AKT1 and AKT2 Induce Distinct Phosphorylation Patterns in HL-1

Subscriber access provided by Northwestern Univ. Library

Article

AKT1 AND AKT2 INDUCE DISTINCT PHOSPHORYLATION PATTERNS IN HL-1 CARDIAC MYOCYTES Michael Reinartz, Annika Raupach, Wolfgang Kaisers, and Axel Gödecke J. Proteome Res., Just Accepted Manuscript • DOI: 10.1021/pr500131g • Publication Date (Web): 27 Aug 2014 Downloaded from http://pubs.acs.org on August 28, 2014

Just Accepted “Just Accepted” manuscripts have been peer-reviewed and accepted for publication. They are posted online prior to technical editing, formatting for publication and author proofing. The American Chemical Society provides “Just Accepted” as a free service to the research community to expedite the dissemination of scientific material as soon as possible after acceptance. “Just Accepted” manuscripts appear in full in PDF format accompanied by an HTML abstract. “Just Accepted” manuscripts have been fully peer reviewed, but should not be considered the official version of record. They are accessible to all readers and citable by the Digital Object Identifier (DOI®). “Just Accepted” is an optional service offered to authors. Therefore, the “Just Accepted” Web site may not include all articles that will be published in the journal. After a manuscript is technically edited and formatted, it will be removed from the “Just Accepted” Web site and published as an ASAP article. Note that technical editing may introduce minor changes to the manuscript text and/or graphics which could affect content, and all legal disclaimers and ethical guidelines that apply to the journal pertain. ACS cannot be held responsible for errors or consequences arising from the use of information contained in these “Just Accepted” manuscripts.

Journal of Proteome Research is published by the American Chemical Society. 1155 Sixteenth Street N.W., Washington, DC 20036 Published by American Chemical Society. Copyright © American Chemical Society. However, no copyright claim is made to original U.S. Government works, or works produced by employees of any Commonwealth realm Crown government in the course of their duties.

Page 1 of 36

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Journal of Proteome Research

AKT1 AND AKT2 INDUCE DISTINCT PHOSPHORYLATION PATTERNS IN HL-1 CARDIAC MYOCYTES

Michael Reinartz1,#, Annika Raupach1,#, Wolfgang Kaisers2, Axel Gödecke1,3 #

1

2

These authors contributed equally

Department of Cardiovascular Physiology, Heinrich-Heine-University Düsseldorf,

Biological and Medical Research Center (BMFZ, CBiBs), Heinrich-Heine-University Düsseldorf Universitätsstraße 1, Düsseldorf D-40225, Germany

Michael Reinartz: [email protected] Annika Raupach: [email protected] Wolfgang Kaisers: [email protected] Axel Gödecke: [email protected]

3

To whom correspondence should be addressed:

Axel Gödecke, Tel.: 49-211-8112675, Fax: 49-211-8112672, E-mail: [email protected]

1 Environment ACS Paragon Plus


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

ABBREVIATIONS CRU (Calcium release unit); DMEM (Dulbecco's Modified Eagle Medium); KD (knock down); KEGG (Kyoto Encyclopedia of Genes and Genomes); PIP3 (Phosphatidylinositol (3,4,5)triphosphate); PLA (Proximity ligation assay); TRIS (tris (hydroxymethyl) aminomethane); SCX (Strong cation exchange chromatography); shRNA (short hairpin ribonucleic acid)

ABSTRACT The protein kinase AKT is a central kinase in the heart and has major impact on growth/hypertrophy, survival/apoptosis and metabolism. To gain more insight into AKT isoform specific signaling at the molecular level we investigated the phosphoproteome of HL-1 cardiomyocytes carrying AKT1 or AKT2 isoform specific knock down, respectively. We combined stable isotope labeling with high resolution mass spectrometry and identified 377 regulated phosphopeptides. Although AKT1 is expressed at four-fold higher levels, insulin stimulation mainly activated AKT2, which might in part rely on a preferred interaction of AKT2 with mammalian target of rapamycin complex 2. In line with this result, the highest number of regulated phosphopeptides was identified in the AKT2 knock down cells. Isoform specific regulation of AKT targets not previously described could be observed and specific regulation of indirect target sites allows a deeper insight into affected biological processes. In the myocardial context we identified many phosphosites supporting a connection of AKT to excitation-contraction coupling. Phosphoproteins identified included L-type calcium channel, ryanodine receptor, junctophilin, histidine-rich calcium binding protein, phospholamban, heat shock protein beta-6, and Ca2+/calmodulin-dependent kinase II. In conclusion, AKT isoform specific knock down combined with quantitative phosphoproteomics provided a powerful strategy to unravel AKT isoform specific signaling.

KEYWORDS AKT, phosphoproteomics, cardiomyocytes, insulin signaling, mass spectrometry, excitationcontraction coupling


Page 2 of 36

Page 3 of 36

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


1. INTRODUCTION Protein kinases are frequently expressed in the form of different isoforms which share a high degree of sequence similarity. Despite these similarities of the primary structure, the single isoforms may exert specific functions in signal transduction. The sequence differences may lead to altered protein interactions, which in turn may affect kinase activation by upstream signals. Alternatively, the substrate specificity of kinase isoforms may modulate different sets of target proteins. Being located at the intersection of several afferent signals and a manifold of downstream targets the protein kinase AKT is expressed as three different isoforms, namely AKT1, AKT2, and AKT3. All three isoforms share a high degree of sequence similarity and are activated in response to hormones and growth factors in a PI3K (phosphoinositide-3-kinase) dependent manner. Formation of PIP3 recruits AKT as well as its upstream kinase PDK1 (phosphoinositide-dependent kinase 1) to the plasma membrane where both bind to PIP3 via their PH-domains. PDK1 then phosphorylates AKT within the T-loop of the catalytic domain at Thr308 which mediates partial activation of AKT.1 Full activation of AKT requires a second phosphorylation of the carboxy-terminal hydrophobic domain at Ser473, which is mainly mediated by mTORC2 (mammalian target of rapamycin complex 2).2, 3 Evidence for isoform specific functions of AKT has been obtained from knock out models. AKT2 knockout mice are insulin resistant and develop a type 2 diabetes-like phenotype.4 In AKT1 knockout mice glucose metabolism is unaffected, but the animals are smaller than their wild type littermates and have higher rates of apoptosis in testis and thymus.5, 6 AKT3 deficient mice develop smaller brains.7 In the heart AKT has gained major attention since regulation of cardiac growth, survival, metabolism, gene expression, and contractility are all influenced by AKT. The diversity of AKT signal transduction in the heart seems to be coordinated by the isoforms AKT1 and AKT2 whereas AKT3 is only weakly expressed under physiological conditions. Analysis of isoform specific functions in knockout mice demonstrated that AKT1 promoted physiological cardiac hypertrophy while it antagonized pathological hypertrophy.8 AKT2, on the other hand, was dispensable for the development of cardiac hypertrophy but was required for regulation of survival in response to ischemic injury and glucose metabolism in cardiomyocytes.9



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 4 of 36

Although AKT signaling was analyzed by proteomic approaches10, 11 identification of regulatory networks specifically affected by AKT1 and AKT2, respectively, has not been achieved until now. Since protein phosphorylation is one major mechanism to control the activity of proteins we performed a comprehensive proteomic approach to identify new targets influenced by AKT signaling in general and to uncover also isoform specific AKT functions at the phosphoproteome level. We applied a quantitative mass spectrometry based approach12 which allowed a simultaneous comparison of relative changes at the phosphorylation level of peptides derived from three different samples. We used the HL-1 cardiomyocyte cell line, a widely used model for cardiac myocytes, to generate AKT1 and AKT2 isoform specific knock down lines13 and identified a wide range of phosphoproteins influenced in an AKT1 and AKT2 dependent manner.

2. MATERIAL AND METHODS 2.1. Cell culture HL-1 cardiomyocytes were a gift from Dr. Claycomb (Louisiana State University) and were maintained as previously described.13 Claycomb medium, supplemented with 2 mM glutamine, 100 U/ml penicillin/streptomycin, 100 µM norepinephrine in 30 mM l-ascorbic acid and 10 % foetal bovine serum, was changed every second day. The culture dishes were pre-coated with a solution of 0.02 % (wt./vol.) gelatine containing 5 µg/ml fibronectin. Cells were grown in an atmosphere of 5 % CO2 at 37 °C. HEK293T cells were maintained in DMEM (supplemented with 10 % fetal calf serum, 2 mM L-glutamine, 0.1 mM non-essential amino acids and 100 U/ml penicillin/streptomycin).

2.2. Generation of stable knock down (KD) cell lines The KD of AKT-isoforms was induced with RNA interference using lentiviral infection of shRNA constructs. To produce the virus, HEK293T cells were transiently transfected with three plasmids (helper plasmid pCD/NL-BH and the VSV-G plasmid (kindly obtained from Jacob Reiser, New Orleans, LA, and Dirk Lindemann, Dresden, Germany) and one containing the shRNA construct) as described previously.14 The shRNA constructs inserted into the vector pLKO.1-puro (mission shRNAi library;

the

RNAi

consortium)

were

obtained

from

Sigma-Aldrich:


shC

(SHC002,

Page 5 of 36

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


CCGGGCACATCAAGATAACGGACTTCTCGAGAAGTCCGTTATCTTGATGTGCTTTTT), AKT1:

#934

(TRCN0000022934,

CCGGGCACATCAAGATAACGGACTTCTCGAGAAGTCCGTTATCTTGATGTGCTTTTT), #935

(TRCN000022935,

CCGGCGTGTGACCATGAACGAGTTTCTCGAGAAACTCGTTCATGGTCACACGTTTTT), #936

(TRCN000022936,

CCGGTGGCACCTTTATTGGCTACAACTCGAGTTGTAGCCAATAAAGGTGCCATTTTT), AKT2:

#258

(TRCN0000055258,

CCGGGCCACGGTACTTCCTTCTGAACTCGAGTTCAGAAGGAAGTACCGTGGCT #259

TTTTG),

(TRCN0000055259,

CGGCGCCTCTTTGAGCTCATTCTTCTCGAGAAGAATGAGCTCAAAGAGGCGTTTTTG), #261

(TRCN000022261,

CCGGTCACTTCAGAAGTGGACACAACTCGAGTTGTGTCCACTTCTGAAGTGATTTTTG). 24 h after transfection, the supernatant containing the virus was collected and used for infection of HL-1 cells. The selection of infected cells (3 µg/ml puromycin) was started 24 h after infection.

