An Alternative Approach to Synthesizing Galactooligosaccharides by

Apr 19, 2016 - Construction of Yeast Expression Plasmids for Surface Display of β- ...... oryzae β-galactosidase immobilized in cotton cloth Biotech...
1 downloads 0 Views 3MB Size
Download PDF
Article pubs.acs.org/JAFC

An Alternative Approach to Synthesizing Galactooligosaccharides by Cell-Surface Display of β‑Galactosidase on Yarrowia lipolytica Jin An,† Lebin Zhang,† Lijuan Li,† Dawen Liu,† Huiling Cheng,† Hengwei Wang,§ Muhammad Zohaib Nawaz,† Hairong Cheng,*,† and Zixin Deng† †

State Key Laboratory of Microbial Metabolism and School of Life Sciences and Biotechnology, Shanghai Jiao Tong University, Shanghai 200240, China § Innovation & Application Institute, Zhejiang Ocean University, Zhoushan 316022, China ABSTRACT: An alternative strategy for synthesizing galactooligosaccharides (GOS) from an erythritol-producing yeast Yarrowia lipolytica using surface display technology was demonstrated. The engineered strain CGMCC11369 was developed by fusion of the β-galactosidase gene from Aspergillus oryzae to the YlPir1 gene, which codes for a cell wall protein. β-Galactosidase was effectively displayed on the cell surface of Yarrowia lipolytica start strain CGMCC7326. This engineered strain with surfacedisplayed β-galactosidase efficiently synthesized GOS from lactose. An amount of 160 g/L GOS was produced within 6 h in a solution of 500 g/L lactose and 5 mg/mL cell (dry weight) at pH 5.5 and 60 °C, with a yield of 51% of consumed lactose monohydrate. This newly developed method was applied with waste yeast paste from erythritol industry at least 10 times. The optimal reaction temperature increased to 60 °C, about 20 °C higher than that of free β-galactosidase, which was helpful for enhancing the reaction rate and GOS production. KEYWORDS: Yarrowia lipolytica, cell surface display, galactooligosaccharides, β-galactosidase, erythritol

■

INTRODUCTION According to the Food and Agriculture Organization of the United Nations, a prebiotic is a nonviable food component that confers a health benefit to the host (human being or animal) associated with modulation of the microbiota. Such prebiotics normally contain galactooligosaccharides (GOSs), fructooligosaccharides (FOSs), isomaltooligosaccharides (IMOSs), xylooligosaccharides (XOSs), and soybean oligosaccharides (SBOSs). Traditionally, FOS was the main focus of research on prebiotics; however, recently it has been shifted toward GOS, a naturally occurring sugar in human milk.1 Thus, GOS is widely used as a beneficial component in infant formula feeds such as dairy products to mimic the biological functions of human milk oligosaccharides (HMOs).2 The introduction of GOSs into food products is desirable due to their numerous health benefits, including reduced colon cancer risk, decreasing inflammation, reduction of the invasion of enteropathogens, enhanced host immunity, and increased abundance of Bifidobacteria.3−7 Because GOS is widely used in bakeries, fermented dairy foods, and beverages, it has high demand in global markets. At present, industrial production of GOS involves the use of βgalactosidase as the enzyme having galactosyltransferase and glycoside hydrolase activity from lactose. The β-galactosidases are previously purified from fermentation broths of Aspergillus oryzae, Bacillus circulans, Lactobacillus reuteri, Bif idobacterium, Kluyveromyces lactis, and Kluyveromyces marxianus.8−15 Purified enzymes can be used either in free form or immobilized on a supporting matrix.16,17 Immobilization provides more benefits than free enzymes such as reusability, continuous operation, stability, and product purity, thus reducing the production cost. However, immobilized β-galactosidase has limitations including © XXXX American Chemical Society

support matrix contamination, enzyme diffusions, and activity loss due to glutaraldehyde cross-linking. Currently, the method for GOS production is usually a fourstage process, that is, enzyme production, purification, immobilization, and transformation, which is time-consuming and expensive. It is therefore necessary to develop easy-tooperate processes. We developed an engineered Yarrowia lipolytica strain CGMCC11369 that was capable of producing β-galactosidase immobilized on the cell surface using surface display technology. The effects of temperature, pH, lactose concentration, thermal stability, and the reusability of the surface-displayed β-galactosidase on Y. lipolytica were studied. The engineered strain showed potential for synthesizing GOS from lactose with waste yeast paste isolated from erythritol fermentation as the whole-cell catalysts. Our results showed that the GOS production method can lower the cost of GOS production. In the food fermentation industry, especially in erythritol fermentation industry, thousands of tons of yeast paste is generated annually, most of which raises serious environmental issues due to improper disposal. Therefore, an integrated utilization of such yeast paste according to the concept of reduce, reuse, and recycle is receiving close attention.18 One alternative is to produce prebiotics such as GOS using waste yeast paste as whole-cell catalysts, with the advantage of providing abundant, cheaper, and readily available whole-cell catalysts and overcoming environmental problems. With this engineered Y. lipolytica strain, the production (160 g/L) and Received: January 6, 2016 Revised: April 8, 2016 Accepted: April 19, 2016

