An N,N-Bis(benzimidazolylpicolinoyl)piperazine (BT-11): A Novel

Article pubs.acs.org/jmc

An N,N‑Bis(benzimidazolylpicolinoyl)piperazine (BT-11): A Novel Lanthionine Synthetase C‑Like 2‑Based Therapeutic for Inflammatory Bowel Disease Adria Carbo,† Richard D. Gandour,† Raquel Hontecillas,† Noah Philipson,† Aykut Uren,‡ and Josep Bassaganya-Riera*,† †

Biotherapeutics Inc., 1800 Kraft Drive, Suite 200, Blacksburg, Virginia 24060, United States Georgetown University Medical Center, Washington, District of Columbia 20057, United States

‡

S Supporting Information *

ABSTRACT: Lanthionine synthetase C-like 2 (LANCL2), a novel therapeutic target for inflammatory and autoimmune diseases and diabetes, exerts anti-inflammatory and insulin-sensitizing effects. This study reports the first LANCL2-based therapeutics for inflammatory bowel disease (IBD). Analogues of 1 (ABA) and 2 (NSC61610) were screened by molecular docking, then synthesized and analyzed for binding to LANCL2 by surface plasmon resonance. Piperazine-1,4diylbis(6-benzo[d]imidazole-2-yl)pyridine-2-yl)methanone, 7, was identified as the lead LANCL2-binding compound for treating IBD. The oral treatment with 7 (8 mg/kg/d) in a mouse model of IBD resulted in lowering the disease activity index, decreasing colonic inflammatory lesions by 4-fold, and suppressing inflammatory markers (e.g., TNF-α, and interferon-γ) in the gut. Furthermore, studies in LANCL2−/− mice demonstrated that loss of LANCL2 abrogated beneficial actions of 7, suggesting high selectivity for the target. In conclusion, 7 merits continued development as a LANCL2-based, first-in-class orally active therapeutic for IBD.

■

INTRODUCTION Inflammatory bowel disease (IBD), a chronic recurring disease of the gastrointestinal (GI) tract, afflicts over 1 million people in North America and 4 million worldwide.1 This widespread and debilitating autoimmune disease results in decreased quality of life and significant health care-related costs.2 IBD comprises two clinical manifestations: ulcerative colitis (UC) and Crohn’s disease. Both pathologies are characterized by uncontrolled chronic inflammation in the GI tract triggered by an unbalanced, pro-inflammatory immune response to the commensal gut microbiota. Current therapies for IBD, such as anti-TNF-α biologics, are modestly successful for the long-term management of the disease and have significant adverse side effects, including infection, cancer, and death. A recent review3 summarizes the current treatment paradigm for IBD, small molecules and biologics. Aminosalicylates (e.g., mesalamine) inhibit interleukin (IL)-1, TNF-α, and platelet activating factor. These locally acting immunosuppressors decrease antibody secretion by nonspecifically inhibiting cytokines. Immunomodulators (e.g., methotrexate) block the de novo pathway of purine synthesis. They show antiproliferative effects and reduce inflammation. Corticosteroids (e.g., prednisone), among other functions, block phospholipase A2 in the arachidonic acid cascade and, thus, alter the balance between prostaglandins and leukotrienes.4 They stimulate apoptosis of lamina propria lymphocytes and suppress transcription of cytokines. Anti-TNF-α drugs (e.g., infliximab) induce apoptosis in proinflammatory cells. They bind © 2016 American Chemical Society

specifically to TNF-α and block the interaction of the receptor. They specifically inhibit inflammatory cytokines, which result in immunosuppression. Anticell adhesion molecules (e.g., vedolizumab) inhibit migration of leukocytes into the GI mucosa. They specifically inhibit cell adhesion molecules that mediate lymphocyte−endothelial interactions.5 Although current treatments have improved, an unmet clinical need remains for safer and more effective IBD therapeutics. For example, anti-TNF-α antibodies, used to treat patients with moderate to severe Crohn’s disease, only work in 30−40% of the patients and have adverse effects that range from infection to cancer and death. Lanthionine synthetase C-like 2 (LANCL2) has emerged as a new therapeutic target for treating inflammatory and immunemediated diseases and diabetes.6 Its proposed natural ligand is abscisic acid, 1 (ABA) (Chart 1),7 which exerts antiinflammatory and antidiabetic effects.8−12 LANCL2 is broadly expressed in epithelial cells and the immune system, including thymus, spleen, colon, and Peyer’s patches; expression in these cells and tissues suggests a potential role in modulating mucosal immune responses. To further understand the function of LANCL2 through its structure and to investigate whether 1 activates LANCL2 via direct binding to the protein, molecular modeling of human LANCL2 was performed.13 On the basis of the predicted structure of LANCL2, an in silico docking approach was used Received: March 18, 2016 Published: November 4, 2016 10113

