Acute and Chronic Responses of Activated Sludge Viability and

Article pubs.acs.org/est

Acute and Chronic Responses of Activated Sludge Viability and Performance to Silica Nanoparticles Xiong Zheng, Yinglong Su, and Yinguang Chen* State Key Laboratory of Pollution Control and Resources Reuse, School of Environmental Science and Engineering, Tongji University, 1239 Siping Road, Shanghai 200092, China S Supporting Information *

ABSTRACT: Recently, the potential health and environmental risks of silica nanoparticles (SiO2 NPs) are attracting great interest. However, little is known about their possible impacts on wastewater biological nitrogen and phosphorus removal. In this study, the acute and chronic effects of SiO2 NPs on activated sludge viability and biological nutrient removal performance were investigated. It was found that the presence of environmentally relevant concentration (1 mg/L) of SiO2 NPs caused no adverse acute and chronic effects on sludge viability and wastewater nitrogen and phosphorus removal. However, chronic exposure to 50 mg/L SiO2 NPs induced the increase of effluent nitrate concentration, and thus depressed the total nitrogen (TN) removal efficiency from 79.6% to 51.6% after 70 days of exposure, which was due to the declined activities of denitrifying enzymes, nitrate reductase and nitrite reductase. Wastewater phosphorus removal was insensitive to 1 and 50 mg/L SiO2 NPs after either the acute or chronic exposure, because the critical factors closely related to biological phosphorus removal were not significantly changed, such as the activities of exopolyphosphatase and polyphosphate kinase and the intracellular transformations of polyhydroxyalkanoates and glycogen. Denaturing gradient gel electrophoresis (DGGE) analysis revealed that the bacterial community structure was changed after long-term exposure to 50 mg/L SiO2 NPs, and the quantitative PCR assays indicated that the abundance of denitrifying bacteria was decreased, which was consistent with the declined wastewater nitrogen removal.

■

INTRODUCTION Nanomaterials are defined as particles, fibers, and tubes with at least one dimension of 100 nm or less.1 Over the past decade, large numbers of engineered nanomaterials with specific physicochemical characteristics have been manufactured, and the various applications of these nanomaterials are being developed.2 Among these engineered nanomaterials, silica nanoparticles (SiO2 NPs) have been widely used for mechanical polishing, cosmetics, and applications in biomedical fields, including optical imaging, cancer therapy, and targeted drug delivery.3,4 Recently, some widely used nanomaterials, such as zinc oxide (ZnO) and titanium dioxide (TiO2) NPs, have been found to be present in air, soils, sewage, and sludge in wastewater treatment systems.5,6 The large production and utilization of SiO2 NPs will cause their release into the environment and pose the potential risks to human and other living organisms. As a consequence, a great effort should be made to investigate their possible adverse effects. Recent studies concerning the potential influences of SiO2 NPs mainly focused on their risks to human health. For © 2012 American Chemical Society

instance, the cytotoxicity of SiO2 NPs to human mesothelioma and rodent fibroblast cell lines were evaluated with in vitro tests, and the results indicated that 30 mg/L SiO2 NPs showed no significant impacts on these cells for 3 days of exposure.7 Similarly, Chang et al. reported that SiO2 NPs were nontoxic to the normal human fibroblast and tumor cells at the dosage of 0.05). Although several publications reported that SiO2 NPs were able to cause the cytotoxicity to some model bacteria,10,11 two independent assays of this study indicated that SiO2 NPs did not induce the acute and chronic influences on sludge viability even at the concentration of 50 mg/L. Acute and Chronic Effects of SiO2 NPs on Biological Nitrogen and Phosphorus Removal. Although the above results indicated that the acute and chronic exposure to SiO2 NPs induced marginal influences on sludge viability, it remains unknown whether the presence of SiO2 NPs can cause the effect on wastewater biological nutrient removal. Thus, the potential impacts of 1 and 50 mg/L SiO2 NPs on wastewater nitrogen and phosphorus removal were further explored. As shown in Figure 2, the effluent NH4+-N, NO2−-N, and SOP levels in the presence of either 1 or 50 mg/L SiO2 NPs were