2.3. Stimulation of cells for western blot analysis Cells cultured on 6-well plates were serum-starved over night with DMEM (Gibco) supplemented with 100 U/ml penicillin/streptomycin, 2 mM glutamine, and 100 µM norepinephrine in 30 mM Lascorbic acid. Stimulation was performed by addition of 200 nM insulin or 130 nM IGF-1 for ten minutes. Cells were washed twice with ice-cold PBS and lysed in 10 mM TRIS pH 7.5, 150 mM NaCl, 0.1 % IGEPAL CA-630 containing 1.5 mM PMSF, Halt protease inhibitor cocktail single use (Thermo Scientific). In experiments analyzing phosphorylation PhosSTOP phosphatase inhibitor cocktail tablets (Roche) were added.

2.4. Protein analysis For protein analysis cells were lysed in lysis buffer and protein concentrations were determined with BCA Protein Assay Kit (Thermo Scientific). SDS-PAGE and Western blotting were performed as



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

described previously.15 Primary antibodies: AKT1 (2967, 2938), AKT2 (5239, 3063), AKT3 (4059), phospho-AKTSer473 (9271), AKT (pan) mouse (2920), AKT (pan) rabbit (4691), mTOR (2983) from Cell Signaling. Isoform-specific antibodies were validated with tissues from full knock-out mice of AKT1 and AKT2 (data not shown). β-Actin (5386) from Sigma-Aldrich. Secondary antibodies used: α-rabbit or α-mouse IRDye800CW, α-rabbit or α-mouse IRDye680RD from Licor Biosciences. Signals were detected and quantified with infrared Odyssey Scanner (Licor Biosciences).

2.5. Proximity ligation assay In situ proximity ligation assay (PLA) was performed using the Duolink II kit (Olink Bioscience, Uppsala, Sweden) as described previously.16 Briefly, cells were seeded on glass slides covered with fibronectin. 2 hours after seeding, cells were stimulated for 10 minutes with 200 nM insulin, washed with ice-cold PBS and fixed 10 minutes with 4 % paraformaldehyde/0.1 M PBS. Cells were permeabilized for 10 minutes with 0.2 % saponin/PBS, washed with PBS, and blocked 30 minutes in blocking buffer (Olink Biosciences). All further steps were performed according to the manufacturer`s protocol. Primary antibodies (1:50) were incubated over night at 4°C. Finally, cells were mounted with ProLong® Gold antifade reagent with DAPI (Invitrogen, P36931). Images were acquired with fluorescence microscope Keyence BZ9000 using a 60× objective. We used camera software BZ-IIViewer 1.4 and the analyzer software BZ-II-Analyzer 1.4.1 (Keyence). Five to ten image sections were analyzed manually for the ratio of signals per nuclei. For relative quantification the values for shC cells were set to 100%. As control PLA reactions with only one antibody were done in parallel. The very few background signals (data not shown) were subtracted from the particular values.

2.6. Sample preparation for phosphoproteome analysis Comparative phosphoproteome analysis was performed on HL-1 derived ∆AKT1, ∆AKT2 and shC cell lines after insulin stimulation. Cells were grown on dishes until reaching 90 % confluency. Then, cells were starved for 50 minutes followed by stimulation with 200 nM insulin for 10 minutes. Based on previously published data specifically analyzing tyrosine phosphorylation17 this time point relates to maximal activation of early targets and branching of signal transduction into a complex network.


Page 6 of 36

Page 7 of 36

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


After two wash steps with ice-cold PBS cells were lysed in 10 mM Tris, 150 mM NaCl, 0.1 % IGEPAL CA-630, pH 7.4 containing complete Mini EDTA-free protease inhibitor (Roche) and PhosSTOP phosphatase inhibitor cocktail tablets (Roche), which were added immediately before use. Cell lysates were centrifuged at 4000 rpm and 4°C for 20 minutes and the supernatant was taken for further analysis. After determination of the protein amounts with the BCA Protein Assay Kit (Thermo Scientific) protein concentrations were adjusted to the same concentration and equal amounts of protein were acetone precipitated over night. Protein sediments were resuspended in 20 mM Tris, 8 M urea, 0.1 % Rapigest (Waters), pH 8.0. Proteins were reduced with 10 mM DTT for 45 minutes at 37°C and then alkylated with 40 mM iodoacetamide for 30 minutes at 25°C in the dark. Tryptic digest (enzyme:substrate ratio of 1:50; Sequencing Grade Modified Trypsin (Promega), 666 µg protein was digested with 13,3 µg trypsin) was performed over night at 37°C after diluting the samples to 1.6 M urea, 20 mM NH4HCO3 and 3 mM CaCl2. Proteolysis was terminated by acidification with trifluoracetic acid (final pH 0.6, which corresponds to a more than 1.5 fold change in signal intensity. Class 2 candidates had an insignificant t-test but the majority of quantification events had to lie outside the 95 % confidence



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 10 of 36

intervals. Since we used independently transfected cell lines some biological variability is to be expected and can be deduced from AKT quantifications after knock down as revealed by Fig. 1B. The mass spectrometry proteomics data have been deposited to the ProteomeXchange Consortium (http://proteomecentral.proteomexchange.org) via the PRIDE partner repository21 with the dataset identifier PXD000268. Replicates I and II were labeled: AKT1 (light), AKT2 (medium) and shC (heavy), replicates III-VI were labeled: AKT1 (heavy), AKT2 (medium), shC (light).

2.9. Motif search The search for consensus motifs was performed with open-source platform motif-x (http://motifx.med.harvard.edu/).22,

23

Only significantly regulated peptides were used. Additionally, the

phosphorylation sites must have its majority of localization probability above 0.75 for all identifications.24 The following parameters were used: central residue = S* or T*, width = 13, occurrences = 20, significance = 0.000001, background database = IPI mouse Proteome and background central character = S or T. To assign motifs to candidate kinases we used NetPhosK25 and Phosida26.

2.10 Gene Ontology (GO) term and KEGG pathway analysis GO term and KEGG pathway analysis were performed with the ClueGO 2.1.1 plugin27 (updated 20.03.2014)

and

Cytoscape

3.028

or

the

DAVID

Bioinformatics

Resources

6.7

(http://david.abcc.ncifcrf.gov/)29.

2.11 Search for AKT substrates For identification of AKT substrates we used PhosphosSitePlus (http://www.phosphosite.org), containing 29 and 272 phosphosites for AKT1 and AKT2, respectively (20.05.2014).30

3. RESULTS To investigate isoform specific signaling of AKT in HL-1 cardiomyocytes we generated stable knock down cell lines of AKT1 (∆AKT1) and AKT2 (∆AKT2) via RNA interference by lentiviral


Page 11 of 36

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


infection to express shRNA constructs. For each isoform we tested three different shRNA constructs (binding positions of shRNA see Supplemental Fig. A.1) for efficient suppression of AKT1 and AKT2, respectively. The shRNA sequences yielding the highest knock down efficiencies were used for further experiments (#934/∆AKT1, #258 or #259/∆AKT2). A cell line which expresses shRNA without any target in murine cells was generated as control (shC).

3.1. AKT1 is expressed at four-fold higher levels than AKT2 Quantitative analysis of AKT isoform expression was performed by near-infrared detection on Western blots (Fig. 1A). When compared to shC cells, AKT1 expression was reduced in ∆AKT1 cells by 90 %, AKT2 expression was reduced in ∆AKT2 cells by 85 % (Fig. 1B). It is important to note that knock down of a specific isoform did neither elevate expression of the other expressed isoform (Fig. 1B) nor did it induce expression of AKT3 (Supplemental Fig. A.2), which was also not found in HL-1 and shC cells, respectively. Next, we determined the relative expression levels of AKT1 and AKT2. Western analysis with an anti-pan-AKT antibody (Fig. 1C), which binds a common epitope of all AKT isoforms, revealed that in ∆AKT1 cells the total AKT expression level had dropped by 75 % (Fig. 1D). However, ∆AKT2 cells revealed only a slight decrease in total AKT expression (-25 %). Since the knock down of the AKT isoforms was similarly efficient in ∆AKT1 and ∆AKT2 cells the remaining signal detected by the pan-AKT antibody referred almost exclusively to AKT2 in ∆AKT1 cells, while on the opposite the signal of ∆AKT2 cells accounted for AKT1 protein. In conclusion, AKT1 contributes to approximately 75 % of total AKT expression, whereas AKT2 expression amounts to only 25 % in HL-1 cells.

3.2. AKT2 is preferably phosphorylated by IGF-1/insulin stimulation In further experiments we analyzed the effect of isoform knock down on the activation of AKT. Cells were stimulated with insulin and IGF-1, respectively, and the extent of Ser473 phosphorylation was determined. Under basal conditions, AKT was hardly phosphorylated in all tested cell lines (Fig. 2A). However, IGF-1 stimulation led to a substantial increase in Ser473 phosphorylation. Quantification (Fig. 2B) demonstrated that AKT phosphorylation in ∆AKT1 was similar to that in HL-



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

1 cells, despite the almost complete knock down of the major AKT isoform. ∆AKT2 cells, however, exhibited an almost 50 % reduction of total AKT phosphorylation. Comparable results were determined for stimulation by insulin. These results suggest that the minor isoform AKT2 was the preferred phosphorylation target after insulin/IGF-1 stimulation. This finding was supported by proximity ligation assay, using a combination of pan-AKT- and pAKTSer-antibodies, which allows the simultaneous identification of AKT and its phosphorylation in situ. In insulin-stimulated ∆AKT2 cells, signals indicating AKT phosphorylation were strongly reduced in comparison to shC cells (Fig. 2C). In contrast, the labeling of phospho-AKT was only moderately reduced in ∆AKT1 cells compared to shC cells. Quantification of three independent assays revealed a phosphorylation signal reduction by 85 % in ∆AKT2 and by 55 % in ∆AKT1 cells in comparison to shC cells (Fig. 2D). These results underline the preferred phosphorylation of AKT2 by insulin stimulation.