A

DOI: 10.1021/acs.jafc.5b06138 J. Agric. Food Chem. XXXX, XXX, XXX−XXX

Article

Journal of Agricultural and Food Chemistry

Figure 1. DNA elements of two surface-displayed plasmids used in this study: (A) plasmid with hp4d as promoter; (B) plasmid with FBAIN as promoter. pFBA-Pir1-Gal with promoter FBA1IN was constructed from the plasmid pHP4d-Pir1-A.oryGal. The FBA1IN promoter of Y. lipolytica was amplified using Y. lipolytica genomic DNA as template and primers (forward primer P FBA1IN -F, 5′-ATAATCGATAGTGTACGCAGTACTATAGAGGAAC-3′, and reverse primer PFBA1IN-R, 5′-ATACACGTGGAAGAGCTGGGTTAGTTTGTGTAG-3′), according to the FBAIN promoter sequence of Y. lipolytica (GenBank accession YALI0E26004g, 997bp),21 where underlined sequences are ClaI and PmlI restriction sites, respectively. The 1.0-kp amplicon was digested with ClaI and PmlI and ligated into predigested plasmid pINA-Pir1-Gal, producing the final plasmid pFBA-Pir1-A.oryGal, which replaced the strong promoter hp4d with another strong promoter FBAIN (Figure 1B). Transformation of Y. lipolytica Yeasts. Two surface-displayed plasmids were linearized with NotI, and the resulting fragments (5′zeta-ura3d1-hp4d-Pir1-A.oryGal-LIP2t-zeta′-3 from pHP4d-Pir1-A.oryGal and 5-′zeta-ura3d1-FBAIN-Pir1-A.oryGal-LIP2t-zeta′-3 from pFBA-Pir1-A.oryGal) were used to transform the erythritol-producing Y. lipolytica CGMCC7326 according to the one-step transformation method.22 After transformation, cells were propagated directly on a selective minimal medium plate (6.7 g/L yeast nitrogen base, 5 g/L ammonia sulfate, 20 g/L lactose, pH 5.5) and incubated at 28 °C for 3−5 days until colonies appeared. Resulting transformants were further selected on the above minimal medium plate, as larger colonies were grown on the background of smaller ones. Larger colonies were then purified by streaking three times on the above minimal medium plates. After colonies were purified on the minimal medium, larger colonies were transferred to YPL plate (10 g/L yeast extract, 5 g/L tryptone, 20 g/L lactose, in 0.1% X-gal solution) and cultivated at 30 °C for 5 days to select those colonies that express β-galactosidase on their cell surface. Identification of Y. lipolytica Transformants. Genomic DNA of larger Y. lipolytica transformants was extracted by using the DNA extraction kit (TianGen, Beijing, China). The forward primer PGal‑F and reverse primer PGal‑R described above were used to amplify the 2.9 kb A. oryzae β-galactosidase gene according to the thermal cycling conditions: initial denaturation for 5 min at 95 °C, followed by 35 cycles for 35 s at 94 °C, 40 s at 55 °C, 3 min at 72 °C, and extra extension at 72 °C for 10 min. Transformants of those PCR identified were further confirmed by testing the transgalactosylating activity (AT) and the hydrolytic activity (AH). It was found that the transformant no. 3 had the highest activity among all the transformants. Therefore, transformant no. 3 was used in subsequent investigations. β-Galactosidase Activity Assay. Positive transformants were cultivated in YPD media for 48 h at 30 °C. Cells were collected by centrifugation at 10000g for 5 min and were washed two times with sodium acetate buffer (50 mM, pH 5.5). The β-galactosidase hydrolytic activity (AH) assay was carried out with a β-galactosidase assay kit. The released o-nitrophenol (oNP) was measured by the absorbance at 420 nm. One unit of enzyme activity was defined as that

yield (51%) were obtained at 500 g/L lactose monohydrate 6 h later at 60 °C. The displayed A.oryGal enzyme on the surface of Y. lipolytica worked as efficiently as the immobilized enzyme on other supporting matrixes such as cotton17 and is more efficient than the free enzyme; it is therefore ideal for industrial application.

■

MATERIALS AND METHODS

Strains and Media. Yarrowia lipolytica CGMCC7326, an efficient erythritol-producing yeast,19 was used to develop a GOS-producing recombinant yeast with surface-displayed β-galactosidase enzyme. Yeast strains were cultured in YPD medium (20 g/L peptone, 10 g/L yeast extract, 20 g/L glucose), and lactose was added when needed. All Y. lipolytica strains were grown at 30 °C in a solid media containing agar (20 g/L). Construction of Yeast Expression Plasmids for Surface Display of β-Galactosidase. The yeast Y. lipolytica surface display vector pHP4d-Pir1-A.oryGal with the hp4d promoter was constructed from the plasmid pINA1311.20 The gene-encoding cell wall protein Pir1 was amplified using genomic DNA of Y. lipolytica CGMCC7326 as the template with a pair of primers, Ppir1-F (5′-ATACACGTGATGGTGTTCAAGTCTGCTGCTGTTTC-3′) and Ppir1-R (5′ATAGGATCCCTTGTCGTATCGTCCTTGTAGTCACAGTCTTCCAAGTTAACGATAG-3′), where single underlined nucleotides are the PmlI and BamHI restriction sites and the italic are the FLAGencoded sequences, those expressed peptides that can be immunorecognized by anti-FLAG antibody; the ATG in bold is the start code of the Pir1 gene. The PCR reaction began with denaturation for 5 min at 94 °C, followed by 35 cycles of 30 s at 94 °C, 40 s at 58 °C, and 50 s at 72 °C. The amplicon (890-bp) was digested with PmlI and BamHI and ligated into plasmid pINA1311 after being treated with the same enzymes, yielding the plasmid pINA-Pir1. The gene-encoding β-galactosidase enzyme was amplified using the cDNA of A. oryzae as a template. The total mRNA was isolated from A. oryzae cells using a GenElute mRNA miniprep Kit (Sigma). The cDNA was synthesized using a reverse-transcript kit (TIANScript II RT Kit, TianGen, China) following manufacturer’s instruction. The gene encoding β-galactosidase enzyme was amplified using synthesized cDNA and a primer pair (forward primer PGal-F, 5′-ATAGGATCCTCCATCAAGCATCGTCTCAATGG-3′, and reverse primer PGal-,: 5′-ATAGGTACCTTAGTATGCTCCCTTCCGCTGC-3′), according to the β-galactosidase sequence of A. oryzae (GenBank accession XM_001727409, 3018 bp), where underlined sequences were BamHI and KpnI sites. The 2.9-kp PCR fragment without the 57-bp signal sequence was digested with BamHI and KpnI and ligated into plasmid pINA1311-Pir1 after being treated with BamHI and KpnI, yielding the final plasmid pHP4d-Pir1-A.oryGal (Figure 1A). To compare the promoter activity with hp4d, another Y. lipolytica surface display vector B

