Activatable QD-Based Near-Infrared Fluorescence Probe for Sensitive

Subscriber access provided by The University of British Columbia Library

Article

Activatable QD-Based Near-Infrared Fluorescence Probe for Sensitive Detection and Imaging of DNA Yizhong Shen, Nan Zhang, Yidan Sun, Wei-Wei Zhao, Deju Ye, Jing-Juan Xu, and Hong-Yuan Chen ACS Appl. Mater. Interfaces, Just Accepted Manuscript • Publication Date (Web): 11 Jul 2017 Downloaded from http://pubs.acs.org on July 11, 2017

Just Accepted “Just Accepted” manuscripts have been peer-reviewed and accepted for publication. They are posted online prior to technical editing, formatting for publication and author proofing. The American Chemical Society provides “Just Accepted” as a free service to the research community to expedite the dissemination of scientific material as soon as possible after acceptance. “Just Accepted” manuscripts appear in full in PDF format accompanied by an HTML abstract. “Just Accepted” manuscripts have been fully peer reviewed, but should not be considered the official version of record. They are accessible to all readers and citable by the Digital Object Identifier (DOI®). “Just Accepted” is an optional service offered to authors. Therefore, the “Just Accepted” Web site may not include all articles that will be published in the journal. After a manuscript is technically edited and formatted, it will be removed from the “Just Accepted” Web site and published as an ASAP article. Note that technical editing may introduce minor changes to the manuscript text and/or graphics which could affect content, and all legal disclaimers and ethical guidelines that apply to the journal pertain. ACS cannot be held responsible for errors or consequences arising from the use of information contained in these “Just Accepted” manuscripts.

ACS Applied Materials & Interfaces is published by the American Chemical Society. 1155 Sixteenth Street N.W., Washington, DC 20036 Published by American Chemical Society. Copyright © American Chemical Society. However, no copyright claim is made to original U.S. Government works, or works produced by employees of any Commonwealth realm Crown government in the course of their duties.

Page 1 of 27

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

ACS Applied Materials & Interfaces

Activatable QD-Based Near-Infrared Fluorescence Probe for Sensitive Detection and Imaging of DNA Yizhong Shen, Nan Zhang, Yidan Sun, Wei-Wei Zhao, Deju Ye,* Jing-Juan Xu and Hong-Yuan Chen*

State Key Laboratory of Analytical Chemistry for Life Science and Collaborative Innovation Center of Chemistry for Life Science, School of Chemistry and Chemical Engineering, Nanjing University, Nanjing 210023, China * Corresponding author. Tel.: +86 25 89684862; fax: +86 25 89684862. E-mail addresses: [email protected] (D. Ye); [email protected] (H. Chen).

KEYWORDS: activatable probe, near-infrared QDs, fluorescence imaging, DNA, photoinduced electron transfer

1

ACS Paragon Plus Environment


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

ABSTRACT Accurate detection of DNA is essential for the precise diagnosis of diseases. Here, we reported an activatable near-infrared (NIR) fluorescence nanoprobe (QD-Al-GFLX) comprising of NIR quantum dots (QDs) and Al(III)-gatifloxacin (Al-GFLX) complexes for the sensitive detection of double-stranded DNA (dsDNA) both in aqueous solution and in living cells. We demonstrated that the initial strong NIR fluorescence of QDs in QD-Al-GFLX was quenched by the Al-GFLX complex via a photoinduced electron transfer (PET) mechanism. Upon interaction with dsDNA, the high binding affinity between dsDNA and Al-GFLX complex could trigger QD-Al-GFLX dissociation, which could eliminate the PET process, resulting in significant enhancement of NIR fluorescence. QD-Al-GFLX was sensitive and specific to detect dsDNA in aqueous solution, with a detection limit of 6.83 ng/mL. The subsequent fluorescence imaging revealed that QD-Al-GFLX hold a high ability to enter into live cells, generating strong NIR fluorescence capable of reporting on dsDNA levels. This study highlighted the potential of using QD-Al-GFLX nanoprobe for the real-time detection and imaging of dsDNA in living cells.

2


Page 2 of 27

Page 3 of 27

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


INTRODUCTION Semiconductor quantum dots (QDs) have been emerging as one of the most explored optically active nanomaterials for biological sensing and molecular imaging due to their prominent optical properties, such as large extinction coefficient, high fluorescence quantum yield, narrow emission wavelength, size tunable fluorescence emission and excellent photostability.1-3 Various QD-based fluorescence probes have been actively developed for the sensitive detection of different biological targets, including metal ions, pH, redox potential and enzymes.4-6 Among them, activatable fluorescence probes that show amplified fluorescence upon interaction with a specific molecular target are particularly attractive as the switch of fluorescence from “off” to “on” could generally provide improved sensitivity and specificity.7-9 Therefore, there is still growing interest in the development of new activatable QD-based nanoprobes to detect various biological targets both in vitro and in vivo. Deoxyribonucleic acid (DNA) is one of the most important biomolecules encoding genetic information and controlling gene expression in biological systems.10-12 It has been recognized that DNA expression is highly variable among different cells (e.g., cancer cells, neuron) or same type of cell under different status (e.g., differentiation, apoptosis). Aberrant DNA levels can generally indicate disease states. As such, accurate detection of DNA can enable distinguishing different cell types or reporting on different cell status, which is helpful for the precise diagnosis of disease.13,14 To date, a large number of analytical methods have been developed for the

determination

of

DNA,

such

as

fluorescence,15

phosphorescence,16

electrochemistry,17 resonance Rayleigh scattering,18 surface plasmon resonance19,20 and chemiluminescence21. Among these, fluorescence that can offer prominent merits in terms of sensitivity and easy operation has attracted much attention. For example, 3