3.3. mTOR interacts preferentially with AKT2 Since IGF-1 and insulin appear to signal preferably via AKT2 activation, we sought to determine the cause for this preference. One possible explanation could be a more effective interaction between AKT2 and the mTORC2 complex, which is assumed to phosphorylate Ser473 of AKT.3 Immunoprecipitation of AKT2 did not result in a detectable co-IP of mTORC2. Since we have recently shown that the majority of AKT2 associated proteins interact only weakly16 we investigated if the interaction of mTORC and AKT2 could be monitored in situ by PLA using mTor and pan-AKT antibodies. As shown in Fig. 2E, signal intensity of AKT-mTOR PLA was lower in ∆AKT2 and ∆AKT1 cells than in shC cells. The quantification reveals a 50 % reduction of interaction signals for both knock down cell lines (Fig. 2F). The low amount of AKT2 in ∆AKT1 cells generates almost the same number of interactions, compared to the high amount of AKT1 in ∆AKT2 cells. Thus, in view of its lower expression level, AKT2 appears to interact with mTORC to a relatively higher extent than AKT1.

3.4. Phosphoproteome analysis uncovers AKT isoform specific regulation of proteins


Page 12 of 36

Page 13 of 36

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Based on our KD cell lines we investigated AKT-isoform specific effects at the phosphoproteome level of ∆AKT1 and ∆AKT2 cell lines in comparison to sh-controls. To perform a simultaneous, relative quantification of phosphopeptides derived from three cell lines we applied stable isotope dimethyl labeling, phosphopeptide enrichment followed by SCX or IEF fractionation prior to reversed-phase nano-LC-MS/MS analysis. Totally, we analyzed six biological replicates and identified more than 8400 unique phosphopeptides of which more than 6300 phosphopeptides were quantified at least twice. Labeling efficacy was controlled by database search for unlabeled peptides and revealed that less than 0.5 % unlabeled phosphopeptides were identified by the MaxQuant software with respect to labeled phosphopeptides (Andromeda score >60, data not shown). The complete MaxQuant Phospho (STY) output tables for the individual experiments are provided in the Supplemental Table A.1. As illustrated in Fig. 3A, the majority of phosphopeptides was not influenced by AKT knock down and insulin treatment. The number of peptides specifically altered in ∆AKT2 cells was five-fold higher than for ∆AKT1 (Fig. 3B). In addition, a third group was identified with regulated phosphosites for ∆AKT1 as well as ∆AKT2 cells. Therefore, the level of these phosphopeptides is modulated by AKT in an isoform-independent manner. Interestingly, for two phosphopeptides (28S ribosomal protein S34) opposite isoform regulation was observed. A complete list of these regulated phosphopeptides is presented in Supplemental Table A.2 and the annotated phosphopeptide spectra are shown in Supplemental Figure A.3. Details of MS survey scans showing intensities for labeled phosphopeptides of the three different cell lines exemplify AKT-isoform specific as well as isoformindependent types of regulation (Fig. 3C). A phosphopeptide carrying Ser16 and Thr17 of cardiac phospholamban was downregulated due to the AKT2 knock down (Fig. 3C.1), whereas a phosphopeptide of AHNAK was upregulated in the same cell line (Fig. 3C.2). The same peptides were not significantly changed in the ∆AKT1 cell line when compared to the sh-control, thus regulation is AKT2 specific in both cases. AKT1 isoform specific downregulation was observed, e.g., for a phosphopeptide of the transcription factor FOXO4 (Forkhead box protein O4) (Fig. 3C.3) and a phosphopeptide of CaMKII-δ (Calcium/ calmodulin-dependent protein kinase II) in both AKT knock down cell lines (Fig. 3C.4).



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

3.5. AKT knock down has far reaching effects on kinase networks Since we were analyzing stable knockdown cell lines we expected that the altered phosphopeptides did not only represent AKT-specific targets. Given the widespread organization of kinases into regulatory networks, we rather expected that also substrates of other kinases would be affected by the inactivation of AKT isoforms. In an initial search (Supplemental Table A.3) we therefore screened for the identification of known AKT targets which are published on PhosphoSitePlus.30 Our analysis identified 37 of these AKT phosphosites. Of these were 36 quantified and one of these was regulated, namely Ser16 and Thr17 of cardiac phospholamban (regulated phosphopeptide, Fig. 3C.1). Some identified known AKT sites included Ser39 of Vimentin, Ser155 of Bad (Bcl2 antagonist of cell death), and Ser9 of Glycogen Synthase Kinase 3 beta (Supplemental Table A.3). To find out whether other kinase consensus sites were enriched among the regulated phosphopeptides, we performed a kinase motif search including all regulated phosphopeptides with motif-x.23 As shown in Fig. 4 several consensus sites for kinases other than AKT including MAPK, PKA (cAMP-dependent protein kinase), CaMKII, and Casein kinase 2 were identified by motif-x, NetPhosK and Phosida for ∆AKT2 cells. For ∆AKT1-specific and isoform unspecific regulated peptides the search failed due to small pool size. Phosphopeptides containing the RXXS* AKT-like substrate motif are listed in Supplemental Table A.4. 44 of the regulated phosphopeptides were grouped into this motif indicating that beyond known AKT targets published on PhosphoSitePlus novel AKT target sites might be among the identified phosphopeptides. A Gene Ontology (GO) term analysis of all regulated phosphopeptides demonstrated that MAPKK and CaMKII isoforms and also several other kinases like STK3 (serine/threonine-protein kinase 3), ribosomal protein S6 kinase or TNIK (TRAF2 and NCK interacting kinase) pointing to comprehensive downstream effects of these kinases in the context of AKT dependent signaling (Supplemental Table A.5, GO Terms, subgroup kinase activity).

3.6. Distinct networks of phosphoproteins are modulated by AKT1 and AKT2 GO term analysis was used to identify biological processes that might be influenced in an AKT dependent manner. A visualization of such an analysis is shown in Fig. 5. The resulting networks for regulated proteins of ∆AKT2 (A) and ∆AKT1 (B) cells reveal quantitative and qualitative differences.


Page 14 of 36

Page 15 of 36

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


The most complex network was obtained for ∆AKT2 cells. As revealed by the most significant term of each functional group the ∆AKT2 derived network relies on proteins involved in cardiac muscle tissue development, regulation of heart contraction, Ras protein signal transduction, negative regulation of actin filament depolymerization and protein targeting. Phosphoproteins observed for the ∆AKT1 cells categorize into terms regulation of heart rate and regulation of relaxation of cardiac muscle. Since we used HL-1 cardiac myocytes as a model system we selected the regulated phosphopeptides falling into GO terms dealing with heart and fused them into one table to exemplify isoform dependent regulation (Table 1). Selected phosphoproteins from Table 1 are schematically visualized in the context of excitation-contraction coupling in Fig. 6. Heart relevant terms (adrenergic signaling in cardiomyocytes, dilated cardiomyopathy) were also identified besides others (e.g. MAPK signaling pathway, regulation of actin cytoskeleton) in a search for KEGG pathways (Supplemental Table A.5, KEGG pathways; Supplemental Figure A.4).

4. DISCUSSION This study performed for the first time a comprehensive phosphoproteome analysis to dissect AKT isoform-specific signaling. The major results presented in this paper are as follows: (i) Loss of specific AKT isoforms results in widespread alterations of the phosphoprotein network in HL-1 cells which to a major extent occurs via altered activity of other kinases. CaMKII, MAPK, and Casein kinase 2 signaling were substantially affected by the knock down of AKT1 and AKT2. (ii) Loss of AKT2 function resulted in quantitatively stronger effects on the cardiomyocyte signaling networks. (iii) The underlying mechanism for the predominant action of AKT2 is, at least in part, a preferred activation of AKT2 in response to insulin.

4.1. Preferred activation of the AKT2 isoform might in part rely on higher interaction of mTORC2 with AKT2 Using a shRNA-mediated knockdown strategy we generated cell lines with a chronic knock down of AKT1 and AKT2 isoforms in HL-1 cardiomyocytes. Characterization of the knock down cell lines revealed that AKT1 was the dominant isoform accounting for around 75 %, whereas AKT2 made up



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

the residual 25 % of the total AKT protein. This result is similar to the murine heart where AKT1 is also the quantitatively dominant isoform.31 The functional significance of the quantitative difference remains obscure because we demonstrated here, that despite the differences in expression levels, AKT2 was the predominantly phosphorylated isoform after stimulation with insulin and IGF-1. In adipocytes, AKT2 has also been identified as the preferred phosphorylation target32, but in these cells, AKT2 is also the dominant isoform on the protein level.33 Thus, irrespective of differences in AKT protein amount AKT2 seems to be the preferred isoform which is activated upon stimulation with insulin or IGF-1. In line with this observation was the finding that despite differences in protein levels AKT1 and AKT2 interacted to a similar extent with mTOR, which is part of both, mTORC1 and mTORC2. Our data suggest that the AKT-mTOR interaction detected in HL-1 cells in situ reflects the activation of AKT isoforms by mTORC2, which phosphorylates AKT on Ser473. Since AKT regulates mTORC1 indirectly via TSC2-Rheb (Tuberous sclerosis complex 2, GTP-binding protein Rheb) or PRAS40 (Proline-rich AKT substrate), a direct interaction of the mTORC1 complex and AKT is unlikely and has not been described so far. These data demonstrate that the relative activation of a kinase isoform by upstream signaling molecules may represent an important determinant of isoform specific effects. Interestingly, the major AKT1 pool was not activated to a large extent and even inactivation of AKT2 did not result in an elevated AKT1 phosphorylation/activation. Thus, the preferred activation of AKT2 is not simply due to a competition for limited binding sites. This mechanism may rather include the contribution of additional factors such as adaptor proteins, which might convey isoform-specific phosphorylation, as shown for adaptor proteins WDFY234 and APLL35 which specifically co-localize with AKT2 and mediate its activation after insulin stimulation in adipocytes.