DOI: 10.1021/acs.jafc.5b06138 J. Agric. Food Chem. XXXX, XXX, XXX−XXX

Article

Journal of Agricultural and Food Chemistry hydrolyzing 1 μmol of o-nitrophenyl-β-galactoside (oNPG) to onitrophenol per minute. One unit of transgalactosylation activity (AT) was defined as the amount of enzyme that catalyzed the transglycosylation of 1 μmol of galactose per minute at pH 5.5 and 60 °C. The ratio of transglycosylating and hydrolytic activity (AT/AH) was determined by measuring the ratio of the content of glucose (GR) and galactose (GalR) in the reaction mixture. The content of transferred galactose (GalT, galactose used in transglycosylation) in the reaction mixture was calculated as GalT = GR − GalR. Therefore, the ratio of β-galactosidase transglycosylating and hydrolytic activity was calculated as the ratio of transferred galactose to free galactose (GalT/GalR). Immunofluorescence Microscopy. To examine whether the A.oryGal enzyme was indeed displayed on the surface of Y. lipolytica, immunofluorescence microscopy of recombinant Y. lipolytica cells was performed. The parent strain Y. lipolytica CGMCC7326 and the selected transformants were cultured in the YPD medium at 30 °C for 48 h. Cells were harvested and washed three times with phosphate buffer (PB, 50 mM, pH 7.4) and incubated with the mouse polyclonal antibody against FLAG tag (1:100 diluted in PB containing 2% bovine serum albumin) on ice for 30 min. After incubation, yeast cells were washed with PB to remove the unbound antibody and incubated with fluorescein isothiocyanate (FITC)-conjugated goat anti-mouse immunoglobulin G (IgG, 1:200 diluted in PB with 2% bovine serum albumin) on ice for 30 min in the dark. After being washed three times with PB, fluorescent-labeled cells were observed under the fluorescence microscope. Characterization of the Surface-Displayed A.oryGal. To characterize the properties of the displayed A.oryGal, transformant no. 3 was cultured in 50 mL of medium containing 10 g/L yeast extract, 5 g/L tryptone, 20 g/L glucose, and 10 g/L lactose at 30 °C and 200 rpm for 2 days. The cells were centrifuged and washed two times with phosphate buffer (50 mM, pH 6.0) and were used as wholecell catalysts. To investigate the effect of temperature on GOS production, relative transgalactosylation activities were measured as described above at temperatures ranging from 30 to 70 °C. The 5 mL reaction mixture with 500 g/L lactose and 25 mg dcw (equivalent to 20 OD600 in 5 mL) in phosphate buffer (50 mM, pH 6.0) was incubated for 3 h. The total concentration of GOS, glucose, and galactose was measured. To investigate the effect of pH on GOS production, relative transgalactosylation activities were measured as described above at 60 °C with sodium acetate buffer (pH 4.0−6.0), phosphate sodium buffer (pH 6.0−8.0), and Tris-HCl buffer (pH 8.0−9.0), each with 50 mM. Five milliliter reaction mixtures with 500 g/L lactose and 25 mg cells (dcw) in 50 mM above buffers were incubated for 3 h. The total concentration of GOS, glucose, and galactose was measured. In addition, thermostability of the displayed A.oryGal was determined by incubating the resting cells at 65, 75, and 85 °C for 100 min, and residual hydrolysis activities were determined using the β-galactosidase activity assay kit. To investigate reusability of the displayed A.oryGal, the enzyme activity of the first reaction and the residual activity of the following reactions were detected. Yeast cells were collected by centrifugation after the first reaction and were applied for the second reaction and so on. Each reaction took 6 h, and the content of GOS was determined by HPLC. The first reaction activity of the surface-displayed A.oryGal was defined as 100%. All the reactions were performed in triplicate. GOS Synthesis Using the Surface-Displayed A.oryGal. The engineered Y. lipolytica CGMCC11369 could synthesize erythritol as well as GOS. First, yeast paste of Y. lipolytica surface-displayed A.oryGal was obtained from the erythritol fermentation broth and used as whole-cell catalysts to synthesize GOS from lactose. To produce erythritol, the Y. lipolytica transformant no. 3 (CGMCC11369) was cultured in a 2 L flask containing 500 mL of sterilized YCAG medium (5 g/L yeast extract, 3 g/L corn syrup powder, 5 g/L ammonium citrate, 10 mM MgSO4, 5 mM MnSO4, and 250 g/L glucose, pH6.0) in a shaker at 200 rpm and 30 °C for 80 h. Cells were harvested by centrifugation, washed two times with PB buffer (50 mM, pH 5.5), and then used as whole-cell catalysts. Cells were added to lactose solution

(500 g/L) in 50 mM sodium acetate buffer (pH 5.5) in a total reaction volume of 500 mL. The final cell density (OD600) in the mixture was adjusted to 20 (equivalent to 2500 mg dry cell weight in 500 mL reaction mixture). The mixture was incubated at 60 °C in an orbital shaker at 200 rpm and 50 μL of aliquots were withdrawn at different times, diluted 10 times with distilled water, and centrifuged at 10000g for 10 min. The content of glucose, galactose, GOS, and residual lactose were analyzed by HPLC. Analytical Methods. Dry cell weight was measured by collection of cells from 50 mL of culture. In brief, pellets were washed two times using distilled water, centrifuged at 10000g, and dried at 105 °C to constant weight. Analysis of monosaccharides and GOS was performed on an HPLC system equipped with a Shodex RI 101 refractive index detector (RID) and analytical HPLC columns (Shodex KS 802) at 70 °C using distilled water as eluent at a flow rate of 1.0 mL/min.

■

RESULTS AND DISCUSSION Construction of Two Cell Surface-Displayed βGalactosidase Systems for Y. lipolytica. In this study, we constructed two cell surface-displayed β-galactosidase expression systems under constitutive and strong promoters hp4d and FBAIN, respectively (Figure 1). Though the hybrid promoter hp4d is almost constitutive without any induction and independent from cultivation conditions such as pH, carbon, and nitrogen sources,23 unexpectedly, a growth-dependent gene expression was observed.24 Fructose 1,6-bisphosphate aldolase gene (FBA1, YALI0E26004g), glyceraldehyde-3-phosphate dehydrogenase gene (TDH1, YALI0C06369g), and phosphoglyceratemutase gene (GPM1, YALI0B02728g) were assumed to be highly expressed glycolytic genes in Y. lipolytica. Promoter activities of these three genes were compared, and it was revealed that the FBA1IN promoter (997 bp) was the strongest.21 The plasmid pFBA-Pir1-A.oryGal was constructed using FBAIN promoter, and its activity was compared with that of the hp4d promoter using the β-galactosidase gene as reporter (Figure 1B). The A. oryzae β-galactosidase enzyme (A.oryGal) was fused to the C-terminus of the YlPir1 protein, and the YlPir1 protein was anchored to glycoproteins of the cell surface of Y. lipolytica via disulfide bonds. Between the YlPir1 and A.oryGal gene, a FLAG tag was inserted for immunofluorescence detection. When linearized by NotI, the bacterial moieties of two plasmids were removed before transformation, and only the “yeast cassette” was used for transformation of the erythritolproducing strain Y. lipolytica CGMCC7326, avoiding the insertion of bacterial DNA into the genome of engineered Y. lipolytica and the spread of the antibiotic-resistant gene (kanamycin) to the environment. The use of antibiotic resistance markers in yeasts for the production of food additives is not allowed in many countries, and the use of safe and sustainable food-grade selection markers is strongly recommended. In this study, we found that the β-galactosidase gene (A.oryGal) can also be used as a selection marker, which is safe for the production of food additives. Selection of the Yeast Transformants. The parent strain Y. lipolytica CGMCC7326 was unable to grow on the SD medium with lactose as the sole carbon source due to the lack of a β-galactosidase-encoding gene or a lactase-encoding gene. Transformants expressing the β-galactosidase-encoding gene of A. oryzae were expected to grow in SD media with lactose as the sole carbon source. With lactose as selective marker, transformants grown on solid SD media containing lactose as the sole carbon source were positive transformants because C