accordance with the manufacturers’ instructions. The analyses of NH4+-N, NO2−-N, NO3−-N, total nitrogen (TN), SOP, mixed liquor suspended solids (MLSS), and MLVSS were detailed in the Standard Methods.18 To determine the total concentration of SiO2 NPs in each reactor, 2 mL of mixture was withdrawn and digested with a mixture of nitric acid (HNO3) and hydrofluoric acid (HF), followed by analyzing the resulting solution via the ICP-MS. The measurements of the activities of AMO, NOR, NAR, NIR, PPX, and PPK were the same as those described in our previous publication.15 Intracellular PHA (including polyhydroxybutyrate (PHB), ployhydroxyvalerate (PHV) and polyhydroxy-2-methylvalerate (PH2MV)) and glycogen in activated sludge were determined using the method of Jiang et al.19 To analyze the bacterial community structure, bacterial DNA of activated sludge was extracted using the method of Purkhold et al,20 and the procedure of PCR-DGGE analysis was detailed in the literature.21 Real-time PCR assays were used for the quantification of denitrifying bacteria by nitrite reductase genes (nirK and nirS) as functional markers. The primers of nirK876(ATYGGCGGVAYGGCGA) and nirK1040(GCCTCGATCAGRTTRTGGTT) 2 2 and nirSsh2F(ACCGCCGCCAACAACTCCAACA) and nirSsh4R(CCGCCCTGGCCCTTGAGC) 23 were, respectively, adopted to amplify the nirK and nirS genes fragments. PCR assays were performed in a total volume of 20 μL contaning 1 × SYBR Green PCR Master Mix (Invitrogen), 0.5 μM each primer for nirK (or nirS), and 1 μL of template DNA. PCR amplification programs were detailed in the literature above.22,23 A standard curve was generated by using 10-fold serial dilutions of linearized plasmid containing the cloned nirK (or nirS) gene as a template, and used for the absolute quantification of nirK (or nirS) gene copies.22 All PCR assays were performed using three replicates per sample, and contained control reactions without template. Statistical Analysis. All tests were performed in triplicate, and an analysis of variance (ANOVA) was used to test the significance of the results and p < 0.05 was considered to be statistically significant.

■

RESULTS AND DISCUSSION Acute and Chronic Effects of SiO2 NPs on Activated Sludge Viability. Cell proliferation and LDH release assays have been widely used to evaluate the influences of toxicants on cell growth and viability.24,25 Simultaneous use of these two assays are suggested to enable to avoid the bias that might be

Figure 2. Effluent concentrations of NH4+-N (Δ), NO2−-N (□), NO3−-N (○), and SOP (◇) in the presence of 0 (black), 1 (blue), and 50 (red) mg/L SiO2 NPs for 70 days of exposure. Error bars represent standard deviations of triplicate measurements. 7184

dx.doi.org/10.1021/es300777b | Environ. Sci. Technol. 2012, 46, 7182−7188

Environmental Science & Technology

Article

Figure 3. Variations of NH4+-N (Δ), NO2−-N (□), NO3−-N (○), and SOP (◇) in one cycle after short-term (A) and long-term (B) exposure to 0 (black), 1 (blue), and 50 (red) mg/L SiO2 NPs, respectively. Error bars represent standard deviations of triplicate measurements.

and NO3−-N in the low DO stage, although ammonia oxidation was not affected (see Figure 3B). At the end of low DO phase, all the accumulated NO2−-N was removed, whereas the corresponding effluent NO3−-N was increased to 12.1 ± 1.1 mg/L which was much higher than that in the control (5.1 ± 0.3 mg/L). It was found that the total nitrogen (TN) removal efficiency in the presence of 50 mg/L SiO2 NPs was only 51.6%, which was lower than that in the control (79.6%). Obviously, despite no measurable impact on wastewater phosphorus removal, the chronic exposure to 50 mg/L SiO2 caused the inhibitory effect on wastewater nitrogen removal process. Previous publications reported that toxic metal ions released from the dissolution of NPs were mainly responsible for their acute toxicity to some living organisms.7,30,31 This mechanism is suitable for explaining the toxicity of slightly soluble NPs, such as ZnO NPs.15 However, SiO2 NPs are difficult to dissolve in water under near neutral conditions. It was reported in the literature that the exposure to SiO2 NPs induced no significant effects on human cells (MSTO and 3T3 cells) due to its insolubility, whereas ZnO and Fe3O4 NPs caused the great toxicity because of their dissolution.7 Similarly, TiO2 NPs were found to have no negative effects on biological nitrogen and phosphorus removal after short-term exposure due to its insolubility.16 Thus, no acute effects of insoluble SiO2 NPs on sludge viability and wastewater nutrient removal were observed. Nevertheless, although no toxic ions were released from SiO2 NPs, this study indicated that long-term exposure to 50 mg/L SiO2 NPs showed a negative impact on wastewater nitrogen