4.2. Loss of AKT signal transduction affects other kinases with impact on many biological processes In the heart, AKT has a major impact on growth/hypertrophy, survival/apoptosis and metabolism.36 To gain deeper insight into AKT isoform-specific signaling in cardiomyocytes we analyzed AKTmediated changes in the phosphoproteome of HL-1 cells upon insulin stimulation. Since we used cell lines with stable expression of shRNA downregulating AKT1 and AKT2 kinases, respectively,


Page 16 of 36

Page 17 of 36

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


quantitative alterations of phosphopeptides could be the result of different processes. These may include reduced phosphorylation due to down regulated AKT1/AKT2 kinases. However, since AKT kinases are part of widespread regulatory networks involving further downstream kinases, reduced or even elevated phosphorylation levels could occur due to an AKT dependent effect on these downstream effectors. Moreover, AKT regulates the activity of transcription factors and therefore also differences in protein expression might account for altered levels of phosphopeptides. In our analysis we identified regulated phosphopeptides of several proteins which are involved in the regulation of transcription

(e.g.

CREB

regulated

transcription

coactivator

3;

MKL

(megakaryoblastic

leukemia)/myocardin-like 1; FOXO4 (forkhead box O4); Supplemental Table A.6) Whatever the underlying cause may be, our experimental setup, which is similar to the chronic inactivation of genes in knockout mice, leads to the identification of regulatory networks which are modulated by AKT1, AKT2, or both. Akt signaling modulated around 6 % (377) of identified phosphopeptides derived from proteins involved in diverse biological processes. Only 5 % of the significantly altered phosphopeptides were equally targeted in both knock down cell lines. In ∆AKT2 cells, however, 80 % of the affected phosphopeptides (300) were identified which is in accordance with the observation that AKT2 is the preferred isoform activated by insulin. 15 % of the phosphopeptides were altered in an AKT1 dependent manner. Among the many phosphopeptides significantly changed due to AKT knockdown, approximately 12 % contained an AKT consensus motif as identified by a search with motif-x. Comparison of the data to published AKT substrates on PhosphoSitePlus30 revealed that only a subset of known AKT substrates was identified (Supplemental Table A.3). As expected several other kinases contribute to phosphorylation changes. We found that the consensus phosphorylation sites of MAPK, CK2, PKA, and CaMKII were enriched above background sequences in ∆AKT2 cells. Taken together, the majority of phosphosites altered due to AKT1/AKT2 knockdown were affected indirectly by other kinases, but in an AKT dependent manner. Interestingly, for these and other kinases altered phosphopeptides were identified (Supplemental Table A.5). This demonstrated, that the observed



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

global changes of the phosphorylation pattern appeared to involve a widespread signaling network modulated by a primary loss of AKT1/AKT2 signal transduction. GO term analysis identified terms that link AKT1 and AKT2 to specific functions. AKT2 knockdown substantially affected regulation of heart contraction and cardiac muscle tissue development, Ras protein signal transduction, negative regulation of actin filament depolymerization and protein targeting. On the other hand, AKT1-specific targets built a small network covering the terms regulation of heart rate and regulation of relaxation of cardiac muscle. Thus, our phosphoproteome analysis clearly distinguishes AKT1 and AKT2 dependent functions in cardiac myocytes.

4.3. Proteins involved in excitation-contraction coupling are modulated by AKT Among others, systematic analysis uncovered a wide-spread, unappreciated modulation of proteins involved in Ca2+ homeostasis by AKT1, AKT2 or both. Sarcolemmal Ca2+ entry and Ca2+ release from the sarcoplasmic reticulum (SR) are the basis for excitation contraction coupling. These processes require a highly ordered structure like the Ca2+ release unit (CRU) which includes L-type calcium channel (LTCC), ryanodine channels (RyR2) and accessory proteins such as triadin, junctophilin and junctin. We observed a regulated phosphopeptide for which two phosphosites (Ser1950, Ser1951) were predicted with equal probability located in subunit α-1D (CaV1.3) of the LTCC showing less intensity in both ∆AKT cell lines, whereby Ser1951 shows a higher probability score for an AKT consensus site (analyzed with GPS 2.1).37 It was shown that PI3K and AKT inhibitors exert acute effects on [Ca2+]i, Ca2+ transients, and membrane Ca2+ current in HL-1 cardiomyocytes.38 Our identification of a new AKT-dependent phosphosite might provide a molecular mechanism for this observation. It was also shown that loss of PI3K p110α, an important activator of AKT signaling, resulted in a reduction of inward Ca2+ current and contractile dysfunction due to a reduced number of voltage-dependent L-type Ca2+ channels.39 Moreover, AKT-dependent phosphorylation appears to inhibit the proteolytic degradation of the CaVβ2 accessory subunit.40 The reduced level of the Ser1950 or 1951 phosphopeptide might reflect a destabilization and increased degradation of the LTCC pore-forming subunit due to AKT knock down. Decreased channel density was also observed in db/db obese type 2 diabetic mice


Page 18 of 36

Page 19 of 36

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


relating LTCC function to the development of diabetes associated cardiomyopathy.41 In cardiac myocytes LTCC mediated Ca2+ entry stimulates the Ca2+ release from the SR by activation of the ryanodine receptor. CaMKII phosphorylates the ryanodine receptor at Ser2807,

2813

residue.42,

43

We

observed downregulation of this double phosphorylated peptide in AKT2 knock down cells. Although Ser2807 is a known CaMKII site it also resembles the AKT consensus motif. Thus, we assume that it may be phosphorylated by AKT2 as well. Besides the ion channels junctophilin 2 is an important element of the CRU by keeping the LTCC and the ryanodine receptor at precise distance.44 A phosphopeptide of junctophilin-2, the dominant isoform in the heart, was increased in ∆AKT2 cells. Knockdown of junctophilin-2 expression results in a maturation block of the T-tubular system45 and mutations in junctophilin-2 are associated with hypertrophic cardiomyopathy.46 We also identified proteins involved in Ca2+ reuptake as targets of AKT signaling. A prominent example of a direct AKT target is cardiac phospholamban which can be phosphorylated on Ser16 and Thr17. The selected phosphopeptide was significantly less abundant in the ∆AKT2 cell line (Fig. 3C.1). Since two phosphosites are present in this peptide, altered phosphorylation of either site can be responsible for the observation. In cardiac muscle Ser16 is specifically phosphorylated by PKA following β-adrenergic stimulation whereas Thr17 may be targeted by CaMKII-δ47, 48 and by AKT49. Upon insulin stimulation AKT associates with the SR, where it seems to selectively phosphorylate phospholamban at Thr17. Increased phospholamban phosphorylation would release SERCA2a from inhibition and accelerate Ca2+ reuptake into the sarcoplasmic reticulum. Our results suggest that selectively AKT2 might be responsible for Thr17 phosphorylation upon insulin stimulation. Regulation of contractile function and Ca2+ cycling by AKT is further underscored by the identification of additional candidates like histidine-rich calcium binding protein (HRC) and heat shock protein beta-6 (HspB6) (Fig. 6). HRC appears to regulate SERCA2a and the ryanodine receptor and may coordinate cross-talk between Ca2+-uptake and release by the SR.50 HspB6 modulates the protein phosphatase 1/phospholamban axis leading to enhanced SR Ca2+-cycling.51 The prominent regulatory phosphosite of HspB6 is Ser16, which was less phosphorylated in our ∆AKT2 cells and resembles the AKT consensus motif. Interestingly, it was shown that HspB6 binds to phosphorylated



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 20 of 36

AKT, providing a direct link between activated AKT and HspB6.52 As pointed out above, several of the altered phosphosites reduced by AKT knockdown resemble also the consensus motif of CaMKIIisoforms. Interestingly, we observed phosphosites of CaMKII isoforms β, γ and δ that were downregulated in ∆AKT cells. A peptide bearing Ser315, 319 of CaMKII-δ was reproducibly decreased in both ∆AKT cell lines, but the functional significance of this phosphorylation is presently not known. We found that a peptide carrying P-Ser311 of CaMKII-γ showed less intensity especially in ∆AKT2 cells. Phosphorylation of Ser311 was previously observed in other proteomic analyses.53,

54

Several reasons argue for a possible regulatory function of this phosphosite: The close proximity of Ser311 to the regulatory Thr306 phosphorylation site suggests that this phosphorylation has also regulatory properties. Thr306 is a target for autophosphorylation which inhibits CaMKII-γ activity by prevention of Calmodulin (CaM) binding when phosphorylated.55 Moreover, oxidation of Met308, a site prone to oxidation also interferes with CaM binding.56 Therefore, the AKT2 dependent phosphorylation of Ser311 most likely represents a further mechanism which regulates CaMKII-γ activity. Another example for the close relationship of AKT and CaMKII signaling is connexin 43. Two phosphopeptides specifically downregulated in ∆AKT2 cells were identified, whereby either Ser364 or Ser365 were predicted as likely phosphorylation sites. The latter has been identified as a CaMKII site in vitro57. Besides many proteins involved in Ca2+ cycling, proteins of the contractile apparatus were AKT (isoform-specific) targets as well (Fig. 6). Several phosphosites of the sarcomeric protein titin58 were downregulated. Phosphorylation of titin may affect the passive mechanical properties of the sarcomere and regulate protein interactions. In ∆AKT2 cells, obscurin, which represents an interaction partner of titin was less phosphorylated. Obscurin also interacts with other sarcomeric proteins like myosin, and MyBP-C (slow) (myosin binding protein C, slow) and also with non sarcomeric proteins like small ankyrin 1, located in the SR membrane.59 Therefore, obscurin appears to coordinate the assembly and organization of the sarcoplasmic reticulum with myofibrillar elements. Besides several phosphosites regulated without AKT isoform specificity, Ser282 of cardiac myosin binding protein C (cMyBP-C) was downregulated in an AKT2 isoform dependent manner. Phosphorylation of this residue is of major importance for cardiac function, since cMyBP-C phosphorylation levels were markedly