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

He’s group has employed QDs to design several fluorescence probes, providing high sensitivity and specificity to detect DNA in aqueous solution.22-24 In spite of these progresses, the application for the direct imaging of endogenous DNA in live cells is still challenging, presumably due to the low cell uptake which cannot produce sensitive fluorescence signals to tell the DNA concentration. As such, the development of new DNA activatable fluorescence probes capable of reporting on DNA levels in live cells is highly demanded. In this work, we have developed an activatable NIR fluorescence probe (QD-Al-GFLX) based on a NIR fluorescent N-acetyl-L-cysteine (NAC)-coated CdTe QD and an Al(III) coordinated quinolone antibiotics gatifloxacin (Al-GFLX) (Figure 1), and demonstrate its high capacity to detect dsDNA both in aqueous solution and in live cells. We showed that the fluorescence of QD-Al-GFLX was initially quenched via a PET process between QDs and the complexed Al-GFLX. Upon interaction with dsDNA, the strong binding affinity between dsDNA and Al-GFLX could trigger the dissociation of QD-Al-GFLX and liberation of free QDs, resulting in remarkable recovery of NIR fluorescence capable of sensitive and selective detection of dsDNA. Moreover, QD-Al-GFLX exhibited a high ability to enter into live cancer cells, generating strong NIR fluorescence distributed mainly in the nucleus, which was successful for the imaging of endogenous dsDNA inside cells.

EXPERIMENTAL SECTION General materials and methods. All chemicals and biological reagents were purchased from commercial suppliers and used without further purification. N-acetyl-L-cysteine (NAC), tellurium powder, and CdCl2·2.5H2O were purchased from Aladdin Reagent Corporation (Shanghai, China). Al(NO3)3·9H2O, Calf thymus 4


Page 4 of 27

Page 5 of 27

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


DNA (ctDNA), Yeast ribonucleic acid (RNA), human serum albumin (HSA), cysteine, bovine serum albumin (BSA) and ATP were purchased from Sigma-Aldrich Chemical Corporation (St Louis, MO, USA). The single-stranded DNA (ssDNA, TGGAAGGAGGCGTTATGAGGGGGTCCA) was obtained from Shanghai Sangon Biological Engineering Technology and Services (Shanghai, China). Gatifloxacin (GFLX) were purchased from CRM/RM information center of China (Beijing, China). Hoechst 33342 was obtained from KeyGen Biotech. Co. Ltd. (Nanjing, China). The

fluorescence

spectra

were

measured

with

a

Hitachi

F-7000

spectrofluorophotometer (Hitachi Company, Tokyo, Japan) with a 1 cm quartz cuvette. The UV-vis spectra were measured on a UV-3600 spectrophotometer (Shimadzu, Kyoto, Japan). Transmission electron microscopic (TEM) images were acquired with a JEM-2100 transmission electron microscope (JEOL, Ltd., Japan). Atomic force microscope (AFM) images were acquired in tapping mode on a Multimode V AFM with a NanoScope V Controller (Bruker Inc., Germany), and the diameter analysis of nanoparticles were performed with NanoScope Analysis 1.5. Dynamic light scattering (DLS) was measured by 90 Plus/BI-MAS (Brookhaven Instruments, America). Zeta potential analysis was performed on a Zetasizer (Nano-Z, Malvern, UK). Photocurrent was observed on a CHI 660c electrochemical workstation (Shanghai Chenhua Apparatus Co., China) with a three-electrode system: a modified ITO electrode with a geometrical circular area (0.5 cm in diameter) as the working electrode, a Pt wire as the counter electrode, and a saturated Ag/AgCl electrode as the reference electrode. The photoelectrochemical (PEC) measurements were carried out using a homemade PEC system equipped with a 5.0 W light-emitting diode lamp with the emission wavelength of 415 nm. Fluorescence lifetimes were 5



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

detected by a FLS 920 time-resolved spectroscope (Edinberge, UK). Fluorescence images were observed with an Olympus IX73 fluorescent inverted microscope (Olympus, Japan). Preparation of NIR fluorescence NAC-CdTe QDs. The synthesis of NAC-CdTe QDs was according to the previously reported methods with minor modifications.25 Under N2 atmosphere and magnetic stirring, tellurium powder (0.0128 g) reacted with excessive amount of sodium borohydride in D.I. water to produce colorless solution of sodium hydrogen telluride (NaHTe). NAC (15.0 mM) and CdCl2 (12.5 mM) were dissolved in 40.0 mL D.I. water under an ice-water bath, and the pH was carefully adjusted to 10.5 with the addition of NaOH solution (1.0 M). Then, H2Te gas which was generated by the addition of H2SO4 (0.5 M) into the as-prepared NaHTe solution was conducted into the NAC and CdCl2 solution under violent stirring. The molar ratio of Cd: Te: NAC was fixed at a ratio of 1.0 : 0.2 : 1.2. After reaction at room temperature (r.t.) for 10 min, the solution was transferred into a 40.0 mL Teflon-lined stainless steel autoclave and incubated in an oven at 200.0 ºC for 70.0 min to afford the crude NAC-CdTe QDs. In order to remove the residual reagents such as NAC, Cd2+, and Te2-, the crude NAC-CdTe QDs were then carefully purified through triple precipitation process with cold 2-propanol. Finally, the as-prepared NAC-CdTe QDs were stored in D.I. water for further experiments. The concentration of QDs was calculated according to the concentration of Cd2+, which was determined by the inductively coupled plasma mass spectrometry (ICP-MS).26 Preparation of Al-GFLX complex. To prepare Al-GFLX complex, 5.0 mL, 1.0 mM GFLX aqueous solution and 5.0 mL,1.0 mM Al3+ aqueous solution were mixed in a 25 mL round-bottom flask, and the resulting solution was kept stirring at r.t. for 2 h. After reaction, the solution was concentrated under vacuum to afford stable 6