DOI: 10.1021/acs.jafc.5b06138 J. Agric. Food Chem. XXXX, XXX, XXX−XXX

Article

Journal of Agricultural and Food Chemistry

promoter. But differences in β-galactosidase activity among selected transformants with the same promoter were observed (Figure 2C−E); this might be due to differences in the number of copies in the genome, or the so-called “position effect”, that is, the integration into the poor silent genome region. Like P. pastoris, Y. lipolytica is also commonly used as host for heterologous protein expression and for synthesis of fatty acidbased bioproducts.25,26 For such applications, it is a prerequisite to have appropriate promoters to drive the expression of proteins and enzymes involved in biosynthetic pathways. There is always a need for strong promoters to obtain higher expression of proteins or enzymes. The FBAIN promoter was found to be stronger than other promoters TEF1, GPM1, and TDH1.21 With β-galactosidase as reporter, we found that the hp4d promoter has a similar activity to that of the FBAIN promoter. The transformant no. 3 (hp4d-Pir1-A.oryGal) has slightly higher yield and productivity than transformant No.6 (FBAIN-Pir1-A.oryGal) (data not shown). The parent strain and the transformant no. 3 both produced erythritol at a yield of 0.55 g of erythritol per g of glucose, with the productivity of 1.4 ± 0.2 g/(L·h). Thus, the surface display of β-galactosidase does not affect the erythritol producing capability. Therefore, transformant no. 3, which harbored the hp4d-Pir1-A.oryGal cassette, was selected for further studies. Transgalactosylating and Hydrolytic Activity Assay of Cell Surface-Displayed A.oryGal. We further determined whether the supernatant has enzymatic activity and whether it is induced by lactose. Transformant no. 3 was found to possess the transgalactosylating and hydrolytic activity up to 0.55 ± 0.03 U and 0.14 ± 0.02 U per mg dry cell weight respectively, at a ratio (AT/AH) of 3.9. The similar results of transgalactosylating activity were obtained in YP media containing 20 g/L glucose or 20 g/L lactose or 200 g/L lactose, suggesting that the β-galactosidase was constitutively expressed in the recombinant Y. lipolytica. Interestingly, the supernatant also has transgalactosylating and hydrolytic activity, with almost the same ratio of AT/AH (Table 1). It can be deduced from this case that A.oryGal enzyme was not displayed on the cell surface of Y. lipolytica as a whole, though A.oryGal was fused to anchor protein YlPir1. Several suggestions might be proposed to explain the secretion of β-galactosidase. The first possibility is that β-galactosidase fused to YlPir1 was cleaved by protease secreted in the medium. Y. lipolytica is a model for protein secretion; many extracellular hydrolases including alkaline protease (AEP) and lipase are secreted in protein or lipidrich media.20,27 Another possibility is that parts of YlPir1 binding sites on cell walls were covalently incorporated by YlPir1 protein, instead of YlPir1−β-galactosidase fusion protein, which facilitates direct secretion into the medium. Therefore, disruption of the YlPir1 and AEP gene in Y. lipolytica may increase the efficiency of cell surface display, thus lowering βgalactosidase activity in the medium.

they could express the A.oryGal gene. More than 300 transformants were grown on the above selective plate and were purified via subculturing on YPD plates supplemented with 0.1% X-gal. A single clone was used for streaking every time (Figure 2). Large and small clones were grown on the

Figure 2. Selection and promoter activity assay of various yeast transformants: (A) Transformants grown on the SD plate supplemented with lactose as the sole carbon source at 30 °C for 3 days; (B) transformants and control strain were transferred to the SD plate supplemented with lactose as the sole carbon source and cultured for 5 days; ck, the control strain Y. lipolytica CGMCC7326, unable to grow on this SD plate; (C) transformants containing the hp4d-Pir1A.oryGal cassette grown on the YPL plate plus X-gal (0.1%) for 5 days; transformants 1−5, which are blue, were selected for β-galactosidase assays; (D) Transformants containing the FBAIN-Pir1-A.oryGal cassette grown on the YPL plate plus X-gal (0.1%) for 5 days; transformants 6−10, which are blue, were selected for β-galactosidase assays; (E) Histochemical β-galactosidase assays of transformants 1−10, staining was performed at 50 °C for 2 h.

selective plates (Figure 2A), and then clones were purified by transferring large clones to the above selective plate; the control strain (CK) was unable to grow because it lacks the A.oryGal gene (Figure 2B). Those recombinants that expressed the βgalactosidase gene with hp4d or FBAIN as promoter became blue with different shades on the YPD plates containing 0.1% X-gal (Figure 2C,D). Ten colonies (no. 1−5 colonies with the hp4d-Pir1-A.oryGal expression cassette and no. 6−10 with the FBAIN-Pir1-A.oryGal expression cassette) were selected to assay the β-galactosidase activity. Among these transformants, transformant no. 3 with the hp4d-Pir1-A.oryGal cassette and transformant no. 6 with the FBAIN-Pir1-A.oryGal cassette had the strongest activity, with 0.53 ± 0.03 U/mg and 0.50 ± 0.03 U/mg dry cell weight, respectively. There was no significant activity difference found between the FBAIN and hp4d

Table 1. A.oryGal Activities of Cells and Supernatant in Different Lactose Concentrationsa YP + 2% glucose AT AH AT/AH a

YP + 2% lactose

YP + 20% lactose

supernatant (U/mL)

cells (U/mg dcw)

supernatant (U/mL)

cells (U/mg dcw)

supernatant (U/mL)

cells (U/mg dcw)

0.12 ± 0.01 0.03 ± 0.005 4.0

0.52 ± 0.03 0.12 ± 0.02 4.3

0.13 ± 0.01 0.03 ± 0.005 4.3

0.53 ± 0.03 0.12 ± 0.01 4.4

0.12 ± 0.01 0.03 ± 0.005 4.0

0.59 ± 0.03 0.16 ± 0.02 3.7

The data represent the mean values and standard deviations of three independent experiments. D

DOI: 10.1021/acs.jafc.5b06138 J. Agric. Food Chem. XXXX, XXX, XXX−XXX

Article

Journal of Agricultural and Food Chemistry Confirmation of Surface-Displayed A.oryGal by Immunofluorescence Microscopy. The 24-bp FLAG-coding sequence was added between the Pir1 and A.oryGal gene. The localization of Pir1-Flag-A.oryGal fusion protein on the surface of Y. lipolytica cells labeled with FITC was further confirmed by immunofluorescence microscopy, with the FLAG monoclonal antibody as a primary antibody and IgG/FITC as a secondary antibody. Green fluorescence was observed on the cells of transformant no. 3 under the fluorescent microscope, while the control cells were not fluorescent (Figure 3). The result indicated that the fusion protein (Pir1-FLAG-A.oryGal) was successfully displayed on the cell surface of the recombinant yeast.