DOI: 10.1021/acs.jmedchem.6b00412 J. Med. Chem. 2016, 59, 10113−10126

Journal of Medicinal Chemistry

Article

for binding to LANCL2 as measured by surface plasmon resonance (SPR). From these data, 7, our top lead, is assayed for antiinflammatory efficacy in a dextran sodium sulfate (DSS) mouse model of IBD. These in vivo results demonstrate that oral treatment with 7 (8 mg/kg/day) ameliorates colitis in mice.16,17 Further, our initial safety assessment in rats indicates that oral treatment with 7 at high doses has an excellent safety profile up to 1000 mg/kg/day.18,19 In addition to reporting the details of these preclinical efficacy studies,16,17 we report a selectivity study with knockout mice (LANCL2−/−) to support our hypothesis that 7 protects from IBD by targeting LANCL2. These studies support a claim that 7 has potential to be a safe and effective orally active therapeutic for IBD.

Chart 1

■

RESULTS

Drug Design. The physicochemical properties of the two leads suggest that 1 fits the profile (Table 1) for an oral drug,20 while 2 might be too big and too hydrophobic. In analyses with ChemAxon software (www.chemicalize.org) on drug likeness, 2 only passes one of the six Lipinski-like filters; 1 passes all six. Lead 2 passed only the Veber filter (polar surface area ≤140 Å2 and rotatable bonds ≤12). Yet 2 effectively reduces gut inflammation in mouse models,14 thereby validating its potential as a lead. The one caveat is that 2 is a very insoluble compound. So, both leads must be considered as candidate parent compounds for developing derivatives and analogues that are NCEs. To maintain as much of the lead ligands as possible, the design of analogues of 2 and 1 began with a conservative approach to retain any pharmacophores in the leads. We designed analogues based on ease of synthesis and ability to probe possible separate binding sites on LANCL2 for the two leads. Informed by the ranges for the characteristic physical

to screen ligands from public databases such as NCI Diversity Set II, ChemBridge, ZINC natural products, and FDAapproved drugs. These studies uncovered 2 (NSC61610, PubChem 247228) (Chart 1) as the top-ranked ligand based on binding energy to LANCL2. Biochemical in vitro and in vivo experiments demonstrated that treatment with 2 induces IL-10mediated anti-inflammatory responses that ameliorate disease activity and decrease inflammatory lesions in the gut.14 Herein, we describe the process for identifying 7 (BT-11)15 (Chart 1 and Scheme 1) as a lead orally active compound for treating IBD. Our discovery process begins with designing analogues of 2 (Supporting Information, Table S1) and 1 (Supporting Information, Table S2) within limits of “freedom to operate” to develop new chemical entities (NCEs). These designs are screened computationally by molecular docking to LANCL2. Compounds selected for synthesis are then assayed Scheme 1. Synthesis of Analogues of 2

10114



Article

removing two hydrogen bond donors. Although the 1,4arrangement of the two nitrogens in piperazine provided the same relative attachment as the para-substituted benzene ring in 2, the number of bonds connecting the two benzimidazoles were reduced, resulting in a slightly smaller molecule. Further, the increased flexibility of the piperazine compared to a planar benzene could enhance interaction of these analogues with LANCL2 compared to the rigid 2. The isoprenoid phytohormone 1, discovered first in plants and then in mammals,23 provided an even greater challenge for finding NCEs because a recent patent application24 covered a large chemical space. With the thought that the keto and hydroxyl groups were the key parts of the pharmacophore, simplifying the isophorone moiety to cyclohexanone offered opportunities for analogues (Supporting Information, Table S2). We added an (E)-ethenediyl spacer to link the cyclohexanone to six-membered and five-membered aromatic rings. The positioning of the carboxyl group on these aromatic rings was designed to probe the optimal geometry for binding. To test our designs, we performed molecular docking, then selected compounds for synthesis, assayed their binding to LANCL2 with SPR, and then selected one for in vivo testing in mice and rats. The top lead was advanced toward a full-scale preclinical efficacy and safety program. Molecular Docking. To guide the selection of which compounds to synthesize for assays, the interactions of the analogues with LANCL2 were analyzed by docking studies. The initial goal was to find analogues with binding energies equal to or exceeding those for 2 and 1. Having identified these analogues, we visually examined the fit with respect to sterics and chemical compatibility. Among the analogues of 2, piperazine analogues were significantly better than the others. Thus, 7 and 8 emerged as targets for chemical synthesis (Scheme 1) and further assay. As the synthons and chemistry were similar, we synthesized 9−14 and 19. For analogues (Supporting Information, Table S2) of 1, docking studies suggested that nearly all members of the sixmembered ring series, especially 36, 38, and 41, showed better