Page 6 of 27

Page 7 of 27

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Al-GFLX complex. The ratio of GFLX and Al3+ in the complex was determined by the Job’s method, and the concentration of Al-GFLX was determined by ICP-MS.27 Preparation of QD-Al-GFLX nanoprobe. An aqueous solution containing NAC-CdTe QDs (0.1 mM based on the Cd2+ concentration) and Al-GFLX complex (80.0 µM) in 1 mL Tris-HCl buffer (0.01 M, 15.0 mM NaCl, pH 7.2) was kept stirring at r.t. for 8 min. After that, the mixture was transferred into a 10 KD Millipore, centrifuged (4000 rmp) at r.t. for 10 min, and washed with D.I. water three times. Finally, the concentrated QD-Al-GFLX nanoprobe was obtained and stored under dark at 4.0 °C for next experiments. The concentration of QD-Al-GFLX nanoprobe was determined by QDs. Measurement of Stern-Volmer quenching constant. The Stern-Volmer quenching constant, Ksv, was measured using a fluorescence titration method. A series of solutions containing 0.1 mM NAC-CdTe QDs QDs and varying concentration of Al-GFLX complex ranging from 0 to 50.0 µM in 0.01 M Tris-HCl buffer solution (pH 7.2) were incubated at 288 K, 298 K, or 310 K for 8 min. The temperature were controlled using a recycled water system throughout all experiments. Then, the fluorescence spectra of all the samples were acquired with excitation at 462 nm, and the maximum fluorescence intensity at 710 nm in each sample was obtained, which was applied to reveal the quenching behavior according to the well-known Stern-Volmer equation (1) 28: F0 = 1 + K SV [Q ] F

(1) where F0 and F are the fluorescence intensities of the QDs in the absence and presence of a quencher (Al-GFLX complex); [Q] is the concentration of the quencher. Ksv is the Stern-Volmer quenching constant, which defines the quenching efficiency 7



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

of the quencher. By plotting the F0/F against [Q], the Ksv of the QD-Al-GFLX at three different temperatures (288 K, 298 K, and 310 K) could be obtained from the linear regression of the each plot at three different temperature. Fabrication of QDs modified ITO electrodes. The CdTe QDs/ITO electrode was fabricated by alternately dipping ITO electrode into the respective solution containing positive charged PDDA (2%, containing 0.5 M NaCl) and negative charged NAC-capped CdTe QDs (0.1 mM) solution for 10 min. This process was repeated four times in order to reach the optimal photocurrent intensity. The electrodes were carefully washed with D.I. water after each dipping step. Photoelectrochemical measurement. 25.0 µL, 80.0 µM Al-GFLX complex was dropped on the CdTe QDs/ITO electrode, and incubated at 37.0 ºC for 60 min, followed by washing with 0.01 M Tris-HCl buffer (pH 7.2). The PEC signal of the resulting CdTe QD-Al-GFLX/ITO electrode was measured in the 0.01 M Tris-HCl buffer (pH 7.2). Then, 25.0 µL 36.0 µg/mL ctDNA was spread onto the electrode and incubated 37.0 ºC for another 60.0 min. After washing with 0.01 M Tris-HCl buffer three times, the PEC signal was measured again. Detection of DNA using the QD-Al-GFLX in aqueous solution and serum. QD-Al-GFLX (0.1 mM determined by Cd2+) in 0.01 M Tris-HCl buffer (pH 7.2) was incubated with varying concentrations of ctDNA at r.t. After 10 min, the fluorescence emission spectra were measured with excitation at 462 nm. To testify the specificity for dsDNA, QD-Al-GFLX was incubated with some representative ions and biologically relevant biomolecules under the same conditions, and the fluorescence was then measured with excitation at 462 nm. For the determination of ctDNA in serum, fresh serum obtained from healthy human was diluted with 0.01 M Tris-HCl buffer (1 to 50 dilution), and QD-Al-GFLX was added at a final concentration of 0.1 8


Page 8 of 27

Page 9 of 27

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


mM (determined by Cd2+). The resulting solution was then incubated with varying concentration ctDNA at r.t. for 10 min. The fluorescence intensity at 710 nm was collected for quantitative analysis upon excitation at 462 nm. Cell culturing and imaging. Human cervical carcinoma HeLa cells were cultured in Dulbecco's modified Eagle's medium (DMEM) supplemented with fetal bovine serum (10%), streptomycin (100.0 mg/L), and penicillin (100.0 U/mL) at 37 °C in a humidified incubator containing 5.0% CO2 and 95.0% air. The medium was replenished every other day. For fluorescence imaging, HeLa cells (~105 cell) were seeded onto 35.0 mm confocal dishes (Glass Bottom Dish) and incubated in DMEM for 24 h. The cells were washed with PBS (1×, pH 7.4) three times and incubated with NIR QDs (0.1 mM), QD-Al-GFLX (0.1 mM) or Al-GFLX complex (80.0 µM) at 37.0 °C for 2 h. Hoechst 33342 (2.0 µg/mL) was then added, and the cells were kept incubation at 37 °C for another 20 min. Afterwards, the cells were washed with PBS (1X, pH 7.4) three times, and the fluorescence images of cells were acquired with an Olympus IX73 fluorescent inverted microscope. The fluorescence images at NIR channel were acquired from 700–750 nm wavelength with the excitation at 630 – 670 nm, and the blue fluorescence images of Hoechst 33342 staining were acquired from 420–460 nm with excitation at 340–390 nm.