activity in the 15th cycle (Figure 5D). From the practical perspective, the cells could be used at least 10 times. Various evidence showed that N-glycosylation was essential for thermal stability of enzymes. As described above, the Y. lipolytica strain was shown to be an excellent host for secreted expression of recombinant proteins with post-translational modifications. One of the modifications included moderate glycosylation, which contained only short oligosaccharide chains of 8−10 mannose residues, compared with the glycosylation pattern of P. pastoris and H. polymorpha, which perform glycosylations with chains of 8−14 mannose residues.23 It was found that there are 12 putative glycosylation sequons (Asn-Xaa-Ser/Thr stretch, where Xaa is not proline) on mature β-galactosidase of A. oryzae (GenBank accession XM_001727409), six of which (Asn137, Asn249, Asn354, Asn434, Asn459, and Asn503) have the potential to be N-glycosylated with a threshold score above 0.5, analyzed by the online NetNGlyc 1.0 server (http://www.cbs.dtu.dk/services/ NetNGlyc). In general, N-glycosylation occurs at or above this score. The resulting higher optimal reaction temperature for A.oryGal displayed on the cell surface of Y. lipolytica can improve lactose solubility and decrease the viscosity of high concentrations of lactose, thus increasing the reaction speed and product yield, highly beneficial features for industrial production of GOS. From the practical point of view, the cell surface display for enzyme immobilization improves its stability and is better for GOS production from lactose than free enzymes. Effect of Lactose Concentration on GOS Production. Initial lactose concentration is one of the most significant factors affecting GOS production and yield. The effect of lactose concentration on the formation of GOS was investigated at initial lactose concentrations of 100−700 g/L at 60 °C. Figure 5 showed the effect of lactose concentration on GOS synthesis. With the increasing initial lactose concentration from 100 to 500 g/L, the production of GOS increased from 15 to 160 g/L and yield increased from 18.7% to 51%. The highest production (160 g/L) and yield (51%) were obtained at 500 g/ L lactose monohydrate. The higher lactose concentrations caused an increase in the yield of GOS synthesis. However, lactose monohydrate concentrations over 600 g/L caused a significant decrease in GOS production but with almost the same yield at 0.50 g of GOS per gram of lactose monohydrate consumed (Figure 5). It was shown that the yield of GOS from lactose was independent of the initial concentration of lactose as long as its concentration was above 30%,17,31,32 while hydrolysis became predominant under low lactose concentration, thus resulting in a low GOS yield. Residual lactose remained at all initial concentrations when reacted at 60 °C for 6 h (Figure 5) and even for 20 h (data not shown). Glucose and galactose were released during hydrolysis and transgalactosylation. It is known that released galactose was a competitive inhibitor of hydrolysis, and glucose could inhibit transgalactosylation.33 Thus, an equilibrium might be achieved during lactose hydrolysis and transgalactosylation. Glucose and galactose should be removed from the reaction mixture in order to increase GOS formation and yield, thus reducing the residual lactose content in the final reaction mixture. Supersaturated lactose solution was in an unstable state, and precipitation occurred spontaneously until saturation was reached.32 Consequently, the decrease in production at 600 g/L lactose monohydrate could be explained by lactose precipitation during the reaction, thus reducing the concen-

Figure 3. Immunofluorescent labeling of A.oryGal displayed on the cell surface of Y. lipolytica. Microphotographs were taken under visible light (A and C), and immunofluorescence microphotographs were taken at emission 500 nm (B and D): (A, B) cells of Y. lipolytica parent strain (control); (C, D) cells of transformant no. 3 (harboring the hp4d-Pir1-A.oryGal cassette).

Characterization of the Surface-Displayed A.oryGal. Figure 4 shows the effects of temperature and pH on the relative activity of displayed β-galactosidase, as well as the thermostability and recycle times. The displayed A.oryGal had the maximum activity at 60 °C, 20 °C higher than that of free or immobilized enzyme reported previously.17,28−30 About 67% and 87% activity was maintained at 30 and 70 °C, respectively (Figure 4A). The peak enzyme activity was observed at pH 5.5 instead of pH 4.5, which was observed in the case of free or immobilized β-galactosidase from A. oryzae, previously.17,28−30 But only 20% activity was retained at pH 4.0 and pH 8.0 (Figure 4B). Enzyme thermostability is an important factor for the long-term enzymatic bioconversion. Figure 4 showed that the displayed enzyme was stable at 65 °C. When incubated at 75 °C for 90 min, 75% activity was maintained. Therefore, the displayed enzyme was much more stable than the free enzyme, which was deactivated drastically at 60 °C.17 The thermostability of displayed β-galactosidase decreased drastically at 85 °C, only 10% activity was retained when it was incubated at 85 °C for 90 min (Figure 4C). A.oryGal can be repeatedly used as immobilized enzyme when using the surface-displayed expression system. The enzyme activity decreased gradually with the increase of recycle numbers. The enzyme activity retained 85% of the initial activity in the tenth cycle and decreased to 65% of the initial E

DOI: 10.1021/acs.jafc.5b06138 J. Agric. Food Chem. XXXX, XXX, XXX−XXX

Article

Journal of Agricultural and Food Chemistry

Figure 4. Characterization of the cell surface-displayed A.oryGal enzyme: (A) Effect of temperature on the relative activity of surface-displayed A.oryGal enzyme. Relative activity was calculated by assuming the activity obtained at 60 °C as 100%. (B) Effect of pH on the activity of surfacedisplayed A.oryGal. Relative activity was calculated by assuming the activity obtained at pH 6.0 as 100%. (C) The thermostability of surface-displayed A.oryGal. Relative activity was calculated by assuming the activity as 100% at 60 °C, and cells were incubated at 65, 75, and 85 °C for different times. (D) Effect of repeated transformation times on the relative activity of surface-displayed A.oryGal. Relative activity was calculated by assuming the initial activity as 100%. Data represent the means of three exprements, and error bars represent standard deviation.

higher solubility of lactose, but the detailed impact of temperature on the enzymatic rate and GOS production need further study. Time Course of GOS Production. The experiment was performed under the optimal conditions (60 °C, pH 5.5, and 500 g/L lactose monohydrate). The time course of reactions by the displayed enzyme on Y. lipolytica cell was examined. Glucose, galactose, and total GOS (trisaccharides, Glc-(Gal)2; tetrasaccharides, Glc-(Gal)3) were formed from lactose by transgalactosylation and hydrolysis (Figure 6). The concentration of glucose was higher than that of galactose, indicating that the difference in the amount of glucose and galactose was

Figure 5. Effect of lactose concentrations on the formation of GOS by the surface-displayed A.oryGal. Production and yield of GOS increased with increasing initial lactose monohydrate concentration from 100 to 500 g/L. The highest production (160 g/L) and yield (51%) were obtained with 500 g/L lactose monohydrate. The mixtures were incubated at 60 °C for 6 h. For clarity, error bars were omitted; each experiment was performed three times.