Table 1. Physical Properties (Means and Percentiles) for Marketed Oral Drugs20,a MW cLogP ONs AHs NATOM NRING ROT TotalSA PSA ACC DON Xs

mean

10−90th percentile

2

1

343.7 2.3 5.5 1.8 23.9 2.6 5.4 395 78 3.2 1.8 0.5

200−475 −0.8 to 5.2 2−9 0−3 14−33 1−4 1−10 246−547 22−134 1−6 0−3 0−2

548.6 6.5 8 4 42 7 6 718 116 4 4 0

264.3 0.9 4 2 19 4 3 395 75 4 2 0

a

ONs, number of O and N atoms; AHs, number of O−H and N−H bonds; NATOM, number of non-hydrogen atoms; NRING, number of rings; TotalSA, total surface area; PSA, polar surface area; ACC, number of hydrogen bond acceptors; DON, number of hydrogen bond donors; Xs, number of halogens.

properties of oral drugs20 and given the limited “freedom to operate” for constructing novel chemotypes, we designed several sets of ligands to improve physical properties for both leads (Supporting Information, Tables S1 and S2). The designs for analogues of these two, very dissimilar leads provided a broad range of physical properties. For analogues (Supporting Information, Table S1) of 2, we examined a few modifications: (i) changing para-substituted benzene to 1,4-cyclohexyl to vary flexibility in the central scaffold, (ii) changing the two meta-substituted benzene rings to 2,6-substituted pyridines to lower cLogP, and (iii) benzimidazole to benzoxazole or 7-azabenzimidazoles to decrease or increase the number of nitrogen atoms. For the remainder of the analogues, we reversed the amide bond, a strategy known as an umpolung approach. The central scaffold varied with several diamines, including piperazine,21,22 which changed secondary amides into tertiary amides, thereby Scheme 2. Synthesis of Analogues of 1: 24, 28, and 30

10115



Article

Scheme 3. Synthesis Analogues of 1: 36, 38, and 41

binding than 1. No analogue was especially better or worse at docking than 1. Analogues 24 and 28 were similar in binding to that of 1; 24, which has no nitrogen atoms, was chosen for comparison with 36, 38, and 41. Analogues 24, 28, 36, 38, and 41 were synthesized (Schemes 2 and 3) for further assay by SPR. Chemistry. Analogues of 2 were synthesized by carbodiimide chemistry (Scheme 1). Synthesizing the unsymmetrical 19 required making 17 and 18. The coupling of 18·HCl with 3 gave a higher yield than the coupling of 17·HCl with 4. The yields for 7 and 8 were optimized and scaled to gram quantities as these had better solubilities and activities than the others. All target compounds were characterized by LCMS and 1H NMR (see Supporting Information). Target compounds were purified by chromatography to at least 95% as analyzed by LCMS. Analogues of 1 (Schemes 2 and 3) were synthesized by organometallic chemistries. Heck and Suzuki cross-coupling reactions produced the analogues. Heck chemistry worked well for coupling to the aryl iodide (21) and furanyl bromide (25); it gave poor yields for coupling to bromopicolinates and bromoisonicotinate. Suzuki chemistry worked well for these pyridines. Surprisingly, coupling of 33 to 4-bromopicolinate occurred with demethylation of the ester. Notably, 4-

bromopicolinic acid was identified as a side product (see Supporting Information). In the course of optimizing the synthesis of 28, 30 formed as a major side product. Aware that serendipity plays a role in drug discovery and after performing molecular docking, we developed a pathway to 30. Interestingly, reversing the deprotection reactions favored one product over the other. All target compounds were characterized by LCMS and 1H NMR (see Supporting Information). Target compounds were purified by chromatography to at least 95% as analyzed by LCMS. Biochemistry and Biology. Below, we present four experiments, two in vitro assessments and two in vivo assessments, that identify 7 as the lead and elucidate its role in targeting LANCL2 for treating IBD. Experiment no. 1 assayed several analogues for binding to LANCL2 by SPR. Experiment no. 2 measured cAMP in WT and LANCL2−/− splenocytes following treatment with 7. Experiments nos. 3 and 4 assessed efficacy of 7 in DSS mouse models of IBD. Experiment no. 3 was with WT only; experiment no. 4 was with WT compared to LANCL2−/−. These two experiments assessed selectivity and mechanism of action (MoA) in vivo. Our goal was to demonstrate that 7 has anti-inflammatory effects by binding to LANCL2 by examining 10116



Article

Figure 1. Analogue 7 binds to LANCL2 and engages the anti-inflammatory pathway driven by cAMP. (A) Cartoon representation of the LANCL2 pathway, which upon binding activates adenyl cyclase (AC), following cAMP, CREB, and PKA activation. (B) SPR sensorgrams, analogue 7 was injected over LANCL2-coated surfaces at five different concentrations in triplicate. (C) Curve fitting of binding versus concentration of 7 to determine KD.