RESULTS AND DISCUSSION Design of activatable NIR fluorescence nanoprobe QD-Al-GFLX. Figure 1 showed the design of QD-Al-GFLX nanoprobe for DNA detection. NIR fluorescent CdTe QDs coated with anionic ligands (NAC)) were chosen as the fluorophore due to their efficient and stable fluorescence at NIR window, enabling high sensitivity for the detection and imaging of biomolecules. A cationic Al-GFLX complex was used 9



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

because of its high ability to bind with NAC-CdTe QDs via strong electrostatic interactions which can induce fast PET process to quench the NIR fluorescence of QDs. Al-GFLX complex and its quinolone analogues have been demonstrated as broad-spectrum antibiotics due to their strong binding affinity with DNA, resulting in efficient inhibition of DNA gyrase.29,30 We envisioned that the initial NIR fluorescence of QD-Al-GFLX was “off” due to a proposed PET quenching mechanism between QDs and Al-GFLX complex. Upon interaction with dsDNA, the strong binding affinity between Al-GFLX complex and DNA could trigger the dissociation of Al-GFLX from QD-Al-GFLX and liberation of free QDs. As a result, strong NIR fluorescence could be activated, which could report on the level of dsDNA. Moreover, the cationic Al-GFLX complexed on the surface of QDs could also enhance the cellular uptake of QD-Al-GFLX nanoprobe, allowing for the direct imaging of dsDNA inside cells.

Figure 1. General design of activatable NIR fluorescence QD-Al-GFLX nanoprobe for DNA detection. The NIR fluorescence of QD-Al-GFLX is “OFF” due to a PET process between QDs and Al-GFLX. The subsequent binding of Al-GFLX with DNA can trigger QD-Al-GFLX dissociation, inducing fluorescence “ON”.

Preparation and Characterization of QD-Al-GFLX nanoprobe. We firstly 10


Page 10 of 27

Page 11 of 27

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


synthesized the NIR NAC-CdTe QDs via a reported hydrothermal method.25 The transmission electron microscopic (TEM, Figure S1a) and atomic force microscope (AFM, Figure 2a) images showed that the synthesized NAC-CdTe QDs are sphere and monodisperse, which were confirmed by the dynamic light scattering (DLS) analysis, with a hydrodynamic size of 9.8 ± 0.7 nm in aqueous solution (Figure 2c). The maximum fluorescence emission was found to be 710 nm (Figure S1b). As expected, they displayed negative zeta potential (-39.2 ± 1.9 mV) due to the presence of NAC on the surface (Figure 2d). The chelation of Al3+ with GFLX to form Al-GFLX complex was investigated by monitoring of the UV-vis absorption and fluorescence, revealing that the composition ratio of GFLX : Al3+ was 1 : 1 (Figure S2).

Figure 2. Characterization of NIR QDs and QD-Al-GFLX nanoprobe. (a) AFM image of NIR QDs. (b) AFM image of QD-Al-GFLX. (c) DLS analysis of NIR QDs and QD-Al-GFLX in D.I. water. (d) Zeta potentials of NIR QDs and QD-Al-GFLX in D.I. water.

11



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

We then investigated the formation of QD-Al-GFLX in aqueous solution. Upon titration with Al-GFLX complex, we found that the fluorescence of QDs (0.1 mM) at 710 nm gradually decreased, with the maximum fluorescence quenched when the concentration of Al-GFLX complex was ~80.0 µM (Figures 3a and 3b). A maximum ~9-fold quenched fluorescence could be obtained. By monitoring the fluorescence intensity at 710 nm, we found that the binding process between QDs and Al-GFLX complex was very fast, with the maximum quenching efficiency achieved at 8 min (Figures 3c and 3d). DLS analysis showed that QD-Al-GFLX displayed a uniform hydrodynamic size (14.7 ± 1.1 nm, Figure 2c), which was also verified by the AFM analysis (Figure 2b). The hydrodynamic size was larger than that of QDs (∼9.8 nm), probably attributable to the presence of cationic Al-GFLX on the surface of QDs, which was also verified by the positive zeta potential (15.5 ± 0.4 mV) of QD-Al-GFLX (Figure 2d). These results suggested that the Al-GFLX chelate could efficiently bind to the surface of NAC-CdTe QDs, forming QD-Al-GFLX nanoprobe with NIR fluorescence significantly quenched.

12


Page 12 of 27

Page 13 of 27

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Figure 3. Characterization of the formation of QD-Al-GFLX nanoprobe. (a) Fluorescence spectra of NAC-CdTe QDs (0.1 mM based on Cd2+) following incubation with varying concentration (0, 10.0, 20.0, 30.0, 40.0, 50.0, 60.0, 70.0, 80.0, 90.0 and 100.0 µM) of Al-GFLX complex in aqueous solution for 8 min. (b) The fluorescence quenching efficiency (%) of QDs (λem = 710 nm) upon interaction with different concentration of Al-GFLX complex. (c) Fluoresce spectra of NAC-CdTe QDs (0.1 mM) following incubation with 80.0 µM Al-GFLX complex for different time (0, 1, 2, 3, 4, 5, 6, 7, 8, 10, 15 and 20 min). (d) Plot of fluorescence intensity at 710 nm vs. incubation time (λex = 462 nm).

Investigation of quenching mechanism. It has been known that the fluorescence of QDs can be generally quenched via either dynamic quenching or static quenching process. To explore the potential quenching mechanism between QDs and Al-GFLX complex, we firstly measured the Stern-Volmer quenching constants (Ksv) at three different temperature (288 K, 298 K, and 310 K) using a reported method, and the results were summarized in Table S1.31 It was found that the Ksv was inversely proportional to the temperature (Figure 4a), suggesting a probable static quenching process in QD-Al-GFLX. We then measured the fluorescence lifetime (τ) of QDs before and after interaction with Al-GFLX in aqueous solution. As shown in Figure 4b, the fluorescence lifetime of QDs was nearly the same in QD-Al-GFLX as that of QDs alone. Since the measurement of fluorescence lifetime is the most definitive method to distinguish static and dynamic quenching process, the little change of fluorescence lifetime confirmed a static quenching process between QDs and Al-GFLX complex.32 In order to demonstrate the PET quenching mechanism in the static quenching process, we further monitored the photocurrent response of QDs upon interaction with 13



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Al-GFLX. As shown in Figures 4c and 4d, upon intermittent light irradiation, the electron-hole pairs of bare NAC-CdTe QDs were generated, resulting in a cathodic photocurrent of ~132 nA. After interaction with Al-GFLX complex, the photocurrent decreased to ~42.9 nA, indicating that the binding of Al-GFLX to the QDs could inhibit the electron transfer between QDs and dissolved oxygen molecules. This result suggested that the PET process occurred between QDs and Al-GFLX, which was also demonstrated by the little overlap of the fluorescence emission of QDs and the UV-vis absorption of Al-GFLX (Figure S3). Moreover, with the addition of dsDNA, Al-GFLX complex was intercalated into ctDNA double helix structure, resulting in the elimination of the PET process between the QDs and Al-GFLX, thereby restoring the photocurrent intensity.