Page 21 of 36

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


decreased in human and experimental heart failure60, 61 and its phosphorylation may be involved in protection of the myocardium from ischemic injury.62 Another myofilament protein in the Ca2+dependent regulation of actin-myosin interaction is tropomyosin 1 α (Tpm1) which we identified with reduced phosphorylation at Ser283 or Thr282 in both knock down cell lines. Recently, it was demonstrated that pseudo-phosphorylation of Ser283 slowed deactivation of the thin filament and myofibril relaxation.63 We also identified regulated myosin phosphosites, but the functional significance of these sites is unknown yet. In summary, our phosphoproteomic analysis yielded vast information on AKT isoform specific signal transduction. Since we found that also phosphopeptides of several transcription factors as well as proteins involved in translational control (Supplemental Table A.6) were influenced by the AKT knock down often in an isoform specific manner, we expect that part of the altered phosphopeptides may be the result of transcriptional or translational effects of AKT isoform inactivation. Irrespective of the cause of the altered phosphorylation level, we clearly demonstrate that phosphoproteomics substantially extends our view on AKT1 and AKT2 specific functions in cardiac myocytes.

ASSOCIATED CONTENT Supporting Information Position of shRNAs in the AKT protein. Expression of AKT3 in HL-1 cardiomyocytes. Annotated spectra of phosphopeptides regulated by AKT. Selected KEGG pathways retrieved for regulated phosphopeptides analysed with DAVID. Phospho (STY) Sites identified by the MaxQuant Software. Complete list of regulated phosphopeptides. Screening result for identification of known AKT phosphosites. Motif-x search results for regulated phosphopeptides in ∆AKT2 cells carrying the RXXS* motif. Cytoscape/ClueGO analysis for GO terms and KEGG pathways. Regulated transcription factors and proteins involved in translation. Supporting Information - This material is provided free of charge via the internet http://[email protected].



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

DISCLOSURES The authors have no conflicts of interest to declare.

ACKNOWLEDGMENTS This work was supported by a DFG grant through SFB612, “Molekulare Analyse kardiovaskulärer Funktionen und Funktionsstörungen”, Teilprojekt A5.

REFERENCES 1. Alessi, D. R.; James, S. R.; Downes, C. P.; Holmes, A. B.; Gaffney, P. R.; Reese, C. B.; Cohen, P., Characterization of a 3-phosphoinositide-dependent protein kinase which phosphorylates and activates protein kinase Balpha. Current biology : CB 1997, 7, (4), 261-9. 2. Guertin, D. A.; Stevens, D. M.; Thoreen, C. C.; Burds, A. A.; Kalaany, N. Y.; Moffat, J.; Brown, M.; Fitzgerald, K. J.; Sabatini, D. M., Ablation in mice of the mTORC components raptor, rictor, or mLST8 reveals that mTORC2 is required for signaling to Akt-FOXO and PKCalpha, but not S6K1. Developmental cell 2006, 11, (6), 859-71. 3. Sarbassov, D. D.; Guertin, D. A.; Ali, S. M.; Sabatini, D. M., Phosphorylation and regulation of Akt/PKB by the rictor-mTOR complex. Science 2005, 307, (5712), 1098-101. 4. Cho, H.; Mu, J.; Kim, J. K.; Thorvaldsen, J. L.; Chu, Q. W.; Crenshaw, E. B.; Kaestner, K. H.; Bartolomei, M. S.; Shulman, G. I.; Birnbaum, M. J., Insulin resistance and a diabetes mellitus-like syndrome in mice lacking the protein kinase Akt2 (PKB beta). Science 2001, 292, (5522), 1728-1731. 5. Cho, H.; Thorvaldsen, J. L.; Chu, Q. W.; Feng, F.; Birnbaum, M. J., Akt1/PKB alpha is required for normal growth but dispensable for maintenance of glucose homeostasis in mice. J Biol Chem 2001, 276, (42), 38349-38352. 6. Chen, W. S.; Xu, P. Z.; Gottlob, K.; Chen, M. L.; Sokol, K.; Shiyanova, T.; Roninson, I.; Weng, W.; Suzuki, R.; Tobe, K.; Kadowaki, T.; Hay, N., Growth retardation and increased apoptosis in mice with homozygous disruption of the akt1 gene. Gene Dev 2001, 15, (17), 2203-2208. 7. Tschopp, O.; Yang, Z. Z.; Brodbeck, D.; Dummler, B. A.; Hemmings-Mieszczak, M.; Watanabe, T.; Michaelis, T.; Frahm, J.; Hemmings, B. A., Essential role of protein kinase B gamma (PKB gamma/Akt3) in postnatal brain development but not in glucose homeostasis. Development 2005, 132, (13), 2943-2954. 8. DeBosch, B.; Treskov, I.; Lupu, T. S.; Weinheimer, C.; Kovacs, A.; Courtois, M.; Muslin, A. J., Akt1 is required for physiological cardiac growth. Circulation 2006, 113, (17), 2097-2104. 9. DeBosch, B.; Sambandam, N.; Weinheimer, C.; Courtois, M.; Muslin, A. J., Akt2 regulates cardiac metabolism and cardiomyocyte survival. J Biol Chem 2006, 281, (43), 32841-32851. 10. Humphrey, S. J.; Yang, G.; Yang, P. Y.; Fazakerley, D. J.; Stockli, J.; Yang, J. Y.; James, D. E., Dynamic Adipocyte Phosphoproteome Reveals that Akt Directly Regulates mTORC2. Cell Metab 2013, 17, (6), 1009-1020. 11. Ray, B. N.; Kweon, H. K.; Argetsinger, L. S.; Fingar, D. C.; Andrews, P. C.; Carter-Su, C., Research Resource: Identification of Novel Growth Hormone-Regulated Phosphorylation Sites by Quantitative Phosphoproteomics. Mol Endocrinol 2012, 26, (6), 1056-1073.


Page 22 of 36

Page 23 of 36

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


12. Boersema, P. J.; Raijmakers, R.; Lemeer, S.; Mohammed, S.; Heck, A. J. R., Multiplex peptide stable isotope dimethyl labeling for quantitative proteomics. Nat Protoc 2009, 4, (4), 484-494. 13. Claycomb, W. C.; Lanson, N. A.; Stallworth, B. S.; Egeland, D. B.; Delcarpio, J. B.; Bahinski, A.; Izzo, N. J., HL-1 cells: A cardiac muscle cell line that contracts and retains phenotypic characteristics of the adult cardiomyocyte. P Natl Acad Sci USA 1998, 95, (6), 2979-2984. 14. Godecke, S.; Roderigo, C.; Rose, C. R.; Rauch, B. H.; Godecke, A.; Schrader, J., Thrombin-induced ATP release from human umbilical vein endothelial cells. Am J PhysiolCell Ph 2012, 302, (6), C915-C923. 15. Weser, S.; Gerlach, M.; Kwak, D. M. S.; Czerwinska, M.; Godecke, A., Detection of TAP-tagged proteins in Western blot, confocal laser scanning microscopy and FACS using the ZZ-domain. J Biochem Bioph Meth 2006, 68, (3), 189-194. 16. Bottermann, K.; Reinartz, M.; Barsoum, M.; Kotter, S.; Godecke, A., Systematic Analysis Reveals Elongation Factor 2 and alpha-Enolase as Novel Interaction Partners of AKT2. Plos One 2013, 8, (6). 17. Kruger, M.; Kratchmarova, I.; Blagoev, B.; Tseng, Y. H.; Kahn, C. R.; Mann, M., Dissection of the insulin signaling pathway via quantitative phosphoproteomics. P Natl Acad Sci USA 2008, 105, (7), 2451-2456. 18. Maiolica, A.; Borsotti, D.; Rappsilber, J., Self-made frits for nanoscale columns in proteomics. Proteomics 2005, 5, (15), 3847-50. 19. Cox, J.; Mann, M., MaxQuant enables high peptide identification rates, individualized p.p.b.-range mass accuracies and proteome-wide protein quantification. Nat Biotechnol 2008, 26, (12), 1367-1372. 20. Cox, J.; Neuhauser, N.; Michalski, A.; Scheltema, R. A.; Olsen, J. V.; Mann, M., Andromeda: A Peptide Search Engine Integrated into the MaxQuant Environment. J Proteome Res 2011, 10, (4), 1794-1805. 21. Vizcaino, J. A.; Cote, R. G.; Csordas, A.; Dianes, J. A.; Fabregat, A.; Foster, J. M.; Griss, J.; Alpi, E.; Birim, M.; Contell, J.; O'Kelly, G.; Schoenegger, A.; Ovelleiro, D.; PerezRiverol, Y.; Reisinger, F.; Rios, D.; Wang, R.; Hermjakob, H., The Proteomics Identifications (PRIDE) database and associated tools: status in 2013. Nucleic Acids Res 2013, 41, (D1), D1063-D1069. 22. Chou, M. F.; Schwartz, D., Biological sequence motif discovery using motif-x. Current protocols in bioinformatics / editoral board, Andreas D. Baxevanis ... [et al.] 2011, Chapter 13, Unit 13 15-24. 23. Schwartz, D.; Gygi, S. P., An iterative statistical approach to the identification of protein phosphorylation motifs from large-scale data sets. Nat Biotechnol 2005, 23, (11), 1391-1398. 24. Olsen, J. V.; Blagoev, B.; Gnad, F.; Macek, B.; Kumar, C.; Mortensen, P.; Mann, M., Global, in vivo, and site-specific phosphorylation dynamics in signaling networks. Cell 2006, 127, (3), 635-48. 25. Blom, N.; Sicheritz-Ponten, T.; Gupta, R.; Gammeltoft, S.; Brunak, S., Prediction of post-translational glycosylation and phosphorylation of proteins from the amino acid sequence. Proteomics 2004, 4, (6), 1633-49. 26. Gnad, F.; Gunawardena, J.; Mann, M., PHOSIDA 2011: the posttranslational modification database. Nucleic Acids Res 2011, 39, (Database issue), D253-60. 27. Bindea, G.; Mlecnik, B.; Hackl, H.; Charoentong, P.; Tosolini, M.; Kirilovsky, A.; Fridman, W. H.; Pages, F.; Trajanoski, Z.; Galon, J., ClueGO: a Cytoscape plug-in to decipher functionally grouped gene ontology and pathway annotation networks. Bioinformatics 2009, 25, (8), 1091-3. 28. Smoot, M. E.; Ono, K.; Ruscheinski, J.; Wang, P. L.; Ideker, T., Cytoscape 2.8: new features for data integration and network visualization. Bioinformatics 2011, 27, (3), 431-2. 29. Huang da, W.; Sherman, B. T.; Lempicki, R. A., Systematic and integrative analysis of large gene lists using DAVID bioinformatics resources. Nat Protoc 2009, 4, (1), 44-57. 30. Hornbeck, P. V.; Kornhauser, J. M.; Tkachev, S.; Zhang, B.; Skrzypek, E.; Murray, B.; Latham, V.; Sullivan, M., PhosphoSitePlus: a comprehensive resource for investigating the 23 Environment ACS Paragon Plus