tration of lactose in the reaction mixture. At the concentration of 600 g/L lactose monohydrate, the unstable solution began to precipitate at 60 °C and resulted in a reduction of GOS production. At 700 g/L concentration, sharply decreased production was observed because substantial precipitation occurred. Theoretically, a stable solution of 600−700 g/L lactose concentration could be obtained at higher temperatures such as 80 and 90 °C, which might inactivate the displayed A.oryGal enzyme. Thus, the display of thermostable βgalactosidase from hyperthermophilic bacteria such as Sulfolobus solfataricus on the Y. lipolytica surface might solve this problem. GOS production at higher temperature was very important because temperature influenced the reaction rate and

Figure 6. Time course of GOS production catalyzed by the cell surface-displayed A.oryGal. Maximum total GOS concentration was reached after transformation for 6 h and then decreased. The contents of glucose and galactose increased gradually. The mixture was incubated at 60 °C for 10 h (for detail, see Materials and Methods); samples were taken every hour for assay. For clarity, error bars were omitted; each experiment was performed three times. F

DOI: 10.1021/acs.jafc.5b06138 J. Agric. Food Chem. XXXX, XXX, XXX−XXX

Article

Journal of Agricultural and Food Chemistry transferred to lactose in the transgalactosylation reaction to produce GOS. Figure 7 showed the chromatography profiles for the assay of GOS production by Y. lipolytica surface-displayed A.oryGal in a reaction mixture containing 500 g/L lactose monohydrate at 60 °C for 0.5, 3, 6, and 10 h, respectively. Trisaccharide Glc-(Gal)2 was produced rapidly at the start of the reaction when Y. lipolytica cell paste was added to the reaction mixture, and glucose was also observed but in a small quantity (Figure 6 and Figure 7A). It can be deduced that transgalactosylation dominated early in the reaction, producing GOS with a high yield, while the hydrolysis took over as the reaction proceeded. Lactose was rapidly converted to glucose, galactose, and GOS, most of which were trisaccharide Glc-(Gal)2 and only a few were tetrasaccharides Glc-(Gal)3 in 3 h (Figure 7B). Decrease in trisaccharides was accompanied by increases in other GOS such as tetra- and pentasaccharides. The ratio of tetrasaccharide to trisaccharide increased after approximately 3 h of reaction. The ratio of hydrolysis to transgalactosylation increased after approximately 6 h of reaction due to the decreased lactose concentration in the process of reaction. The total GOS production (tri- and tetrasaccharides) attained the most elevated level after 6 h. In this case, we obtained the final product containing trisaccharide Glc-(Gal)2 (23.4%), tetrasaccharides Glc-(Gal)3 (8.7%), residual lactose (34.5%), glucose (24.6%), and galactose (9.1%). A total of 160 g/L GOS was produced from 328 g of lactose monohydrate consumed, with a yield of 0.51 g of GOS/g of lactose and productivity of 27 g/(L· h) GOS. Pentasaccharide Glc-(Gal)4 was detected after 10 h reaction (arrow indicated in Figure 7D). After 6 h transformation, the total GOS concentration declined gradually (Figure 6 and Figure 7D), as a result of low content of lactose and synthesis of long-chain GOS. The GOS hydrolysis to lactose and then to glucose and galactose became more dominant after 6 h, while GOS content decreased from 32.1% at 6 h to 15.6% at 10 h. Glucose and galactose concentration increased to 38.2% and 28.3%, respectively, after 10 h (Figure 6 and Figure 7), and the increase of such monosaccharides inhibited transgalactosylation.34 Such a similar decrease in GOS content in the reaction mixture has been reported previously.17,30,32 It is worth noting that higher DP of GOS such as Glc-(Gal)4 was formed 10 h later, and the higher-degree GOS has enhanced stability and better prebiotic function than low-degree GOS.35,36 After transformation, yeast paste was isolated and reused with fresh lactose under the same conditions. No significant decrease in production and yield of GOS was observed after cells being repeatedly used 10 times (Figure 4). Though immobilized β-galactosidases have been widely applied in GOS production,17,29,30,33 our results showed that the cell surface display system is another promising strategy to synthesize GOS during repeated transformation. A number of advantages of the enzyme yeast cell surface display system have been found in comparison with enzyme immobilization on supporting carriers. With the enzyme yeast cell surface display system, an enzyme translated by a cell attaches immediately to the cell surface after being transported over the plasma membrane. Such an approach can replace the laborious process of protein purification, and there is no need for sorbent for enzyme immobilization. A number of enzymes have been successfully displayed on the yeast cell surface and show higher activities compared with secreting strains or commercial enzymes.37,38

Figure 7. Chromatography profiles of GOS production. Chromatography profiles of transformation solution after 0.5 (A), 3 (B), 6 (C), and 10 h (D) transformation. Trisaccharide Glc-(Gal)2 was produced rapidly at the start of the reaction when Y. lipolytica cells were added to the reaction mixture (A). Lactose was rapidly converted to glucose, galactose, and GOS, most of which were trisaccharides Glc-(Gal)2 and only a few were tetrasaccharides Glc-(Gal)3 in 3 h (B). The total GOS production (tri- and tetrasaccharides) attained the highest elevated level after 6 h (C). Longer chain GOS such as Glc-(Gal)4 (retention time of 7.3 min, arrow indicated) were synthesized, and trisaccharides Glc-(Gal)2 content was decreased at reaction times beyond 10 h (D).

The comparison of GOS yield and productivity in previous studies is summarized in Table 2. Though the highest GOS G

DOI: 10.1021/acs.jafc.5b06138 J. Agric. Food Chem. XXXX, XXX, XXX−XXX

Article

Journal of Agricultural and Food Chemistry Table 2. Comparison of GOS Production by Differentent β-Galactosidases in Various Modes of Process source of enzyme A. oryzae A. oryzae A. oryzae A. oryzae K. lactis S. solfataricus B.circulans A. oryzae a

mode of process

max yielda (g GOS/g lactose)

lactose monohydrate concn(g/L)

T (°C)

500 380 400

47.5 40 40

10 5 5

0.29 0.31 0.26

145 118 108

270 230 600 50 500

40 45 80 40 60

0.5 4 56 1 6

0.20 0.22 0.52 0.29 0.32

54 51 315 14.8 160

free enzyme free enzyme immobilized enzyme free enzyme free enzyme free enzyme free enzyme displayed on cell

reaction time (h)

production (g/L)

productivity (g/(L·h)) 14.5 23.6 21.6 108 12.8 5.6 14.8 26.6

refs 32 28 17 30 16 31 39 this study

Maximum yield in this table refers to the ratio of GOS produced to initial lactose monohydrate.