Figure 4. Investigation of the quenching mechanism. (a) Stern-Volmer curves (F0/F) of NAC-CdTe QDs (0.1 mM in 0.01 M Tris-HCl buffer solution, pH 7.2) upon incubation with varying concentration of Al-GFLX complex at 288 K, 298 K and 310 K for 8 min, respectively. The fluorescence intensity at 710 nm was obtained with excitation at 462 nm. F0 indicates the initial fluorescence intensity of NAC-CdTe QDs 14


Page 14 of 27

Page 15 of 27

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


and F indicates the fluorescence intensity of NAC-CdTe QDs following incubation with indicated concentration of Al-GFLX for 8 min. (b) The fluorescence lifetime decay curves of NAC-CdTe QDs (black) and QD-Al-GFLX (red) upon excitation with a 405 nm laser (λem = 710 nm). (c) PEC spectra of NAC-CdTe QDs/ITO electrode before (1) and after (2) incubation with 80.0 µM Al-GFLX, or (3) QD-Al-GFLX/ITO electrode after incubation with 36.0 µg/mL dsDNA. The PEC tests were performed in 0.01 M Tris-HCl buffer solution (pH 7.2) with 0 V applied potential vs. Ag/AgCl, and excitation at 415 nm. (d) Quantification of photocurrent of three different electrodes in Figure 4c. Error bars indicate the standard deviation from three measurements.

Fluorescence response toward dsDNA in aqueous solution. In order to test the ability of QD-Al-GFLX nanoprobe for DNA detection, we firstly investigated whether DNA could interact with NAC-CdTe QDs and cause fluorescence change. The results (Figure S4) showed that the fluorescence emission of QDs was little changed upon incubation with DNA at a concentration as high as ~36.0 µg/mL, demonstrating that DNA had negligible influence on the fluorescence of QDs. The activation of QD-Al-GFLX in response to dsDNA was then examined by measuring its fluorescence spectra upon incubation with dsDNA. As shown in Figures 5a and 5b, QD-Al-GFLX displayed a weak fluorescence emission at 710 nm, which gradually increased following incubation with dsDNA (36.0 µg/mL) for over 30 min. The fluorescence enhancement of QD-Al-GFLX induced by dsDNA at 710 nm was maximized at 10 min, with a turn-on ratio calculated to be ~7-fold, affording a significantly brighter NIR fluorescence image under excitation at 462 nm (insert in Figure 5b). These results suggested that the interaction of QD-Al-GFLX with dsDNA 15



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

was kinetics fast, owing to the strong binding ability between Al-GFLX complex and dsDNA. We further employed AFM to analyze the nanoparticle size of QD-Al-GFLX after incubation with dsDNA for 10 min. As shown in Figure 5c, along with the significantly enhanced fluorescence, the size of QD-Al-GFLX decreased from ~10.7 (Figure 2b) to ~6.8 nm following interaction with dsDNA, suggesting that the Al-GFLX complex was peeled from QD-Al-GFLX by dsDNA. These results demonstrated that dsDNA could efficiently interact with QD-Al-GFLX, releasing NAC-CdTe QDs with remarkable enhancement in NIR fluorescence. We further studied the pH effect on QD-Al-GFLX in response to dsDNA, and the results in Figure S5 showed that the fluorescence enhancement of QD-Al-GFLX upon interaction with dsDNA was similarly significant in aqueous solution with pH ranging from 5 to 7.5, indicating a negligible effect of pH within 5-7.5.

Figure 5. Fluorescence response towards dsDNA. (a) Time-dependent fluorescence spectra of QD-Al-GFLX (0.1 mM based on Cd2+ concentration) following incubation with 36.0 µg/mL dsDNA in 0.01 M Tris-HCl buffer (pH 7.2). λex = 462 nm. (b) Plot of fluorescence enhancement (F/F0) at 710 nm vs. incubation time. F0 indicates the initial fluorescence intensity of QD-Al-GFLX, and F indicates the fluorescence intensity at indicated time point. Insert shows the Epi-fluorescence images of QD-Al-GFLX (1) and QD-Al-GFLX after incubation with 36.0 µg/mL DNA for 10 min (2). The images were acquired with excitation channel of 460 nm and emission channel of 710 nm. (c) 16


Page 16 of 27

Page 17 of 27

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


AFM image of QD-Al-GFLX following incubation with 36.0 µg/mL dsDNA for 10 min.