lower than 0.5 mg/L, which were not obviously changed with increasing exposure time (70 d). Also, almost all COD (>98%) in each reactor were found to be removed, and did not show a significant difference between these reactors (p > 0.05). Although 1 mg/L SiO2 NPs had no harms to biological nitrogen removal, the chronic exposure to 50 mg/L SiO2 NPs was found to induce the increase of effluent NO3−-N concentration from 4.8 ± 0.6 (day 1) to 12.1 ± 1.1 mg/L (day 70). These results indicated that when the concentration of SiO2 NPs became higher (such as 50 mg/L), their negative influence on wastewater nitrogen removal occurred after longterm exposure, although no measurable impact on sludge viability was observed. Wastewater biological nutrient removal usually refers to the combination of biological nitrogen removal and enhanced biological phosphorus removal (EBPR) processes.27 In the anaerobic and low DO wastewater treatment system, phosphorus release occurs under the anaerobic condition.28 In the subsequent low DO stage, more phosphorus is taken up by activated sludge to achieve the net phosphorus removal. Ammonia is oxidized to nitrite and nitrate which are removed by denitrification process.29 As seen from Figure 3A, the variations of nitrogen and phosphorus in all SBRs had the similar trends during short-term exposure to SiO2 NPs, suggesting that 1 and 50 mg/L SiO2 NPs had no acute impacts on the anaerobic and low DO transformations of nitrogen and phosphorus. Figure 3B shows that the absence and presence of 1 mg/L SiO2 NPs showed almost the same transformations of nitrogen and phosphorus. However, the chronic exposure to 50 mg/L SiO2 NPs caused the higher accumulations of NO2−-N 7185

dx.doi.org/10.1021/es300777b | Environ. Sci. Technol. 2012, 46, 7182−7188

Environmental Science & Technology

Article

Figure 4. Schematic representation of the anaerobic (A) and low DO (B) metabolic pathways relevant to nitrogen and phosphorus removal in activated sludge (Adapted from Zumft,32 and Martin et al.33). Only the key enzymes measured in this study were labeled.

Figure 5. Relative activities of AMO, NOR, NAR, NIR, PPX, and PPK in activated sludge after short-term (A) and long-term (B) exposure to SiO2 NPs. Error bars represent standard deviations of triplicate measurements.

influences on denitrifying enzymes, which was in accordance with the above observed depressed nitrate reduction. In literature, the catalyzing activities of denitrifying enzymes were reported to be relevant to iron and copper ions in their catalytic centers.34 The addition of trace iron and copper ions was reported to significantly enhance the denitrification rate,35 whereas the decrease of iron and copper ions in pure culture systems, such as Pseudomonas stutzeri and Paracoccus denitrif ican, caused the decline of NAR and NIR activities, and resulted in the decreased denitrification efficiency.36,37 It was found in this study that the presence of 50 mg/L SiO2 NPs induced the obvious decreases (>50%) of iron and copper ions in synthetic wastewater (see SI Figure S2), which resulted in the less iron and copper ions available for microorganisms related to wastewater nitrogen and phosphorus removal. Hence, the chronic deficiency of these trace metal ions caused by 50 mg/L SiO2 NPs might be responsible for the declined activities of NAR and NIR in activated sludge. Biological phosphorus metabolism under anaerobic and low DO conditions is related to the intracellular intermediate metabolites, such as PHA and glycogen, in wastewater treatment facilities (see Figure 4). In the anaerobic stage, polyphosphate is hydrolyzed to supply the energy for taking up wastewater carbon source (acetic acid) which is transformed and stored as intracellular PHA.33 In the subsequent low DO phase, the synthesized PHA can be used as the energy and carbon sources for SOP uptake and glycogen replenishment. SI Table S1 records the transformations of PHA and glycogen in