production of 315 g/L was achieved using free β-galactosidase of the hyperthermophilic bacterium S. solfataricus, the productivity of 5.6 g/(L·h) is lower than that of A. oryzae βgalactosidase displayed on Y. lipolytica. Among the various GOS production modes based on A. oryzae β-galactosidases, higher yield and productivity were obtained by cell surface display technology. The higher yield in our study was attributed to the higher initial lactose concentration at higher reaction temperature owed to the N-glycosylation of displayed A.oryGal enzyme on the surface of Y. lipolytica. The latter worked as efficiently as immobilized enzyme in other support matrices, and more efficiently than free enzymes. In conclusion, we have demonstrated a novel GOS production strategy based on Y. lipolytica surface display technology. With this technology, β-galactosidase from A. oryzae was self-immobilized on the erythritol-producing yeast Y. lipolytica. Erythritol was first produced by this engineered yeast, and a large amount of waste yeast paste was produced. Then, it was used as a biocatalyst carrier to transform lactose to GOS. A satisfactory GOS production was achieved by the engineered Y. lipolytica strain. The highest yield was obtained at 51% of consumed lactose at initial concentration of 500 g/L and 60 °C in this study. Our GOS synthesis strategy has two main advantages: the first is the utilization of the waste yeast paste of the erythritol industry; the second is a higher reaction temperature, thus leading to an increase in reaction speed, higher yield, and productivity (as shown in Table 2). The production cost of GOS was lower than that of other methods, because the biocatalyst (yeast paste) used in this study was a waste from erythritol industry. The commercialized enzymes from A. oryzae, B. circulans, and K. lactis are expensive, and thus the strategy reported in this study shows considerable potential for application in industrial production of GOS from lactose.

■

Funding

This project is supported by the National Basic Research Program of China (No. 2013CB733903) and the National High-tech R&D Program (No. 2012AA021503). Notes

The authors declare no competing financial interest.

■

ABBREVIATIONS USED GOS, galactooligosaccharides; A.oryGal, β-galactosidase enzyme from Aspergillus oryzae; A.oryGal, β-galactosidase gene from Aspergillus oryzae; HPLC, high performance liquid chromotography; oNPG, o-nitrophenyl-β-D-galactopyranoside; DP, degree of polymerization; Glc, glucose; Gal, galactose; FITC, fluorescein isothiocyanate; SD medium, synthetic dextrose medium

■

REFERENCES

(1) Barile, D.; Rastall, R. Human milk and related oligosaccharides as prebiotics. Curr. Opin. Biotechnol. 2013, 24, 214−219. (2) Torres, D. P.; Gonçalves, M.; Teixeira, J. A.; Rodrigues, L. R. Galacto-oligosaccharides: production, properties, applications, and significance as prebiotics. Compr. Rev. Food Sci. Food Saf. 2010, 9, 438−454. (3) Bruno-Barcena, J. M.; Azcarate-Peril, M. A. Galacto-oligosaccharides and colorectal cancer: Feeding our intestinal probiome. J. Funct. Foods 2015, 12, 92−108. (4) Morel, F. B.; Dai, Q.; Ni, J.; Thomas, D.; Parnet, P.; FanÇ aBerthon, P. α-Galacto-oligosaccharides dose-dependently reduce appetide and decrease inflammation in overweight adults. J. Nutr. 2015, 145, 2052−2059. (5) Davis, L. M.; Martínez, I.; Walter, J.; Goin, C.; Hutkins, R. W. Barcoded pyrosequencing reveals that consumption of galactooligosaccharides results in a highly specific bifidogenic response in humans. PLoS One 2011, 6, e25200. (6) Peacock, K. S.; Ruhaak, L. R.; Tsui, M. K.; Mills, D. A.; Lebrilla, C. B. Isomer-Specific consumption of galactooligosaccharides by Bif idobacterial species. J. Agric. Food Chem. 2013, 61, 12612−12619. (7) Searle, L. E.; Cooley, W. A.; Jones, G.; Nunez, A.; Crudgington, B.; Weyer, U.; Dugdale, A. H.; Tzortzis, G.; Collins, J. W.; Woodward, M. J.; La Ragione, R. M. Purified galactooligosaccharide, derived from a mixture produced by the enzymic activity of Bif idobacterium bif idum, reduces Salmonella enterica serovar Typhimurium adhesion and invasion in vitro and in vivo. J. Med. Microbiol. 2010, 59, 1428−1439. (8) Urrutia, P.; Rodriguez-Colinas, B.; Fernandez-Arrojo, L.; Ballesteros, A. O.; Wilson, L.; Illanes, A.; Plou, F. J. Detailed analysis of galactooligosaccharides synthesis with β-galactosidase from Aspergillus oryzae. J. Agric. Food Chem. 2013, 61, 1081−1087. (9) Gosling, A.; Alftrén, J.; Stevens, G. W.; Barber, A. R.; Kentish, S. E.; Gras, S. L. Facile pretreatment of Bacillus circulans betagalactosidase increases the yield of galactosyl oligosaccharides in

AUTHOR INFORMATION

Corresponding Author

*Hairong Cheng. Tel: +86 2134206722. Fax: +86 2134206722. E-mail: [email protected]. Author Contributions

Jin An and Lebin Zhang contributed equally to this work. Lebin Zhang, Jin An, Lijuan Li, and Huiling Cheng performed this research. Hengwei Wang and Muhammad Zohaib Nawaz analyzed data. Hairong Cheng designed the study and wrote the paper. Zixin Deng discussed the data. H