Sensitivity and specificity of QD-Al-GFLX nanoprobe for DNA detection. Having demonstrated the activation of QD-Al-GFLX in response to dsDNA, we then evaluated its sensitivity for the detection of dsDNA by measuring the NIR fluorescence. As shown in Figure 6a, upon incubation of QD-Al-GFLX (0.1 mM) with dsDNA for 10 min, a gradual increase in fluorescence emission at 710 nm was observed with an increase in dsDNA concentration, indicating a dsDNA concentration-dependent activation of QD-Al-GFLX. The fluorescence intensity at 710 nm was linearly proportional to DNA concentration ranging from 0.0228~36.0 µg/mL (Figure 6b), with a detection limit of ~6.83 ng/mL (3σ/S, where σ was the standard deviation of eleven replicate measurements of the fluorescence intensity of the blank samples and S was the slope of the calibration plot). As compared with other reported methods (Table S2), QD-Al-GFLX nanoprobe displayed a larger linear range as well as comparable or even better sensitivity for DNA detection. The selectivity of QD-Al-GFLX for dsDNA over other biologically relevant species such as ions, cysteine, glucose, ATP, proteins, RNA and single-stranded DNA (ssDNA, TGGAAGGAGGCGTTATGAGGGGGTCCA) was next examined by comparing the fluorescence intensity at 710 nm following incubation with respective agent for 10 min. As shown in Figure 6c, only dsDNA could activate QD-Al-GFLX nanoprobe, resulting in a significant ~7-fold enhancement in NIR fluorescence among all the tested agents. It was notable that neither RNA nor ssDNA could induce obvious fluorescence enhancement, suggesting that QD-Al-GFLX was highly specific for dsDNA. 17



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Figure 6. Characterization of sensitivity and specificity of QD-Al-GFLX for DNA. (a) The fluorescence spectra of QD-Al-GFLX following incubation with dsDNA with concentration ranging from 0, 6, 12, 18, 24, 30, 36 and 40.0 µg/mL. (b) Plot of the enhanced fluorescence intensity vs. the concentration of dsDNA. F0 and F represents the fluorescence intensity of QD-Al-GFLX at 710 nm in the absence and presence of dsDNA, respectively. (c) Relative fluorescence intensity of QD-Al-GFLX following incubation with different agents. The concentration for each agent is: 100.0 mM for either K+, Cu2+, Mg2+ or Fe3+, 1.0 M for either CO32-, SO42- or Cl-, 100.0 µg/mL for glucose, 40.0 µg/mL for either cysteine, ATP, BSA, HAS or RNA, and 36.0 µg/mL for either dsDNA or ssDNA. All experiments were performed in Tris-HCl buffer (0.01 M, 15.0 mM NaCl, pH 7.2), and the fluorescence was acquired with excitation at 462 nm. Error bars represent the standard deviation from three measurements.

Investigation of the regenerability of QD-Al-GFLX for DNA detection. Having demonstrated that QD-Al-GFLX nanoprobe was feasible for dsDNA detection, we further studied whether it could be regenerated for multiple detection of dsDNA. As shown in Figure 7a, the initial quenched fluorescence of QD-Al-GFLX was activated by 36.0 µg/mL dsDNA, reaching the maximum ~7-fold enhancement in fluorescence at 710 nm after 10 min. The subsequent addition of 80.0 µM Al-GFLX complex could significantly quench the fluorescence, with intensity similar to that of the initial 18


Page 18 of 27

Page 19 of 27

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


QD-Al-GFLX. This “off-on-off” process suggested that QD-Al-GFLX nanoprobe could be reusable for dsDNA detection. We found that the process could be repeated three times (Figure 7b). After that, the addition of dsDNA could not induce fluorescence enhancement as high as ~7-fold.

Figure 7. Investigation of the regenerability of QD-Al-GFLX for DNA detection. (a) The fluorescence spectra of QD-Al-GFLX following sequential treatment with dsDNA (solid line) and Al-GFLX (dash line) complex for 1 (black), 2 (red) and 3 (blue) cycles. (b) Relative fluorescence intensity changes (F/F0) at 710 nm vs. cycle number (n).

Detection of DNA in Serum. To investigate whether QD-Al-GFLX nanoprobe was amenable to detect dsDNA in complex biological environment, the detection of dsDNA in human serum sample was next performed by standard addition method. QD-Al-GFLX (0.1 mM) and varying amounts of dsDNA were incubated in human serum. After 10 min, these serum samples were carried out for fluorescence measurement. As shown in Table 1, the relative standard deviation (R.S.D.) ranged from 1.5% to 4.8%, which was at a very low level, indicating a good reproducibility. The recovery ranged from 98.54% to 100.95%, which suggested a good accuracy. These results demonstrated that QD-Al-GFLX was appropriate for DNA detection in human serum, which may provide a high potential for further use in clinics. 19



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 20 of 27

Table 1. Detection of DNA in human serum using QD-Al-GFLX.

Samples 1 2 3 a

Found

Added

Found

Recovery

R.S.D.

(µg/mL)

(µg/mL)

(µg/mL)

(n = 5, 100%)

(n = 5, 100%)

5.0

4.927

98.54

4.8

10.0

10.05

100.50

1.5

20.0

20.19

100.95

3.0

ND ND ND

a a a

ND: not detected.

Fluorescence imaging of DNA in live cells. Having demonstrated the ability of QD-Al-GFLX for the selective and sensitive detection of dsDNA in complex biological environment, we next investigated its capability for fluorescence imaging of endogenous dsDNA in living cells. HeLa cells were incubated with either NAC-CdTe QDs, QD-Al-GFLX or Al-GFLX for 2 h, and then co-stained with Hoechst 33342. As shown in Figure 8, the incubation of HeLa cells with QD-Al-GFLX produced strong intracellular NIR fluorescence, which colocalized well with the blue fluorescence emitting from the nucleus staining, suggesting that QD-Al-GFLX could be activated by dsDNA in nucleus. In contrast, only negligible NIR fluorescence was observed in HeLa cells after incubation with either NAC-CdTe QDs or Al-GFLX. These results demonstrated that QD-Al-GFLX could efficiently enter into live HeLa cells and emit strong NIR fluorescence upon interaction with dsDNA in nucleus. Therefore, QD-Al-GFLX was capable of fluorescence imaging of endogenous dsDNA in living cells.