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

structure and function of experimentally determined post-translational modifications in man and mouse. Nucleic Acids Res 2012, 40, (Database issue), D261-70. 31. Chang, Z.; Zhang, Q.; Feng, Q.; Xu, J.; Teng, T.; Luan, Q.; Shan, C.; Hu, Y.; Hemmings, B. A.; Gao, X.; Yang, Z., Deletion of Akt1 causes heart defects and abnormal cardiomyocyte proliferation. Developmental biology 2010, 347, (2), 384-91. 32. Jiang, Z. Y.; Zhou, Q. L.; Coleman, K. A.; Chouinard, M.; Boese, Q.; Czech, M. P., Insulin signaling through Akt/protein kinase B analyzed by small interfering RNA-mediated gene silencing. Proc Natl Acad Sci U S A 2003, 100, (13), 7569-74. 33. Hill, M. M.; Clark, S. F.; Tucker, D. F.; Birnbaum, M. J.; James, D. E.; Macaulay, S. L., A role for protein kinase Bbeta/Akt2 in insulin-stimulated GLUT4 translocation in adipocytes. Molecular and cellular biology 1999, 19, (11), 7771-81. 34. Walz, H. A.; Shi, X.; Chouinard, M.; Bue, C. A.; Navaroli, D. M.; Hayakawa, A.; Zhou, Q. L.; Nadler, J.; Leonard, D. M.; Corvera, S., Isoform-specific regulation of Akt signaling by the endosomal protein WDFY2. J Biol Chem 2010, 285, (19), 14101-8. 35. Saito, T.; Jones, C. C.; Huang, S.; Czech, M. P.; Pilch, P. F., The interaction of Akt with APPL1 is required for insulin-stimulated Glut4 translocation. J Biol Chem 2007, 282, (44), 32280-7. 36. Sussman, M. A.; Volkers, M.; Fischer, K.; Bailey, B.; Cottage, C. T.; Din, S.; Gude, N.; Avitabile, D.; Alvarez, R.; Sundararaman, B.; Quijada, P.; Mason, M.; Konstandin, M. H.; Malhowski, A.; Cheng, Z.; Khan, M.; McGregor, M., Myocardial AKT: the omnipresent nexus. Physiological reviews 2011, 91, (3), 1023-70. 37. Xue, Y.; Ren, J.; Gao, X.; Jin, C.; Wen, L.; Yao, X., GPS 2.0, a tool to predict kinasespecific phosphorylation sites in hierarchy. Molecular & cellular proteomics : MCP 2008, 7, (9), 1598-608. 38. Graves, B. M.; Simerly, T.; Li, C.; Williams, D. L.; Wondergem, R., Phosphoinositide3-kinase/akt - dependent signaling is required for maintenance of [Ca(2+)](i), I(Ca), and Ca(2+) transients in HL-1 cardiomyocytes. Journal of biomedical science 2012, 19, 59. 39. Lu, Z.; Jiang, Y. P.; Wang, W.; Xu, X. H.; Mathias, R. T.; Entcheva, E.; Ballou, L. M.; Cohen, I. S.; Lin, R. Z., Loss of cardiac phosphoinositide 3-kinase p110 alpha results in contractile dysfunction. Circulation 2009, 120, (4), 318-25. 40. Catalucci, D.; Zhang, D. H.; DeSantiago, J.; Aimond, F.; Barbara, G.; Chemin, J.; Bonci, D.; Picht, E.; Rusconi, F.; Dalton, N. D.; Peterson, K. L.; Richard, S.; Bers, D. M.; Brown, J. H.; Condorelli, G., Akt regulates L-type Ca2+ channel activity by modulating Cavalpha1 protein stability. The Journal of cell biology 2009, 184, (6), 923-33. 41. Pereira, L.; Matthes, J.; Schuster, I.; Valdivia, H. H.; Herzig, S.; Richard, S.; Gomez, A. M., Mechanisms of [Ca2+]i transient decrease in cardiomyopathy of db/db type 2 diabetic mice. Diabetes 2006, 55, (3), 608-15. 42. Wehrens, X. H.; Lehnart, S. E.; Reiken, S. R.; Marks, A. R., Ca2+/calmodulindependent protein kinase II phosphorylation regulates the cardiac ryanodine receptor. Circulation research 2004, 94, (6), e61-70. 43. Witcher, D. R.; Kovacs, R. J.; Schulman, H.; Cefali, D. C.; Jones, L. R., Unique phosphorylation site on the cardiac ryanodine receptor regulates calcium channel activity. J Biol Chem 1991, 266, (17), 11144-52. 44. Takeshima, H.; Komazaki, S.; Nishi, M.; Iino, M.; Kangawa, K., Junctophilins: a novel family of junctional membrane complex proteins. Molecular cell 2000, 6, (1), 11-22. 45. Reynolds, J. O.; Chiang, D. Y.; Wang, W.; Beavers, D. L.; Dixit, S. S.; Skapura, D. G.; Landstrom, A. P.; Song, L. S.; Ackerman, M. J.; Wehrens, X. H., Junctophilin-2 is necessary for T-tubule maturation during mouse heart development. Cardiovascular research 2013, 100, (1), 44-53. 46. Landstrom, A. P.; Weisleder, N.; Batalden, K. B.; Bos, J. M.; Tester, D. J.; Ommen, S. R.; Wehrens, X. H.; Claycomb, W. C.; Ko, J. K.; Hwang, M.; Pan, Z.; Ma, J.; Ackerman, M. J., Mutations in JPH2-encoded junctophilin-2 associated with hypertrophic cardiomyopathy in humans. Journal of molecular and cellular cardiology 2007, 42, (6), 1026-35. 47. Mundina-Weilenmann, C.; Vittone, L.; Ortale, M.; de Cingolani, G. C.; Mattiazzi, A., Immunodetection of phosphorylation sites gives new insights into the mechanisms underlying phospholamban phosphorylation in the intact heart. J Biol Chem 1996, 271, (52), 33561-7. 24 Environment ACS Paragon Plus