activity14 with LANCL2; thus, an analogue of 2 might be successful. Experiment no. 2: Measuring cAMP in WT and LANCL2−/− Splenocytes Following Treatment with 7. Results from previous studies14 showed that LANCL2 engagement produces an increase of PKA, followed by an accumulation of cAMP in the cytoplasm (Figure 2). From a mechanistic perspective, activating cAMP leads to suppressing TNF-α and increasing IL-10 via cAMP response elementbinding (CREB) phopshorylation.25 Several endogenous mediators have been described26,27 as TNF-α attenuators, such as cAMP. To elucidate the specific steps in target

four key events: (i) direct binding to the LANCL2 protein, (ii) target engagement/activation after binding of the LANCL2 pathway, (iii) high anti-inflammatory efficacy in animal pharmacology studies with mouse models of colonic inflammation, and (iv) abrogation of the protective actions of 7 in LANCL2−/− mice with IBD. We illustrate the LANCL2 pathway in a cartoon representation (Figure 1A). Experiment no. 1: Assaying Several Analogues for Direct Binding to LANCL2 by SPR. To assess direct binding to the LANCL2 protein, we performed SPR studies with LANCL2. All synthesized analogues were assayed. Binding sensorgrams for 7 (Figure 1B) showed a typical small molecule−protein interaction with very fast on rates and very fast off rates. By plotting the equilibrium binding level against the compound concentration, we measured the equilibrium dissociation constant (KD) for each analogue that bound (e.g., Figure 1C). For analogues of 2, the benzoxazole analogues (8, 10, 12, 14) were insoluble in the assay conditions. Analogues 7 and 19 displayed the best binding. We also tested 17, 18, and 3 in the synthesis as these are potential hydrolysis products of the two top candidates. None of these latter three compounds showed any binding. For analogues of 1, all six compounds showed modest binding, with 30 and 36 as the two top candidates. These results agreed with the docking studies where analogues of 2 had higher binding energies than analogues of 1. Out of the pool of analogues, we identified 7 as an ideal candidate to move forward in the preclinical and clinical regulatory pipeline based on predicted binding, chemical structure, patentability, and ease of synthesis. Further, 2 had

Figure 2. In vitro measurement of cAMP in mouse splenocytes extracted from either WT or LANCL2−/− mice and treated with increasing doses of 7. Statistically significant differences (P < 0.05) are indicated with an asterisk (n = 10). 10117



Article

Figure 3. Effect of oral administration of 7 on colonic inflammatory lesions in mice with IBD. Mice were treated with DSS to induce colonic colitis and treated orally daily with 7 for 7 d. Representative micrographs from the colons of (A,D) control (B,E) DSS, and (C,F) 7-treated DSS mice. Colonic histopathological lesions were evaluated based on (left graph) leukocytic infiltration, (center graph) epithelial erosion, and (right graph) mucosal thickening. (D) Representative micrographs of control, DSS treated, and DSS and 7-treated mice. Statistically significant differences (P < 0.05) are indicated with an asterisk (n = 10).

Figure 4. Colonic gene expression analysis of TNF-α, IL-10, and LANCL2. Colonic gene expression performed by real-time RT-PCR to assess the levels of (A) LANCL2 expression in mice with colitis treated with 7 (8 mg/kg/d) in comparison with vehicle (measurement is from day 3 after treatment), (B) LANCL2 in a time-course manner in untreated mice with colitis, (C) pro-inflammatory TNF-α, and (D) IL-10 in mice with DSS colitis on day 7. Statistically significant differences (P < 0.05) are indicated with an asterisk (n = 10).

engagement triggered by binding of 7 to LANCL2, we performed in vitro studies with mouse splenocytes and assessed the levels of downstream signaling. Results (Figure 2) showed a dose−response increase of cAMP production when WT-derived splenocytes were treated with 7. With splenocytes extracted from LANCL2−/− mice,

cAMP production did not correlate with dose of 7. This in vitro experiment demonstrates 7 stimulates cAMP production by activating the LANCL2 pathway. Experiment no. 3: Assessing Efficacy of 7 in a WT DSS Colitis Mouse Model. Once we confirmed the direct binding by SPR and the target engagement of 7 to LANCL2 in 10118



Article

Figure 5. Selectivity studies: effect of 7 given orally in WT versus LANCL2−/− mice with DSS colitis. (A) Disease activity index scores in WT and LANCL2−/− mice treated with either 7 or vehicle only. (B) Colonic histopathological analyses evaluated based on leukocytic infiltration. Effect of oral 7 in colonic immune cell subsets characterized by (C) TNF-α, (D) IL-10, (E) MHC-II+ CD1c+ granulocytes, and (F) MCP1. Statistically significant differences between groups (P < 0.05) are indicated with an asterisk.