20


Page 21 of 27

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Figure 8. Fluorescence imaging of dsDNA in live HeLa cells. HeLa cells were incubated with QDs (0.1 mM), QD-Al-GFLX (0.1 mM) or Al-GFLX (80.0 µM) at 37 °C for 2 h, and co-stained with Hoechst 33342 (2.0 µg/mL) at 37 °C for another 20 min. The fluorescence images were acquired at the NIR channel from 700–750 nm wavelength with the excitation at 630–670 nm, and the blue channel from 420–460 nm with the excitation at 340–390 nm. Scale bars: 20 µm.

CONCLUSION In summary, we have employed semiconductor QDs and Al-GFLX complexes to develop a new activatable NIR fluorescence nanoprobe (QD-Al-GFLX) for efficient detection and imaging of dsDNA both in aqueous solution and in live cancer cells. We have demonstrated that the NIR fluorescence of QD-Al-GFLX was quenched due to a PET process between QDs and Al-GFLX, which could be efficiently activated by dsDNA, leading to a significant ~7-fold enhancement in NIR fluorescence. QD-Al-GFLX was highly sensitive and specific for dsDNA, which was capable of reporting on the dsDNA levels in human serum. Moreover, QD-Al-GFLX could be 21



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

applied for fluorescence imaging of endogenous dsDNA in live cancer cells. These results suggested that QD-Al-GFLX was a highly feasible probe for dsDNA, which could be amenable for the diagnosis of DNA-related diseases.

ASSOCIATED CONTENT Supporting Information. Supplementary Figures, Tables, and Nano-characterization. This material is available free of charge via the Internet at http://pubs.acs.org.

AUTHOR INFORMATION Corresponding Authors *E-mail: [email protected]. *E-mail: [email protected].

Notes The authors declare no competing financial interest.

ACKNOWLEDGEMENTS Financial supports from the National Natural Science Foundation of China (21505070, 21327902 and 21632008) and Natural Science Foundation of Jiangsu Province (BK20150567) were acknowledged.

REFERENCES (1) Shen, Y.; Shuhendler, A. J.; Ye, D.; Xu, J.-J.; Chen, H.-Y. Two-Photon Excitation Nanoparticles for Photodynamic Therapy. Chem. Soc. Rev. 2016, 45, 6725-6741. (2) Wegner, K. D.; Hildebrandt, N. Quantum Dots: Bright and Versatile In Vitro 22


Page 22 of 27

Page 23 of 27

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


and In Vivo Fluorescence Imaging Biosensors. Chem. Soc. Rev. 2015, 44, 4792-4834. (3) Sun, C.; Cao, Z.; Wu, M.; Lu, C. Intracellular Tracking of Single Native Molecules with Electroporation-Delivered Quantum Dots. Anal. Chem. 2014, 86, 11403-11409. (4) Miao, P.; Tang, Y.; Wang, B.; Meng, F. Near-Infrared Ag2S Quantum Dots-Based DNA Logic Gate Platform for miRNA Diagnostics. Anal. Chem. 2016, 88, 7567-7573. (5) Zhou, W.; Cao, Y.; Sui, D.; Lu, C. Radical Pair-Driven Luminescence of Quantum Dots for Specific Detection of Peroxynitrite in Living Cells. Anal. Chem. 2016, 88, 2659-2665. (6) Zou, C.; Foda, M. F.; Tan, X.; Shao, K.; Wu, L.; Lu, Z.; Bahlol, H. S.; Han, H. Carbon-Dot

and

Quantum-Dot-Coated

Dual-Emission

Core-Satellite

Silica

Nanoparticles for Ratiometric Intracellular Cu2+ Imaging. Anal. Chem. 2016, 88, 7395-7403. (7) Palomo, V.; Díaz, S. A.; Stewart, M. H.; Susumu, K.; Medintz, I. L.; Dawson, P. E. 3,4-Dihydroxyphenylalanine Peptides as Nonperturbative Quantum Dot Sensors of Aminopeptidase. ACS Nano 2016, 10, 6090-6099. (8) Kairdolf, B. A.; Qian, X.; Nie, S. Bioconjugated Nanoparticles for Biosensing, in Vivo Imaging, and Medical Diagnostics. Anal. Chem. 2017, 89, 1015-1031. (9) Medintz, I. L.; Stewart, M. H.; Trammell, S. A.; Susumu, K.; Delehanty, J. B.; Mei, B. C.; Melinger, J. S.; Blanco-Canosa, J. B.; Dawson, P. E.; Mattoussi, H. Quantum-Dot/Dopamine Bioconjugates Function as Redox Coupled Assemblies for in Vitro and Intracellular pH Sensing. Nat. Mater. 2010, 9, 676-684. (10) Gao, D.; Sheng, Z.; Han, H. A Novel Method for The Analysis of Calf 23



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Thymus DNA Based on CdTe Quantum Dots-Ru(bpy)32+ Photoinduced Electron Transfer System. Microchim. Acta 2010, 168, 341-345. (11) Zhu, Z.; Wang, S.; Wei, D.; Yang, C. Zn2+-Cyclen-Based Complex Enable a Selective Detection of Single-Stranded Thymine-Rich DNA in Aqueous Buffer. Biosen. Bioelectron. 2016, 85, 792-797. (12) Mann, T. L.; Krull, U. J. The Application of Ultrasound as a Rapid Method to Provide DNA Fragments Suitable for Detection by DNA Biosensors. Biosen. Bioelectron. 2004, 20, 945-955. (13) Liu, Y.; Ye, M.; Ge, Q.; Qu, X.; Guo, Q.; Hu, X.; Sun, Q. Ratiometric Quantum Dot-Ligand System Made by Phase Transfer for Visual Detection of Double-Stranded DNA and Single-Nucleotide Polymorphism. Anal. Chem. 2016, 88, 1768-1774. (14) He, X.; Ma, N. A General Strategy for Label-Free Sensitive DNA Detection Based on Quantum Dot Doping. Anal. Chem. 2014, 86, 3676-3681. (15) Zhang, R.; Zhao, D.; Ding, H.-G.; Huang, Y.-X.; Zhong, H.-Z.; Xie, H.-Y. Sensitive Single-Color Fluorescence “Off-On” Switch System for dsDNA Detection Based on Quantum Dots-Ruthenium Assembling Dyads. Biosens. Bioelectron. 2014, 56, 51-57. (16) Miao, Y.; Zhang, Z.; Gong, Y.; Yan, G. Phosphorescent Quantum Dots/Doxorubicin Nanohybrids Based on Photoinduced Electron Transfer for Detection of DNA. Biosens. Bioelectron. 2014, 59, 300-306. (17) Tosar, J. P.; Keel, K.; Laiz, J. Two Independent Label-Free Detection Methods in One Electrochemical DNA Sensor. Biosens. Bioelectron. 2009, 24, 3036-3042. (18) Kong, L.; Liu, Z.; Hu, X.; Liu, S. Interaction of Polymyxin B with ds-DNA, 24