DOI: 10.1021/acs.jafc.5b06138 J. Agric. Food Chem. XXXX, XXX, XXX−XXX

Article

Journal of Agricultural and Food Chemistry milk and lactose reaction systems. J. Agric. Food Chem. 2009, 57, 11570−11574. (10) Rodriguez-Colinas, B.; Poveda, A.; Jimenez-Barbero, J.; Ballesteros, A. O.; Plou, F. J. Galacto-oligosaccharide synthesis from lactose solution or skim milk using the β-galactosidase from Bacillus circulans. J. Agric. Food Chem. 2012, 60, 6391−8. (11) Splechtna, B.; Nguyen, T. H.; Steinböck, M.; Kulbe, K. D.; Lorenz, W.; Haltrich, D. Production of prebiotic galacto-oligosaccharides from lactose using beta-galactosidases from Lactobacillus reuteri. J. Agric. Food Chem. 2006, 54, 4999−5006. (12) Splechtna, B.; Nguyen, T. H.; Haltrich, D. Comparison between discontinuous and continuous lactose conversion processes for the production of prebiotic galacto-oligosaccharides using beta-galactosidase from Lactobacillus reuteri. J. Agric. Food Chem. 2007, 55, 6772− 6777. (13) Hsu, C. A.; Lee, S. L.; Chou, C. C. Enzymatic production of galactooligosaccharides by β-galactosidase from Bif idobacterium longum BCRC 15708. J. Agric. Food Chem. 2007, 55, 2225−2230. (14) Rodriguez-Colinas, B.; de Abreu, M. A.; Fernandez-Arrojo, L.; de Beer, R.; Poveda, A.; Jimenez-Barbero, J.; Haltrich, D.; Ballesteros Olmo, A. O.; Fernandez-Lobato, M.; Plou, F. J. Production of galactooligosaccharides by the β-galactosidase from Kluyveromyces lactis: comparative analysis of permeabilized cells versus soluble enzyme. J. Agric. Food Chem. 2011, 59, 10477−10484. (15) Cheng, C. C.; Yu, M. C.; Cheng, T. C.; Sheu, D. C.; Duan, K. J.; Tai, W. L. Production of high-content galacto-oligosaccharide by enzyme catalysis and fermentation with Kluyveromyces marxianus. Biotechnol. Lett. 2006, 28, 793−797. (16) Foda, M. I.; Lopez-Leiva, M. H. Continuous production of oligosaccharides from whey using a membrane reactor. Process Biochem. 2000, 35, 581−587. (17) Albayrak, N.; Yang, S. T. Production of galacto-oligosaccharides from lactose by Aspergillus oryzae β-galactosidase immobilized in cotton cloth. Biotechnol. Bioeng. 2002, 77, 8−19. (18) Makkar, R. S.; Cameotra, S. S. An update on the use of unconventional substrates for biosurfactant production and their new applications. Appl. Microbiol. Biotechnol. 2002, 58, 428−434. (19) Cheng, H. R.; Lv, J. Y.; Wang, B.; Li, D. C.; Deng, Z. X. Yarrowia lipolytica strain and method thereof for synthesizing erythritol. Patent CN201310282059, 2013. (20) Nicaud, J. M.; Madzak, C.; van den Broek, P.; Gysler, C.; Duboc, P.; Niederberger, P.; Gaillardin, C. Protein expression and secrection in the yeast Yarrowia lipolytica. FEMS Yeast Res. 2002, 2, 371−379. (21) Hong, S. P.; Seip, J.; Walters-Pollak, D.; Rupert, R.; Jackson, R.; Xue, Z.; Zhu, Q. Engineering Yarrowia lipolytica to express secretory invertase with strong FBAIN promoter. Yeast 2012, 29, 59−72. (22) Chen, D. C.; Beckerich, J. M.; Gaillardin, C. One-step transformation of the dimorphic yeast Yarrowia lipolytica. Appl. Microbiol. Biotechnol. 1997, 48, 232−235. (23) Madzak, C.; Gaillardin, C.; Beckerich, J. M. Heterologous protein expression and secretion in the non-conventional yeast Yarrowia lipolytica: a review. J. Biotechnol. 2004, 109, 63−81. (24) Madzak, C.; Treton, B.; Blanchin-Roland, S. Strong hybrid promoters and integrative expression/secretion vectors for quasiconstitutive expression of heterologous proteins in the yeast Yarrowia lipolytica. J. Mol. Microbiol. Biotechnol. 2000, 2, 207−216. (25) Blazeck, J.; Hill, A.; Liu, L.; Knight, R.; Miller, J.; Pan, A.; Otoupal, P.; Alper, H. S. Harnessing Yarrowia lipolytica lipogenesis to creat a platform for lipid and biofuel production. Nat. Commun. 2014, 5, 3131. (26) Abghari, A.; Chen, S. Yarrowia lipolytica as an oleaginous cell factory platform for production of fatty-based biofuel and bioproducts. Front. Energy Res. 2014, 2, 21. (27) Nicaud, J. M. Yarrowia lipolytica. Yeast 2012, 29, 409−418. (28) Iwasaki, K.; Nakajima, M.; Nakao, S. Galacto-oligosaccharide production from lactose by an enzymic batch reaction using βgalactosidase. Process Biochem. 1996, 31, 69−76.

(29) Gaur, R.; Pant, H.; Jain, R.; Khare, S. K. Galacto-oligosaccharide synthesis by immobilized Aspergillus oryzae β-galactosidase. Food Chem. 2006, 97, 426−430. (30) Matella, N. J.; Dolan, K. D.; Lee, Y. S. Comparison of galactooligosaccharide production in free-enzyme ultrafiltration and in immobilized-enzyme systems. J. Food Sci. 2006, 71, C363−368. (31) Park, H. Y.; Kim, H. J.; Lee, J. K.; Kim, D.; Oh, D. K. Galactooligosaccharide production by a thermostable β-galactosidase from Sulfolobus solfataricus. World J. Microbiol. Biotechnol. 2008, 24, 1553−1558. (32) Vera, C.; Guerrero, C.; Conejeros, R.; Illanes, A. Synthesis of galacto-oligosaccharides by β-galactosidase from Aspergillus oryzae using partially dissolved and supersaturated solution of lactose. Enzyme Microb. Technol. 2012, 50, 188−194. (33) Yang, S. T.; Okos, M. R. Effects of temperature on lactose hydrolysis by immobilized beta-galactosidase in plug-flow reactor. Biotechnol. Bioeng. 1989, 33, 873−885. (34) Park, A. R.; Oh, D. K. Galacto-oligosaccharide production using microbial β-galactosidase: current state and perspectives. Appl. Microbiol. Biotechnol. 2010, 85, 1279−1286. (35) Hernández-Hernández, O.; Marín-Manzano, M. C.; Rubio, L. A.; Moreno, F. J.; Sanz, M. L.; Clemente, A. Monomer and linkage type of galacto-oligosaccharides affect their resistance to ideal digestion and prebiotic properties in rats. J. Nutr. 2012, 142, 1232−1239. (36) Morel, F. B.; Dai, Q.; Ni, J.; Thomas, D.; Parnet, P.; FançaBerthon, P. α-Galacto-oligosaccharides dose-dependently reduce appetite and decrease inflammation in over weight adults. J. Nutr. 2015, 145, 2052−2059. (37) Duquesne, S.; Bozonnet, S.; Bordes, F.; Dumon, C.; Nicaud, J.M.; Marty, A. Construction of a highly active xylanase displaying oleagious yeast: Comparison of anchoring systems. PLoS One 2014, 9, e95128. (38) Yamakawa, S.; Yamada, R.; Tanaka, T.; Ogino, C.; Kondo, A. Repeated fermentation from raw starch using Saccharomyces cerevisiae displaying both glucoamylase and α-amylase. Enzyme Microb. Technol. 2012, 50, 343−347. (39) Song, J.; Imanaka, H.; Imamura, K.; Minoda, M.; Katase, T.; Hoshi, Y.; Yamaguchi, S.; Nakanishi, K. Cloning and expression of a βgalactosidase gene of Bacillus circulans. Biosci. Biotechnol. Biochem. 2011, 75, 1194−1197.

I

DOI: 10.1021/acs.jafc.5b06138 J. Agric. Food Chem. XXXX, XXX, XXX−XXX