Experiment no. 4: Target Selectivity Studies: Assessing Efficacy of 7 in WT and LANCL2−/− Mice with IBD. To investigate the dependency of 7 for LANCL2, we performed preclinical studies using WT mice and mice lacking LANCL2 with IBD. Our results provided molecular evidence in vivo that LANCL2 is necessary for 7 to exert anti-inflammatory benefits because absence of LANCL2 abrogated the therapeutic efficacy of 7 in DSS colitis (Figure 5A). During peak inflammation in DSS colitis (7 days after start of the challenge), the effect of 7 in lesion formation at the colonic mucosa also depended on LANCL2. We assessed colonic histopathology in LANCL2−/− mice treated with either vehicle or 7 and observed that the absence of LANCL2 completely abrogates the protective effect of 7 in experimental IBD (Figure 5B). Our flow cytometry analyses of colonic cells from the two DSS colitis mouse models also demonstrated that reducing TNF-α (Figure 5C), MHC-II+ CD11c+ granulocytes (Figure 5E), and MCP-1 (Figure 5F) depends on LANCL2 because the loss of lancl2 abrogates the effect of 7. In line with these results, upregulation of IL-10 secretion after treatment with 7 was completely abrogated in colons of LANCL2−/− mice (Figure 5D) but not in WT littermates. These immunophenotyping results at the colonic mucosa level, together with disease activity and histopathological results, demonstrated that 7 requires LANCL2 to decrease inflammation in experimental IBD.

splenocytes, we assayed the efficacy of 7 in vivo using a mouse model of DSS colitis. Notably, we reported14 that administering 2, the parent compound of 7, significantly improves disease activity and gut inflammatory lesions. Our objective in this study was to investigate whether administering 7 also activates LANCL2 and protects mice from IBD. Daily oral treatment with 7 (8 mg/kg/d) significantly improved disease activity during a 7-day DSS challenge (Figure 3A). We next examined the effect of 7 on colonic inflammatory lesions. In line with our observations of disease activity and gross lesions, histopathological analyses confirmed that oral treatment with 7 significantly decreased by 5-fold the inflammation in the gut mucosa based on assessment of leukocytic infiltration (Figure 3, left graph), epithelial erosion (Figure 3, center graph), and mucosal thickening (Figure 3, right graph). Representative colonic photomicrographs (Figure 3A−F) demonstrate that oral treatment with 7 in mice with DSS colitis significantly ameliorates colonic lesion formation. Furthermore, oral treatment with 7 showed a significant upregulation in colonic LANCL2 expression on day 3 (Figure 4A). The restitution of LANCL2 to homeostatic levels by 7 is critical because LANCL2 mRNA is decreased (Figure 4B) during the peak of inflammation/disease in a DSS colitis mouse model. Furthermore, oral treatment with 7 downregulated the colonic expression of TNF-α (Figure 4C) and upregulated the levels of the anti-inflammatory cytokine IL-10 (Figure 4D). 10119



■

Article

DISCUSSION AND CONCLUSION This study achieved our goal of finding a novel orally active first-in-class therapeutic for IBD (Crohn’s disease and UC) based on a unique MoA involving the LANCL2 pathway. Computational and biochemical screening of libraries of analogues of 1 and 2 enabled identifying our top lead, 7, which binds to LANCL2, downregulates expression of proinflammatory cytokines (e.g., TNF-α or interferon-γ, which are hallmarks of IBD), and promotes IL-10-mediated antiinflammatory responses in the GI tract. Guided by the average physical properties of marketed oral drugs, in silico analyses led to the synthesizing 15 compounds for analysis by SPR to assess binding to LANCL2. With the lowest KD, 7 emerged as the most likely candidate. As an analogue of 2, 7 is the best choice of the analogues analyzed herein for an IBD drug development program. As stated earlier, 2 only passes one of the six Lipinski-like filters; 7 passes three. Comparing some key properties of 7 to those of 2, 7 has a significantly lower cLogP (3.93 vs 6.78), fewer rotatable bonds (4 vs 6), lower MW (528 vs 548), greater polar surface area (123 vs 116), and smaller total surface area (700 vs 719). These changes improve the drug-like properties compared to 2. More importantly, 7 has better solubility than 2, especially in acidic media as found in the gut. Furthermore, 7 is stable in simulated gastric and intestinal fluids (data not published). As stated above, our goal is to develop an orally active IBD drug that acts in the GI tract (ileum and colon). A drug with minimal systemic absorption (10% or less) provides many advantages for a locally acting therapeutic. Not satisfying all rules for a good oral drug with systemic distribution may be a good strategy for developing a drug for IBD. Here, we developed a drug with physicochemical properties that might enable local action in the GI tract. Our preclinical therapeutic efficacy studies in mice show that 7 reduces the disease activity and improves gut inflammation by significantly decreasing leukocytic infiltration in the gut mucosa plus decreasing mucosal thickening and epithelial erosion. A previous study11 documents that oral treatment with 1 produces anti-inflammatory effects in mice with IBD. Specifically, in a DSS colitis mouse model, 1 significantly ameliorates disease activity, colitis, reduced colonic leukocyte infiltration, and inflammation.11 These improvements are associated with downregulation in vascular cell adhesion marker-1, E-selectin, and mucosal addressin adhesion marker1 expression.11 In our study, gene expression analyses confirm that oral administration of 7 upregulates the expression of IL-10 and downregulates the expression of TNF-α mRNA in a DSS colitis mouse model. Also, oral treatment with 7 upregulates LANCL2 expression in the GI tract. LANCL2 is necessary to exert all the anti-inflammatory effects due to administration of 7 because the absence of LANCL2 abrogates the beneficial effect of 7, as demonstrated by experiment 4. From a mechanistic perspective, small molecules (e.g., 1 and 2) that activate LANCL2 regulate inflammatory and metabolic processes through adenylyl cyclase/cAMP dependent mechanisms.23 LANCL2 works through cAMP, which ultimately regulates the expression of cytokines. Notably, various cAMP-elevating agents, such as rolipram and cicaprost, precisely inhibit TNF-α synthesis.28,29 Also, accumulation of cAMP stimulates IL-10 synthesis in humans.30 The mediating signal transduction pathway engages