Page 24 of 36

Page 25 of 36

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


48. Wegener, A. D.; Simmerman, H. K.; Lindemann, J. P.; Jones, L. R., Phospholamban phosphorylation in intact ventricles. Phosphorylation of serine 16 and threonine 17 in response to beta-adrenergic stimulation. J Biol Chem 1989, 264, (19), 11468-74. 49. Catalucci, D.; Latronico, M. V.; Ceci, M.; Rusconi, F.; Young, H. S.; Gallo, P.; Santonastasi, M.; Bellacosa, A.; Brown, J. H.; Condorelli, G., Akt increases sarcoplasmic reticulum Ca2+ cycling by direct phosphorylation of phospholamban at Thr17. J Biol Chem 2009, 284, (41), 28180-7. 50. Arvanitis, D. A.; Vafiadaki, E.; Sanoudou, D.; Kranias, E. G., Histidine-rich calcium binding protein: the new regulator of sarcoplasmic reticulum calcium cycling. Journal of molecular and cellular cardiology 2011, 50, (1), 43-9. 51. Qian, J.; Vafiadaki, E.; Florea, S. M.; Singh, V. P.; Song, W.; Lam, C. K.; Wang, Y.; Yuan, Q.; Pritchard, T. J.; Cai, W.; Haghighi, K.; Rodriguez, P.; Wang, H. S.; Sanoudou, D.; Fan, G. C.; Kranias, E. G., Small heat shock protein 20 interacts with protein phosphatase-1 and enhances sarcoplasmic reticulum calcium cycling. Circulation research 2011, 108, (12), 1429-38. 52. Fan, G. C.; Zhou, X.; Wang, X.; Song, G.; Qian, J.; Nicolaou, P.; Chen, G.; Ren, X.; Kranias, E. G., Heat shock protein 20 interacting with phosphorylated Akt reduces doxorubicin-triggered oxidative stress and cardiotoxicity. Circulation research 2008, 103, (11), 1270-9. 53. Huttlin, E. L.; Jedrychowski, M. P.; Elias, J. E.; Goswami, T.; Rad, R.; Beausoleil, S. A.; Villen, J.; Haas, W.; Sowa, M. E.; Gygi, S. P., A tissue-specific atlas of mouse protein phosphorylation and expression. Cell 2010, 143, (7), 1174-89. 54. Wisniewski, J. R.; Nagaraj, N.; Zougman, A.; Gnad, F.; Mann, M., Brain phosphoproteome obtained by a FASP-based method reveals plasma membrane protein topology. J Proteome Res 2010, 9, (6), 3280-9. 55. Colbran, R. J., Regulation and role of brain calcium/calmodulin-dependent protein kinase II. Neurochemistry international 1992, 21, (4), 469-97. 56. Erickson, J. R.; Joiner, M. L.; Guan, X.; Kutschke, W.; Yang, J.; Oddis, C. V.; Bartlett, R. K.; Lowe, J. S.; O'Donnell, S. E.; Aykin-Burns, N.; Zimmerman, M. C.; Zimmerman, K.; Ham, A. J.; Weiss, R. M.; Spitz, D. R.; Shea, M. A.; Colbran, R. J.; Mohler, P. J.; Anderson, M. E., A dynamic pathway for calcium-independent activation of CaMKII by methionine oxidation. Cell 2008, 133, (3), 462-74. 57. Huang, R. Y.; Laing, J. G.; Kanter, E. M.; Berthoud, V. M.; Bao, M.; Rohrs, H. W.; Townsend, R. R.; Yamada, K. A., Identification of CaMKII phosphorylation sites in Connexin43 by high-resolution mass spectrometry. J Proteome Res 2011, 10, (3), 1098-109. 58. Kruger, M.; Linke, W. A., The giant protein titin: a regulatory node that integrates myocyte signaling pathways. J Biol Chem 2011, 286, (12), 9905-12. 59. Kontrogianni-Konstantopoulos, A.; Ackermann, M. A.; Bowman, A. L.; Yap, S. V.; Bloch, R. J., Muscle giants: molecular scaffolds in sarcomerogenesis. Physiological reviews 2009, 89, (4), 1217-67. 60. El-Armouche, A.; Pohlmann, L.; Schlossarek, S.; Starbatty, J.; Yeh, Y. H.; Nattel, S.; Dobrev, D.; Eschenhagen, T.; Carrier, L., Decreased phosphorylation levels of cardiac myosin-binding protein-C in human and experimental heart failure. Journal of molecular and cellular cardiology 2007, 43, (2), 223-9. 61. Kooij, V.; Holewinski, R. J.; Murphy, A. M.; Van Eyk, J. E., Characterization of the cardiac myosin binding protein-C phosphoproteome in healthy and failing human hearts. Journal of molecular and cellular cardiology 2013, 60, 116-20. 62. Sadayappan, S.; Osinska, H.; Klevitsky, R.; Lorenz, J. N.; Sargent, M.; Molkentin, J. D.; Seidman, C. E.; Seidman, J. G.; Robbins, J., Cardiac myosin binding protein C phosphorylation is cardioprotective. Proc Natl Acad Sci U S A 2006, 103, (45), 16918-23. 63. Nixon, B. R.; Liu, B.; Scellini, B.; Tesi, C.; Piroddi, N.; Ogut, O.; Solaro, R. J.; Ziolo, M. T.; Janssen, P. M.; Davis, J. P.; Poggesi, C.; Biesiadecki, B. J., Tropomyosin Ser-283 pseudo-phosphorylation slows myofibril relaxation. Archives of biochemistry and biophysics 2013, 535, (1), 30-8.



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

FIGURE LEGENDS Figure 1: Characterization of knock down cell lines. (A) Analysis of AKT1 and AKT2 protein levels (MW 60 kDa) in control and knock down cell lines. β-Actin (MW 42 kDa) serves as loading control. (B) Quantification of five independent western blot analyses (n = 5; 3 independently infected cell lines). Values were normalized to shC. (C) Representative western blot analysis of knock down cells with pan-AKT antibody. (D) Quantification of (C) (n = 3). Bars represent means ±SD. (*: p < 0.05)

Figure 2: Analysis of AKT isoform phosphorylation after insulin/IGF-1 stimulation. (A) Representative western blot with an antibody against phospho-Ser473 (MW 60 kDa) before (c) or after stimulation for 10 minutes with 200 nM insulin (ins) or 130 nM IGF-1. β-Actin (MW 42 kDa) serves as loading control. (B) Quantification of six western analyses. Phosphorylation signals of knock down cells were normalized to the corresponding HL-1 phosphorylation signal. (n = 6). (C) Proximity ligation assay (PLA) of insulin-stimulated control and knock down cells with antibodies against panAKT and pAKTSer473. Interaction signal (red), nuclei (blue, DAPI). (D) Quantification of three independent PLAs. The red signals per cell were counted and for each independent PLA normalized to the control cells (values of shC cells were set to 100 %) (n = 3 independent PLAs (~50 cells/PLA). (E) Proximity ligation assay (PLA) on insulin-stimulated control and knock down cells with antibodies against pan-AKT and mTor. Interaction signal (red), nuclei (blue, DAPI). (F) Quantification of three independent PLAs. Analysis as described for (D). (n = 3). Bars represent means ±SD. (*: p < 0.05)

Figure 3: (A) Log2 ratios of phosphopeptides from ∆AKT2 cells compared to shC cells. Regulated phosphopeptides of six biological replicates were evaluated as detailed in the materials and method section 2.8. The analysis was performed for all replicates. (B) Venn diagram for the isoform specific assignment of relevant phosphopeptides. (C) Details of MS spectra showing triplets of four different phosphopeptides derived from the three different samples (shC = black star, ∆AKT2 = white star, ∆AKT1 = grey star) to illustrate relative quantification.


Page 26 of 36

Page 27 of 36

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Figure 4: Serine motif analysis of regulated phosphopeptides of ∆AKT2-cells with motif-x. Tables contain motif score (indicates enrichment level of the extracted motifs), pool size (number of applied peptides), matches (number of peptides including the specific motif), and fold increase (degree of significance and specificity for the motif). Kinases potentially targeting the consensus sequences are listed next to the motif. For AKT1 specific and isoform unspecific peptides the analysis failed due to small pool size.

Figure 5: ClueGO/Cytoscape analysis of AKT regulated phosphoproteins. AKT2-specific (A) and AKT1-specific (B) network. An isoform unspecific network could not be build due to small group size. Only the most significant term per group is labeled. Term enrichment significance is represented by node size. Parameters: Ontology: GO, biological process, all (update 20.03.2014); Enrichment/Depletion (two-sided hypergeometric test); GO tree level: 7-8; p-value: 0.5; p-value correction: Bonferroni, GO term restriction: 2 genes minimum, 4 % genes; Kappa Score: 0.3, initial group size: 3, group merge: 50 %; leading group term: highest significance.

Figure 6: Regulated phosphosites of proteins involved in excitation-contraction coupling. Connections were drawn according to data from the literature as detailed in the discussion. Shape of symbols for phosphorylation site encodes isoform specificity, color distinguishes between increased (green) and decreased (red) phosphorylation, border indicates known (continuous) and potential (dashed) AKT sites.



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Table 1: AKT isoform-specific regulated phosphopeptides identified in GO terms dealing with the heart. After GO term analysis of regulated phosphopeptides four heart relevant terms (∆AKT1: regulation of heart rate (RHR) and regulation of relaxation of cardiac muscle (RRCM); ∆AKT2: regulation of heart contraction (RHC) and cardiac muscle tissue development (CMTD)) were selected. Peptides, which were grouped in these terms (marked with x), are listed together with their phosphosite regulation (red = decreased phosphorylation, green = increased phosphorylation). Numbers = identified in n replicates. IEF: identified with isoelectric focusing (n=2).


Page 28 of 36

Page 29 of 36

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Table 1: AKT isoform-specific regulated phosphopeptides identified in GO terms dealing with the heart. UniProt ID P12023 Q99K28-2 A6X8Z5

Gene name App Arfgap2 Arhgap31

Q9ES28 Q6PAJ1 O55003 Q99246

Arhgef7 Bcr Bnip3 Cacna1d

Q6PHZ2

Camk2d

Q923T9

Camk2g

P47757 A6H8H2

Capzb Dennd4c

O55111 E9Q557

Dsg2 Dsp

Q03145

Epha2

Q6DFZ1 P23242

Gbf1 Gja1

B2RY58

Hcn4

Q9ET78 O35219

Jph2 Kcnh2

Q8R4U7 O09110 P47809 Q3UIK0

Luzp1 Map2k3 Map2k4 Mybpc3

Q3UH59 Q02566 B1B1A8

Myh10 Myh6 Mylk

P70670

Naca

Q04690 P61014

Nf1 Pln

Q5I1X5

Ppp1r13l

Q9DBC7

Prkar1a

P51150 A3KGS3 E9Q401 Q9Z0E8 Q61165 Q9JI10 Q60949

Rab7 Ralgapa2 Ryr2 Slc22a5 Slc9a1 Stk3 Tbc1d1

Q8BHL3 Q9CXF4 Q8BYJ6

Tbc1d10b Tbc1d15 Tbc1d4

P58771

Tpm1

Q80ZA1 A2ASS6

Q8BY87 P56695

Trp53 Ttn

Usp47 Wfs1

RHR RRCM CMTD x x x x x x x x x x x x x x x x x x x x x x x x x x x x x x x x x x x x x x x x x x x x x x x x x x x x x x x x x x x x x x x x x x x x x x x x x x x x x x x x x x x x x x x x x x x x x x x x x

RHC x x x x x x x x x x x

x x x x x

x x x x x x x x x x x x x x x x x x x x x x x x x x x x x x x x x x x x x x x x x x x x x x x x x x x x x x x x x x