removal performance (see Figure 3). In the coming text the possible mechanisms were explored. Acute and Chronic Effects of SiO2 NPs on Key Enzymes Activities and Intermediate Metabolites of Activated Sludge. Several metabolic models have been proposed to explain biological nitrogen and phosphorus removal based on biochemical measurements and metagenomic analysis.32,33 Figure 4 illustrates the major metabolic pathways occurred in the anaerobic and low DO phases. Ammonia monooxygenase (AMO), nitrite oxidoreductase (NOR), nitrate reductase (NAR), and nitrite reductase (NIR) play important roles in catalyzing the processes of nitrification and denitrification. Biological phosphorus removal is mainly dependent on polyphosphate-accumulating organisms (PAOs), which are able to use exopolyphosphatase (PPX) and polyphosphate kinase (PPK) to perform the anaerobic hydrolysis of polyphosphate and subsequent low DO uptake of SOP, respectively. Figure 5A shows that the acute exposure to 1 and 50 mg/L SiO2 NPs did not affect the relative activities of all tested enzymes in activated sludge, which was consistent with no measurable acute effects on biological nitrogen and phosphorus removal. However, the chronic exposure to 50 mg/L SiO2 NPs induced the inhibitory effects on the activities of NAR and NIR (see Figure 5B), whereas the activities of AMO, NOR, PPX, and PPK were almost the same as those in the control. These results suggested that the chronic exposure to 50 mg/L of SiO2 NPs was able to cause the negative 7186

dx.doi.org/10.1021/es300777b | Environ. Sci. Technol. 2012, 46, 7182−7188

Environmental Science & Technology

Article

because the key enzymes activities and bacterial composition related to biological phosphorus removal were not significantly changed.

the anaerobic and low DO stages after short-term and longterm exposure to SiO2 NPs. It can be seen that short-term and long-term exposure to 1 and 50 mg/L SiO2 NPs did not affect the variations of intracellular PHA and glycogen in both anaerobic and low DO stages, which was consistent with no measurable acute and chronic effects on biological phosphorus removal. Effect of Chronic Exposure to SiO2 NPs on Bacterial Community Structure in Activated Sludge. The bacterial composition of activated sludge in wastewater treatment systems is critical for biological nutrient removal, and wastewater nutrient removal efficiency is affected by the abundance of some key bacteria in activated sludge.28 Recent studies have shown that some NPs can alter the bacterial community structure after long-term exposure.16,38 However, it remains unknown whether the chronic exposure to SiO2 NPs can affect the bacterial compositions in activated sludge. In this study, DGGE analysis illustrated that the bacteria capable of removing wastewater nitrogen, such as ammonia-oxidizing bacteria (band 3 related to Nitrosomonas sp.) and nitriteoxidizing bacteria (band 11 related to Nitrospira sp.), and the most important microorganism responsible for biological phosphorus removal, Candidatus Accumulibacter phosphatis (bands 5 and 8), were still observed in these reactors after long-term exposure to 50 mg/L SiO2 NPs (SI Figure S3). However, some types of bacteria, such as Stenotrophomonas sp. (band 4) and Rhodocyclaceae (band 10), appeared after longterm exposure to 50 mg/L SiO2 NPs, whereas Thiothrix sp. (band 6) and Actinobacteria (band 7) were washed out of activated sludge. It was reported in the literature that Stenotrophomonas sp. was able to tolerate high levels of toxic contaminants,39 and was also observed after long-term exposure to TiO2 NPs.16 Rhodocyclaceae (band 10) was usually found in EBPR systems, and was responsible for wastewater phosphorus removal.40 Thus, it can be seen that the chronic exposure to 50 mg/L SiO2 NPs caused a shift in bacterial community structure in activated sludge. To further investigate the effect of SiO2 NPs on the abundance of key bacteria in activated sludge, the real-time quantitative PCR assays were used to determine the abundance of denitrifying bacteria after long-term exposure to SiO2 NPs. Usually, nitrite reductase genes (nirK and nirS) are widely used as functional markers of denitrifying bacteria, and the quantitative changes of denitrifying bacteria can be evaluated by measuring the copy numbers of nirK and nirS genes.22,23 It was found that the copy numbers of nirK and nirS genes were decreased, respectively, from 1.8 × 106 and 4.2 × 106 copies/g MLVSS to 3.0 × 105 and 7.1 × 105 copies/g MLVSS after longterm exposure to 50 mg/L SiO2 NPs. These results indicated that the chronic exposure to 50 mg/L SiO2 NPs depressed the abundance of denitrifying bacteria, which was another reason for their negative influences on wastewater nitrogen removal. From the above discussion, it should be clear that the environmentally relevant concentration (1 mg/L) of SiO2 NPs did not cause the acute and chronic effects on sludge viability and biological nutrient removal in wastewater treatment systems. However, with the increasing use and environmental release of the NPs, higher concentrations of SiO2 NPs, such as 50 mg/L in this study, could induce the negative impact on wastewater nitrogen removal by decreasing the activities of the denitrifying enzymes (NAR and NIR) and the abundance of denitrifying bacteria. Wastewater phosphorus removal was insensitive to the acute and chronic exposure to SiO2 NPs,