PKA as suggested by the reversal of effects with a cAMP inhibitor.30 Targeting activation of the LANCL2 pathway might open a new strategy to treat patients that may not have responded well to other therapies. Activating LANCL2 with 7 positively regulates the production of cAMP in the cytoplasm. In addition, LANCL2 is expressed in RAW 264.7 cells, a mouse leukemic monocyte macrophage cell line. Further, lancl2 knockdown studies provide evidence that ABA-mediated signaling depends on lancl2 expression.23 This leads to the downstream activation of PKA, which serves to phosphorylate and activate many proteins such as CREB, a cellular transcription factor. By binding to cAMP response element DNA sequences, it increases or decreases transcription of downstream genes.25 CREB-regulated genes include those for c-fos, the neurotrophin brain-derived neurotrophic factor, tyrosine hydroxylase, many neuropeptides, and the antiinflammatory cytokine, IL-10. Analogue 7 was tested in safety studies18 in rats up to 1000 mg/kg/d. Behavioral, clinical pathology, and histopathology studies18,19 in a high-single-dose and a 14-day high-multipledose showed no toxicologically relevant differences between vehicle and 7-treated rats. Preliminary data from a PK study (0.5−48 h) conducted in healthy rats given an oral dose (80 mg/kg) of 7 showed that the maximal concentration (Cmax) in blood plasma (28 ng/mL) was reached at 1 h. The product was cleared with a t1/2 of 3.1 h with a rate constant of elimination of −0.225 L/h from an apparent volume of distribution estimated at 3.38 L/kg. A second trial with 7 at 500 mg/kg resulted in a Cmax of 17 ng/mL and a time to Cmax of 4 h. That 7 did not show plasma concentration−dose proportionality following a >6-fold difference in doses suggested that 7 has limited absorption from the GI tract. One would expect greater doserelated differences in plasma concentrations if 7 had a high bioavailability. Also, concentrations of 7 in colon and colon contents were much higher than those in plasma; studies with oral versus rectal administration showed no differences (Supporting Information, Figure S1). Combining the toxicological findings at doses up to 1000 mg/kg/d, the low bioavailability, and lack of plasma concentration−dose proportionality with the results from experiments 3 and 4 (8 mg/kg/d) strongly suggest that 7 may protect from IBD by acting locally in the GI mucosa as opposed to being systemically distributed and taken up by tissues. These two experiments further validate our claim that LANCL2 is a unique therapeutic target for inflammatory diseases. An unmet clinical need remains for novel, safer, and more efficacious drugs to treat both Crohn’s disease and UC. We have presented a unique therapeutic target and a novel drug candidate. The promising results for 7 in animal pharmacology in mice and safety studies in rats support continued nonclinical and clinical development toward a first-in-class, safe, efficacious, orally active therapeutic for IBD.

■

EXPERIMENTAL METHODS

Chemistry. Piperazine-1,4-diylbis((6-(1H-benzo[d]imidazol-2-yl)pyridin-2-yl)methanone) (7 and 7·HCl). A solution of 6-(1Hbenzimidazol-2-yl)pyridine-2-carboxylic acid31 (3, 12 g) in DMF (100 mL) was cooled to 0 °C, and then EDCI (1.5 equiv), HOBt (1.5 equiv) and DIPEA (1.2 equiv) were sequentially added. The mixture was stirred for 10 min at 0 °C. Piperazine (0.5 equiv) was added; the reaction mixture was stirred and gradually warmed to RT over 16 h. The reaction mixture was then poured onto ice (∼300 mL). The 10120