Page 24 of 27

Page 25 of 27

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


and Determination of DNA or Polymyxin B via Resonance Rayleigh Scattering and Resonance Non-Linear Scattering Spectra. Microchim. Acta 2011, 173, 207-213. (19) Ekgasit, S.; Stengel, G.; Knoll, W. Concentration of Dye-Labeled Nucleotides

Incorporated

into

DNA

Determined

by

Surface

Plasmon

Resonance-Surface Plasmon Fluorescence Spectroscopy. Anal. Chem. 2004, 76, 4747-4755. (20) Nelson, B. P.; Grimsrud, T. E.; Liles, M. R.; Goodman, R. M.; Corn, R. M. Surface Plasmon Resonance Imaging Measurements of DNA and RNA Hybridization Adsorption onto DNA Microarrays. Anal. Chem. 2001, 73, 1-7. (21) Yi,

L.;

Zhao,

H.;

Sun,

C.;

Chen,

S.;

Jin,

L.

Flow-Injection

Chemiluminescence Study of Ce(IV)-Na2SO3-Tb(III)-Fluoquinolone Antibiotic System with DNA. Spectrochim. Acta, Part A 2003, 59, 2541-2546. (22) Shen, Y.; Liu, S.; Kong, L.; Tan, X.; He, Y.; Yang, J. Detection of DNA Using an "Off-On" Switch of a Regenerating Biosensor Based on an Electron Transfer Mechanism from Glutathione-Capped CdTe Quantum Dots to Nile Blue. Analyst 2014, 139, 5858-5867. (23) Shen, Y.; Liu, S.; Yang, J.; Wang, L.; Tan, X.; He, Y. A Novel and Sensitive Turn-On Fluorescent Biosensor for the DNA Detection Using Sm3+-Modulated Glutathione-Capped CdTe Quantum Dots. Sens. Actuators, B 2014, 199, 389-397. (24) Wang, L.; Liu, S.; Liang, W.; Li, D.; Yang, J.; He, Y. Detection of DNA Utilizing a Fluorescent Reversible Change of A Biosensor Based on The Electron Transfer from Quantum Dots to Polymyxin B Sulfate. J. Colloid Interface Sci. 2015, 448, 257-264. (25) Li, J.; Yang, T.; Chan, W. H.; Choi, M. M. F.; Zhao, D. Synthesis of High-Quality N-acetyl-L-cysteine-Capped CdTe Quantum Dots by Hydrothermal 25



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Route and the Characterization through MALDI-TOF Mass Spectrometry. J. Phys. Chem. C 2013, 117, 19175-19181. (26) Zhao, D.; He, Z.; Chan, W. H.; Choi, M. M. F. Synthesis and Characterization of High-Quality Water-Soluble Near-Infrared-Emitting CdTe/CdS Quantum Dots Capped by N-acetyl-L-cysteine Via Hydrothermal Method. J. Phys. Chem. C 2009, 113, 1293-1300. (27) Job, P. Studies on the Formation of Complex Minerals in Solution and on Their Stability. Annali di Chimica (Paris), 1928, 9, 113-203. (28) Carrillo-Carrion, C.; Lendl, B.; Simonet, B. M.; Valcarcel, M. Calix 8 arene Coated CdSe/ZnS Quantum Dots as C-60-Nanosensor. Anal. Chem. 2011, 83, 8093-8100. (29) Al-Ghannam, S. M. Atomic Absorption Spectroscopic, Conductometric and Colorimetric Methods for Determination of Some Fluoroquinolone Antibacterials Using Ammonium Reineckate. Spectrochim. Acta, Part A 2008, 69, 1188-1194. (30) Liang, W.; Liu, Z.; Li, D.; Wu, X.; Liu, S.; He, Y. Quantum Dots Modified with the Al(III)-Pefloxacin Complex as a Novel Bioprobe for the Sensitive Turn-On and Dual-Fluorescence Detection of dsDNA. Microchim. Acta 2015, 182, 297-306. (31) Hu, Y.-J.; Wang, Y.; Ou-Yang, Y.; Zhou, J.; Liu, Y. Characterize the Interaction between Naringenin and Bovine Serum Albumin Using Spectroscopic Approach. J. Lumin. 2010, 130, 1394-1399. (32) Shen, Y.; Liu, S.; Kong, L.; Li, D.; He, Y. Sensitive Detection of Polymyxin B Sulfate at the Nanogram Level Using Enhanced Resonance Scattering Signals and Decreased Fluorescence Signals with Thioglycolic Acid Capped CdTe/CdS Quantum Dots as Probe. Sens. Actuators, B 2013, 188, 555-563.

26


Page 26 of 27

Page 27 of 27

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


For TOC:

27


Activatable QD-Based Near-Infrared Fluorescence Probe for Sensitive

Recommend Documents