■

ASSOCIATED CONTENT

S Supporting Information *

Tables S1 and S2 and Figures S1−S3. This material is available free of charge via the Internet at http://pubs.acs.org.

■

AUTHOR INFORMATION

Corresponding Author

*Phone: +86 21 65981263; fax: +86 21 65986313; e-mail: [email protected]. Notes

The authors declare no competing financial interest.

■

ACKNOWLEDGMENTS This work was supported by the National Hi-Tech Research and Development Program of China (863 Program) (2011AA060903), the Foundation of State Key Laboratory of Pollution Control and Resources Reuse, and Shanghai Tongji Gao Tingyao Environmental Science & Technology Development Foundation (STGEF).

■

REFERENCES

(1) Nel, A.; Xia, T.; Madler, L.; Li, N. Toxic potential of materials at the nanolevel. Science 2006, 311, 622−627. (2) Gonzalez, L.; Lison, D.; Kirsch-Volders, M. Genotoxicity of engineered nanomaterials: A critical review. Nanotoxicology 2008, 2, 252−273. (3) Slowing, I. I.; Trewyn, B. G.; Lin, V. S. Y. Mesoporous silica nanoparticles for intracellular delivery of membrane-impermeable proteins. J. Am. Chem. Soc. 2007, 129, 8845−8849. (4) Wu, J.; Wang, C.; Sun, J.; Xue, Y. Neurotoxicity of silica nanoparticles: Brain localization and dopaminergic neurons damage pathways. ACS Nano 2011, 5, 4476−4489. (5) Gottschalk, F.; Sonderer, T.; Scholz, R. W.; Nowack, B. Modeled environmental concentrations of engineered nanomaterials (TiO2, ZnO, Ag, CNT, Fullerenes) for different regions. Environ. Sci. Technol. 2009, 43, 9216−9222. (6) Kiser, M. A.; Westerhoff, P.; Benn, T.; Wang, Y.; Perez-Rivera, J.; Hristovski, K. Titanium nanomaterial removal and release from wastewater treatment plants. Environ. Sci. Technol. 2009, 43, 6757− 6763. (7) Brunner, T. J.; Wick, P.; Manser, P.; Spohn, P.; Grass, R. N.; Limbach, L. K.; Bruinink, A.; Stark, W. J. In vitro cytotoxicity of oxide nanoparticles: Comparison to asbestos, silica, and the effect of particle solubility. Environ. Sci. Technol. 2006, 40, 4374−4381. (8) Chang, J. S.; Chang, K. L. B.; Hwang, D. F.; Kong, Z. L. In vitro cytotoxicitiy of silica nanoparticles at high concentrations strongly depends on the metabolic activity type of the cell line. Environ. Sci. Technol. 2007, 41, 2064−2068. (9) Maurer-Jones, M. A.; Lin, Y.; Haynes, C. L. Functional assessment of metal oxide nanoparticle toxicity in immune cells. ACS Nano 2010, 4, 3363−3373. (10) Adams, L. K.; Lyon, D. Y.; Alvarez, P. J. J. Comparative ecotoxicity of nanoscale TiO2, SiO2, and ZnO water suspensions. Water Res. 2006, 40, 3527−3532. (11) Jiang, W.; Mashayekhi, H.; Xing, B. Bacterial toxicity comparison between nano- and micro-scaled oxide particles. Environ. Pollut. 2009, 157, 1619−1625. (12) Limbach, L. K.; Bereiter, R.; Muller, E.; Krebs, R.; Galli, R.; Stark, W. J. Removal of oxide nanoparticles in a model wastewater treatment plant: Influence of agglomeration and surfactants on clearing efficiency. Environ. Sci. Technol. 2008, 42, 5828−5833. 7187