Phosphosite S441 S431 S1355 S765 S776 S1263 S88 S1950 S1951 S315 S319 S315 S319 S263 S1096 S1635 S1637 S1321 S718 S2827 S2221 S772 S900 Y773 T1337 S364 S365 S139 S14 S102 S99 S179 S241 S286 S285 S1612 S218 S255 S282 S72 S1989 S1480 S1804 T1805 S1803 S1807 T1809 S565 S1492 S822 S1489 S821 S1400 S1859 S2525 S16 S17 S394 S113 S77 T75 S72 S819 S2807 S548 S609 S174 S497 S521 S129 S32 S577 S598 S282 S283 S378 S2080 S5070 S3432 S868 S32

ΔAkt1 ΔAkt2

ΔAkt1 and ΔAkt2

2 6 IEF IEF 5 4 6 2 2 5 5 2 2 6 3 4 4 6 3 3 5 4 4 3 2 3 4 4 5 4 3 2 6 6 5 5 2 4 5 6 5 5 4 6 5 6 4 4 6 6 5 4 3 5 3 6 6 5 IEF 6 5 5 4 4 3 3 5 2 IEF 5 5 5 5 2 2 6 6 4 4 5 3

Modified sequence _VES(ph)LEQEAANER_ _AIS(ph)SDM(ox)FFGR_ _VLLS(ph)PIR_ _NLS(ph)PPLTPAPPPPTPLEEEPEVLLSK_ _KES(ph)APQVLLPEEEK_ _RQS(ph)ILFSTEV_ _NSTLS(ph)EEDYIER_ _RQS(ph)SQDDVLPSPALPHR_ _RQSS(ph)QDDVLPSPALPHR_ _NFS(ph)AAKS(ph)LLK_ _NFS(ph)AAKS(ph)LLK_ _NFS(ph)AAKS(ph)LLNK_ _NFS(ph)AAKS(ph)LLNK_ _ELS(ph)QVLTQR_ _THS(ph)FENVNCHLADSR_ _S(ph)HSVGGPLQNIDFSQR_ _S(ph)HSVGGPLQNIDFSQR_ _STS(ph)LSALVR_ _GQHELS(ph)EVDGR_ _GLPS(ph)PYNM(ox)S(ph)APGS(ph)R_ _SM(ox)S(ph)FQGIR_ _VLEDDPEAT(ph)YTTSGGK_ _LPSTS(ph)GSEGVPFR_ _VLEDDPEATY(ph)TTSGGK_ _SAT(ph)DADM(ox)VNSGWLVVGK_ _VAAGHELQPLAIVDQRPS(ph)SR_ _VAAGHELQPLAIVDQRPSS(ph)R_ _RLIAAEGDAS(ph)PGEDR_ _LYS(ph)LPQQVGAK_ _FRGS(ph)LAS(ph)LGSR_ _FRGS(ph)LAS(ph)LGSR_ _SEHSNGTVAPDS(ph)PAADGPM(ox)LPSPPVPR_ _ALVGPGSAS(ph)PVASIR_ _RAS(ph)S(ph)ADDIEAMR_ _RAS(ph)S(ph)ADDIEAMR_ _S(ph)QENILQGFSLPNK_ _M(ox)CDFGISGYLVDS(ph)VAK_ _LCDFGISGQLVDS(ph)IAK_ _TS(ph)DSHEDAGTLDFSSLLK_ _DAS(ph)PDDQGSYAVIAGSSK_ _RQLHIEGAS(ph)LELSDDDT(ph)ESK_ _SLS(ph)TELFK_ _KSS(ph)TGS(ph)PT(ph)SPINAEK_ _KSST(ph)GS(ph)PTSPINAEK_ _KS(ph)STGS(ph)PTS(ph)PINAEK_ _SSTGS(ph)PTS(ph)PINAEK_ _KS(ph)STGS(ph)PTS(ph)PINAEK_ _ADS(ph)PPAVIR_ _DAPTTLAES(ph)PSS(ph)PK_ _VDPIM(ox)SDVTPTS(ph)PK_ _DAPTTLAES(ph)PSS(ph)PK_ _VDPIM(ox)SDVTPT(ph)SPKK_ _ETPTTPS(ph)PEGVTAAPLEIPISSK_ _AIETLLVS(ph)PAK_ _SM(ox)S(ph)LDM(ox)GQPSQANTK_ _RAS(ph)T(ph)IEMPQQAR_ _RAS(ph)T(ph)IEMPQQAR_ _AVLPGS(ph)PIFSR_ _SESAPSLHPYSPLS(ph)PK_ _TDS(ph)REDEISPPPPNPVVK_ _T(ph)DSREDEIS(ph)PPPPNPVVK_ _FQS(ph)LGVAFYR_ _RSS(ph)S(ph)PAELELK_ _RIS(ph)QTSQVS(ph)IDAAHGYSPR_ _DGEES(ph)PTVLK_ _IPSAVST(ph)VS(ph)MQNIHPK_ _LADFGVAGQLTDT(ph)M(ox)AK_ _S(ph)LTESLESILSR_ _GLQDHSAS(ph)VDLDSSTSSTLSNTSK_ _TEEVRAS(ph)PVPGPGT(ph)PTR_ _ANDQDS(ph)LISGILR_ _SLTSS(ph)LENIFSR_ _LGS(ph)M(ox)DS(ph)FER_ _AISEELDHALNDMT(ph)SI_ _AISEELDHALNDMTS(ph)I_ _AFQALIKEES(ph)PNC_ _IELSPS(ph)MEAPK_ _SDS(ph)FGTPNEAIEPK_ _GAFS(ph)DSEDIDHHSLMAR_ _S(ph)VDAILEESTEK_ _LNATAS(ph)LEQDKIEPPR_



B 250

ΔAKT2 ΔAKT1

relative protein amounts

shC

200

* *

150 100 50

0

HL1

ΔAKT2

shC Akt1

D ΔAKT2

ΔAKT1

relative protein amounts

1 A 2 3 4 HL-1 5 6 AKT1 7 60 kDa 8 9 AKT2 10 60 kDa 11 12 13 β-Actin 42 kDa 14 15 16 17 18 19 20 21 C shC 22 23 24 pan-AKT 60 kDa 25 26 27 β-Actin 28 42 kDa 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58

Page 30 of 36

Akt2

*

100

ΔAKT1

*

80 60 40 20

0

shC

Figure 1

ACS Paragon Plus Environment

ΔAKT2

ΔAKT1

Page 31 of 36


∆AKT1 ins IGF

c

ins

IGF

* *

140 120

100 80

60 40

20 0

ΔAKT1

HL-1

insulin

D ΔAKT2

relative interaction signals

c

∆AKT2

120 100

IGF

* *

80

*

60 40 20 0

shC ΔAkt1 ΔAkt2 F

ΔAKT2

relative interaction signals

1 2 3 4 HL-1 5 c ins IGF M 6 473 7 pAKTSer 60 kDa 8 9 β-Actin 10 42 kDa 11 12 13 14 15 16 17 C 18 473 19 PLA: pAKTSer / pan-AKT 20 ΔAKT1 shC 21 22 23 24 25 26 27 28 29 30 E 31 32 PLA: mTor / pan-AKT 33 shC 34 ΔAKT1 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58

relative phosphorylation signals

B

A

120 100 80 60 40 20 0

Figure 2


*

ΔAKT2


Log2 ratio (∆AKT2/shC)

A

7 6 5 4 3 2 1 0 -1 -2 -3 -4

B ∆AKT1

20

300

C.2

100

100 Relative Abundance

Relative Abundance

57

5000

∆AKT2

phosphopeptides

C.1

50

0 525.5

526.0

526.5

527.0

527.5 528.0 m/z

528.5

529.0

529.5

50

0 670

530.0

672

Cardiac Phospholamban: RAS(pH)T(pH)IEMPQQAR

C.4 100 Relative Abundance

C.3

50

0 663.0

674

676

678

680

682 m/z

684

686

688

690

692

AHNAK: FKAEAPLPS(ph)PK

100 Relative Abundance

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58

Page 32 of 36

50

0 663.5

664.0

664.5

665.0

665.5 m/z

666.0

666.5

667.0

667.5

668.0

661

FOXO4: VLGTPVLAS(ph)PTEDSSHDR

663

665

667

669 m/z

671

673

675

CaMK2, delta: NFS(pH)AAKS(pH)LLK

Figure 3


677

694

Page 33 of 36

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58


1 MAPK

2 AKT CaMK2 PKA

3 CK2

# motif score pool size matches fold increase 1 16 208 55 3,69 2 16 153 44 4,89 3 13,12 109 32 4,73

Figure 4



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58

A Δ AKT2

B Δ AKT1

Figure 5


Page 34 of 36

Page 35 of 36

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58


Ca2+

S179

S104

Jph2

HRC

S1950

or 1951

Cacna1d Ca2+

Ryr2

Ca2+

S2807S2813

Ca2+

Ca2+

Ca2+

Serca

S16

Pln

Hspb6

S16 T17

Ca2+

Ca2+

Camk2g Camk2d S311 S315 S319 S315 S319

T75 S77 83 Prkar1a S

Ca2+

S2080 S3432

T96

S1804 S1807 1803 S Mylk T1809 S1810 T1811

S1840 Myh6

Mybpc3

Ttn

Obscn

S5070

Decreased/increased phosphorylation

S72

Myh10

S282

S1997 T1989

T5753 S6503 AKT2 specific

Ca2+

Pdlim7

Tpm1 S283 or T282

Known/potential AKT site

AKT1 specific AKT specific

Figure 6



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58

shC

ΔAKT1

ΔAKT2

Insulin stimulation Stabile isotope triple dimethyl labeling Phosphopeptide enrichment

57 20 LC-MS Relative quantification

300

Regulated phosphopeptides

Abstract Graphic


Page 36 of 36

AKT1 and AKT2 Induce Distinct Phosphorylation Patterns in HL-1

Recommend Documents