable polyurethane/microsphere composite scaffolds on new bone formation in rat femora. Biomaterials 2009, 30 (35), 6768-6779. DOI: 10.1016/j.biomaterials.2009.08.038 (31) Cao, L.; Werkmeister, J. A.; Wang, J.; Glattauer, V.; McLean, K. M.; Liu, C. Bone regeneration using photocrosslinked hydrogel incorporating rhBMP-2 loaded 2-N, 6-O-sulfated chitosan nanoparticles. Biomaterials 2014, 35 (9), 2730-2742. DOI: 10.1016/j.biomaterials.2013.12.028 (32) Brandner, B.; Kurkela, R.; Vihko, P.; Kungl, A. J. Investigating the effect of VEGF glycosylation on glycosaminoglycan binding and protein unfolding. Biochemical and Biophysical

Research

Communications

2006,

340

(3),

836-839.

DOI:

10.1016/j.bbrc.2005.12.079 (33) Loh, Q. L.; Choong, C. Three-dimensional scaffolds for tissue engineering applications: role of porosity and pore size. Tissue Engineering Part B-Reviews 2013, 19 (6), 485-502. DOI: 10.1089/ten.teb.2012.0437 (34) Anderson, H. C.; Sipe, J. B.; Hessle, L.; Dhamyamraju, R.; Atti, E.; Camacho, N. P.; Millán, J. L. Impaired calcification around matrix vesicles of growth plate and bone in alkaline phosphatase-deficient mice. American Journal of Pathology 2004, 164 (3), 841-847. DOI: 10.1016/s0002-9440(10)63172-0 (35) Gordon, J. A. R.; Tye, C. E.; Sampaio, A. V.; Underhill, T. M.; Hunter, G. K.;


Page 33 of 34 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Goldberg, H. A. Bone sialoprotein expression enhances osteoblast differentiation and matrix mineralization in vitro. Bone 2007, 41 (3), 462-473. DOI: 10.1016/j.bone.2007.04.191 (36) Tzima, E.; Irani-Tehrani, M.; Kiosses, W. B.; Dejana, E.; Schultz, D. A.; Engelhardt, B.; Cao, G. Y.; DeLisser, H.; Schwartz, M. A. A mechanosensory complex that mediates the endothelial cell response to fluid shear stress. Nature 2005, 437 (7057), 426-431. DOI: 10.1038/nature03952 (37) Randi, A. M.; Laffan, M. A. Von Willebrand factor and angiogenesis: basic and applied issues. Journal of Thrombosis and Haemostasis 2017, 15 (1), 13-20. DOI: 10.1111/jth.13551 (38) Ogata, Y. Bone sialoprotein and its transcriptional regulatory mechanism. Journal of Periodontal Research 2008, 43 (2), 127-135. DOI: 10.1111/j.1600-0765.2007.01014.x (39) Vanden, B. L.; Vanderstraeten, G. Heterotopic ossification: a review. Journal of Rehabilitation Medicine 2005, 37 (3), 129-136. DOI: 10.1080/16501970510027628 (40) Dey, D.; Bagarova, J.; Hatsell, S. J.; Armstrong, K. A.; Huang, L.; Ermann, J.; Vonner, A. J.; Shen, Y.; Mohedas, A. H.; Lee, A.; Eekhoff, E. M. W.; van Schie, A.; Demay, M. B.; Keller, C.; Wagers, A. J.; Economides, A. N.; Yu, P. B. Two tissue-resident progenitor lineages drive distinct phenotypes of heterotopic ossification. Science Translational Medicine 2016, 8 (366), 366ra163. DOI: 10.1126/scitranslmed.aaf1090 (41) Petersen, A.; Princ, A.; Korus, G.; Ellinghaus, A.; Leemhuis, H.; Herrera, A.; Klaumunzer, A.; Schreivogel, S.; Woloszyk, A.; Schmidt-Bleek, K.; Geissler, S.; Heschel, I.; Duda, G. N. A biomaterial with a channel-like pore architecture induces endochondral healing of bone defects. Nature communications 2018, 9 (1), 4430-4430. DOI: 10.1038/s41467-018-06504-7



For Table of Contents Use Only

Accelerated bone regenerative efficiency by regulating sequential release of BMP-2 and VEGF and synergism with sulfated chitosan Shuang Zhang, Jie Chen, Yuanman Yu, Kai Dai, Jing Wang, and Changsheng Liu


Page 34 of 34

Accelerated bone regenerative efficiency by regulating sequential

Recommend Documents