dx.doi.org/10.1021/es300777b | Environ. Sci. Technol. 2012, 46, 7182−7188

Environmental Science & Technology

Article

(13) Choi, O.; Hu, Z. Size dependent and reactive oxygen species related nanosilver toxicity to nitrifying bacteria. Environ. Sci. Technol. 2008, 42, 4583−4588. (14) Ganesh, R.; Smeraldi, J.; Hosseini, T.; Khatib, L.; Olson, B. H.; Rosso, D. Evaluation of nanocopper removal and toxicity in municipal wastewaters. Environ. Sci. Technol. 2010, 44, 7808−7813. (15) Zheng, X.; Wu, R.; Chen, Y. Effects of ZnO nanoparticles on wastewater biological nitrogen and phosphorus removal. Environ. Sci. Technol. 2011, 45, 2826−2832. (16) Zheng, X.; Chen, Y.; Wu, R. Long-term effects of titanium dioxide nanoparticles on nitrogen and phosphorus removal from wastewater and bacterial community shift in activated sludge. Environ. Sci. Technol. 2011, 45, 7284−7290. (17) Keller, A. A.; Wang, H.; Zhou, D.; Lenihan, H. S.; Cherr, G.; Cardinale, B. J.; Miller, R.; Ji, Z. Stability and aggregation of metal oxide nanoparticles in natural aqueous matrices. Environ. Sci. Technol. 2010, 44, 1962−1967. (18) APHA. Standard Methods for the Examination of Water and Wastewater, 20th ed.; American Public Health Association: Washington, DC, 1998. (19) Jiang, Y.; Chen, Y.; Zheng, X. Efficient polyhydroxyalkanoates production from a waste-activated sludge alkaline fermentation liquid by activated sludge submitted to the aerobic feeding and discharge process. Environ. Sci. Technol. 2009, 43, 7734−7741. (20) Purkhold, U.; Pommerening-Roser, A.; Juretschko, S.; Schmid, M. C.; Koops, H. P.; Wagner, M. Phylogeny of all recognized species of ammonia oxidizers based on comparative 16S rRNA and amoA sequence analysis: Implications for molecular diversity surveys. Appl. Environ. Microbiol. 2000, 66, 5368−5382. (21) Muyzer, G.; de Waal, E. C.; Uitterlinden, A. G. Profiling of complex microbial populations by denaturing gradient gel electrophoresis analysis of polymerase chain reaction-amplified genes coding for 16S rRNA. Appl. Environ. Microbiol. 1993, 59, 695−700. (22) Henry, S.; Baudoin, E.; Lopez-Gutierrez, J. C.; Martin-Laurent, F.; Brauman, A.; Philippot, L. Quantification of denitrifying bacteria in soils by nirK gene targeted real-time PCR. J. Microbiol. Methods 2004, 59, 327−335. (23) Henderson, S. L.; Dandie, C. E.; Patten, C. L.; Zebarth, B. J.; Burton, D. L.; Trevors, J. T.; Goyer, C. Changes in denitrifier abundance, denitrification gene mRNA levels, nitrous oxide emissions, and denitrification in anoxic soil microcosms amended with glucose and plant residues. Appl. Environ. Microbiol. 2010, 76, 2155−2164. (24) Mosmann, T. Rapid colorimetric assay for cellular growth and survival: Application to proliferation and cytotoxicity assays. J. Immunol. Methods 1983, 65, 55−63. (25) Napierska, D.; Thomassen, L. C. J.; Rabolli, V.; Lison, D.; Gonzalez, L.; Kirsch-Volders, M.; Martens, J. A.; Hoet, P. H. Sizedependent cytotoxicity of monodisperse silica nanoparticles in human endothelial cells. Small 2009, 5, 846−853. (26) Worle-Knirsch, J. M.; Pulskamp, K.; Krug, H. F. Oops they did it again! Carbon nanotubes hoax scientists in viability assays. Nano Lett. 2006, 6, 1261−1268. (27) Oehmen, A.; Lemos, P. C.; Carvalho, G.; Yuan, Z. G.; Keller, J.; Blackall, L. L.; Reis, M. A. M. Advances in enhanced biological phosphorus removal: From micro to macro scale. Water Res. 2007, 41, 2271−2300. (28) Mino, T.; van Loosdrecht, M. C. M.; Heijnen, J. J. Microbiology and biochemistry of the enhanced biological phosphate removal process. Water Res. 1998, 32, 3193−3207. (29) Zeng, R. J.; Lemaire, R.; Yuan, Z.; Keller, J. Simultaneous nitrification, denitrification, and phosphorus removal in a lab-scale sequencing batch reactor. Biotechnol. Bioeng. 2003, 84, 170−178. (30) Franklin, N. M.; Rogers, N. J.; Apte, S. C.; Batley, G. E.; Gadd, G. E.; Casey, P. S. Comparative toxicity of nanoparticulate ZnO, bulk ZnO, and ZnCl2 to a freshwater microalga (Pseudokirchneriella subcapitata): The importance of particle solubility. Environ. Sci. Technol. 2007, 41, 8484−8490. (31) Xia, T.; Kovochich, M.; Liong, M.; Madler, L.; Gilbert, B.; Shi, H. B.; Yeh, J. I.; Zink, J. I.; Nel, A. E. Comparison of the mechanism of