Article

precipitate was filtered, washed with ice-cold water, and dried to give a pale-brown solid (10 g), mp 326.2−328.0 °C. 1H NMR (400 MHz, DMSO-d6), δ 12.97 (s, 1H), 12.79 (s, 1H), 8.42 (d, 1H, J = 8.0), 8.34 (d, 1H, J = 8.0), 8.16 (t, 1H, J = 8.0), 8.09 (t, 1H, J = 8.0), 7.77−7.70 (m, 2H), 7.67 (d, 2H, J = 8.0), 7.57 (d, 1H, J = 7.2), 7.53 (d, 1H, J = 6.8), 7.33−7.16 (m, 4H), 3.90 (br, 2H), 3.80 (br, 2H), 3.65 (br, 2H), 3.56 (br, 2H); 99.9% pure by LCMS-ES 529.44 [M + H]+, 265.46 [(M + 2H)/2]+2. A suspension of 7 (1.0 equiv) in a minimal amount of MeOH was cooled to 0 °C, and 4 M methanolic HCl (excess, 15 mL/g) was added dropwise over a period of 15−20 min. The mixture was stirred and gradually warmed to RT over 3 h. Concentration of the reaction mixture gave a viscous mass, which was washed with MeOH/DCM 1:9 and then lyophilized to get an off-white solid (850 mg), mp 338.8− 340.1 °C. 1H NMR (300 MHz, DMSO-d6), δ 8.63 (d, 1H, J = 7.8), δ 8.54 (d, 1H, J = 7.8), 8.27 (t, 1H, J = 7.8), 8.25 (t, 1H, J = 7.8), 7.92− 7.74 (m, 6H), 7.56−7.41 (m, 4H), 3.91 (br, 2H), 3.81 (br, 2H), 3.64 (br, 2H), 3.55 (br, 2H); 95.2% pure by LCMS-ES 529.56 [M + H]+. Piperazine-1,4-diylbis((6-(benzo[d]oxazol-2-yl)pyridin-2-yl)methanone) (8). A solution of 6-(benzoxazol-2-yl)pyridine-2-carboxylic acid32 (4, 4.05 g) in DMF/DCM 1:9 was treated with EDCI (1.5 equiv), HOBt (1.5 equiv), DIPEA (1.2 equiv), and piperazine (0.5 equiv) at 0 °C. The mixture was stirred and gradually warmed to RT over 16 h. A light-brown solid formed and was filtered in a sinter-glass funnel. Washing with water and lyophilizing gave a light-brown solid (3.2 g), mp 342.0−343.3 °C. 1H NMR (300 MHz, CDCl3), δ 8.47 (d, 1H, J = 8.1), 8.40 (d, 1H, J = 8.1), 8.15−7.98 (m, 2H), 7.94−7.83 (m, 3H), 7.79 (d, 1H, J = 7.8), 7.71 (d, 1H, J = 6.9), 7.55 (d, 1H), 7.52− 7.29 (m, 4H), 4.09−3.91 (m, 8H); 99.3% pure by HPLC and 95.4% pure by qHNMR. Piperazine-1,4-diylbis((3-(1H-benzo[d]imidazol-2-yl)phenyl)methanone) (9 and 9·HCl). A solution of 3-(1H-benzimidazol-2yl)benzoic acid33 (5, 100 mg) in DMF (6 mL) was treated with EDCI (1.5 equiv), HOBt (1.5 equiv), DIPEA (1 equiv), and piperazine (0.5 equiv) at 0 °C. The mixture was stirred and gradually warmed to RT over 16 h. After workup and washings with Et2O, a light-brown solid (30 mg) was isolated. 1H NMR (400 MHz, DMSO-d6), δ 13.01 (s, 2H), 8.23 (br, 4H), 7.66 (br, 4H), 7.55 (br, 4H), 7.22 (br, 4H), 3.91− 3.42 (br, 8H); 95.5% pure by LCMS-ES 527.36 [M + H]+, 264.50 [(M + 2H)/2]+2. To a solution of 9 (30 mg) in dioxane, 4 M HCl was added at RT. After stirring for 3 h, the mixture was concentrated to give a solid. Washing with Et2O gave a light brown solid (10 mg), mp 348.8−349.9 °C. 1H NMR (400 MHz, DMSO-d6), δ 8.48 (br, 4H), 7.91−7.74 (br, 8H), 7.56 (br, 4H), 3.81 (br, 4H), 3.57 (br, 4H); 98.3% pure by LCMS-ES 527.44 [M + H]+, 264.50 [(M + 2H)/2]+2. Piperazine-1,4-diylbis((3-(benzo[d]oxazol-2-yl)phenyl)methanone) (10). In DMF (10 mL), 3-(2-benzoxazolyl)benzoic acid34 (6, 50 mg) was treated with EDCI (1.25 equiv), HOBt (1.25 equiv), DIPEA (1 equiv), and piperazine (0.5 equiv) at 0 °C. The mixture was stirred and gradually warmed to RT over 16 h. After diluting the reaction mixture with ice-cold water, a precipitate formed. Filtration, followed by drying, gave a light-brown solid (30 mg). 1H NMR (300 MHz, TFA), δ 8.72−8.54 (br, 4H), 8.18−7.80 (12H), 4.37−4.05 (4H), 4.04−3.66 (4H); 82.8% pure by LCMS-ES 529.48 [M + H]+. N,N′-(1,4-Phenylene)bis(6-(1H-benzo[d]imidazol-2-yl)picolinamide) (11 and 11·HCl). In DMF (10 mL), 3 (100 mg) was treated with EDCI (1.5 equiv), HOBt (1.5 equiv), DIPEA (3 equiv), and benzene-1,4-diamine (0.5 equiv) at 0 °C. The mixture was stirred and gradually warmed to RT over 16 h. After pouring the reaction mixture into ice-cold water, the precipitate was filtered and dried to give a pale-brown solid (60 mg). In dioxane (3 mL) at 0 °C, the solid (50 mg) was treated with 4 M HCl. The mixture was stirred and gradually warmed to RT over 4 h. Evaporation of the excess dioxane HCl gave a brown solid (30 mg), mp 394.6−398.9 °C. 1H NMR (300 MHz, DMSO-d6), δ 10.96 (s, 2H), 8.61 (t, 2H, J = 4.5), 8.35 (d, 4H, J = 4.5), 8.06 (s, 4H), 7.88− 7.81 (m, 4H), 7.47−7.40 (m, 4H); 97.5% pure by LCMS-ES 551.84 [M + H]+.