toxicity of zinc oxide and cerium oxide nanoparticles based on dissolution and oxidative stress properties. ACS Nano 2008, 2, 2121− 2134. (32) Zumft, W. G. Cell biology and molecular basis of denitrification. Microbiol. Mol. Biol. Rev. 1997, 61, 533−616. (33) Martin, H. G.; Ivanova, N.; Kunin, V.; Warnecke, F.; Barry, K. W.; McHardy, A. C.; Yeates, C.; He, S. M.; Salamov, A. A.; Szeto, E.; Dalin, E.; Putnam, N. H.; Shapiro, H. J.; Pangilinan, J. L.; Rigoutsos, I.; Kyrpides, N. C.; Blackall, L. L.; McMahon, K. D.; Hugenholtz, P. Metagenomic analysis of two enhanced biological phosphorus removal (EBPR) sludge communities. Nat. Biotechnol. 2006, 24, 1263−1269. (34) Moura, I.; Moura, J. J. G. Structural aspects of denitrifying enzymes. Curr. Opin. Chem. Biol. 2001, 5, 168−175. (35) Labbe, N.; Parent, S.; Villemur, R. Addition of trace metals increases denitrification rate in closed marine systems. Water Res. 2003, 37, 914−920. (36) Toyofuku, M.; Nomura, N.; Kuno, E.; Tashiro, Y.; Nakajima, T.; Uchiyama, I. Influence of the Pseudomonas quinolone signal on denitrification in Pseudomonas aeruginosa. J. Bacteriol. 2008, 190, 7947−7956. (37) Granger, J.; Ward, B. B. Accumulation of nitrogen oxides in copper-limited cultures of denitrifying bacteria. Limnol. Oceanogr. 2003, 48, 313−318. (38) Ge, Y.; Schimel, J. P.; Holden, P. A. Evidence for negative effects of TiO2 and ZnO nanoparticles on soil bacterial communities. Environ. Sci. Technol. 2011, 45, 1659−1664. (39) Alonso, A.; Sanchez, P.; Martinez, J. L. Stenotrophomonas maltophilia D457R contains a cluster of genes from gram-positive bacteria involved in antibiotic and heavy metal resistance. Antimicrob. Agents Chemother. 2000, 44, 1778−1782. (40) Wagner, M.; Loy, A.; Nogueira, R.; Purkhold, U.; Lee, N.; Daims, H. Microbial community composition and function in wastewater treatment plants. Antonie van Leeuwenhoek 2002, 81, 665−680.

7188

dx.doi.org/10.1021/es300777b | Environ. Sci. Technol. 2012, 46, 7182−7188