N,N′-(1,4-Phenylene)bis(6-(benzo[d]oxazol-2-yl)picolinamide) (12). In DMF (10 mL), 4 (100 mg) was treated with EDCI (1.5 equiv), HOBt (1.5 equiv), DIPEA (1.2 equiv), and benzene-1,4diamine (0.5 equiv) at 0 °C. The mixture was stirred and gradually warmed to RT over 16 h. Dilution of the reaction mixture with icecold water gave a precipitate. Filtering, followed by drying, gave a lightbrown solid (70 mg). 1H NMR (400 MHz, TFA), δ 8.88 (d, 2H, J = 7.6), 8.82 (d, 2H, J = 7.2), 8.57 (t, 2H, J = 8.0), 8.11 (br, 4H), 8.02− 7.86 (m, 8H). 99.5% pure by LCMS-ES 553.28 [M + H]+. N,N′-(1,4-Phenylene)bis(3-(1H-benzo[d]imidazol-2-yl)benzamide) (13 and 13·HCl). In DMF (6 mL), 5 (100 mg) was treated with EDCI (1.5 equiv), HOBt (1.5 equiv), DIPEA (1 equiv), and benzene-1,4-diamine (0.5 equiv) at 0 °C. The mixture was stirred and gradually warmed to RT over 16 h. TLC (10% methanol:DCM) shows formation of nonpolar spot and absence of starting material. Workup and washing with Et2O gave a light-brown solid (60 mg). 1H NMR (300 MHz, DMSO-d6), δ 13.10 (s, 2H), 10.49 (s, 2H), 8.77 (s, 2H), 8.38 (d, 2H, J = 7.8), 8.07 (d, 2H, J = 7.8), 7.83 (s, 4H), 7.73 (t, 4H, J = 7.8), 7.57 (d, 2H, J = 6.9) 7.30−7.18 (m, 4H); 98.3% pure by LCMS-ES 549.0 [M + H]+ 275.1 [(M + 2H)/2]+2. In dioxane, 13 (60 mg) was treated with 4 M HCl for 3 h. Concentrating the solution formed a solid, which was washed with Et2O to give a light-brown solid (50 mg). 1H NMR (300 MHz, DMSO-d6), δ 10.60 (s, 2H), 8.99 (s, 2H), 8.53 (d, 2H, J = 7.5), 8.31 (d, 2H, J = 7.8), 7.94−7.81 m, 10H), 7.58−7.51 (m, 4H); 96.2% pure by LCMS-ES 549.3 [M + H]+ 275.3 [(M + 2H)/2]+2. N,N′-(1,4-Phenylene)bis(3-(benzo[d]oxazol-2-yl)benzamide) (14). In DMF (10 mL), 6 (50 mg) was treated with EDCI (1.25 equiv), HOBt (1.25 equiv), DIPEA (1 equiv), and benzene-1,4-diamine (0.5 equiv) at 0 °C. The mixture was stirred and gradually warmed to RT over 16 h. Diluting the reaction mixture with ice-cold water formed a precipitate, which was filtered and dried to give a light-brown solid (30 mg). 1H NMR (300 MHz, TFA), δ 9.18 (br, 2H), 8.71 (d, 2H, J = 7.2), 8.55 (br, 2H), 8.10−7.97 (br, 6H), 7.97−7.76 (br, 8H). Insolubility prevented accurate analysis by LCMS-ES. tert-Butyl 4-(6-(1H-Benzo[d]imidazol-2-yl)picolinoyl)piperazine1-carboxylate (15). In DMF (10 mL), 3 (500 mg) was treated with EDCI (1.5 equiv), HOBt (1.5 equiv), DIPEA (3 equiv), and tert-butyl piperazine-1-carboxylate (1.1 equiv) at 0 °C. The mixture was stirred and gradually warmed to RT over 16 h. After pouring the reaction mixture into ice-cold water, the precipitate was filtered and dried to give a pale-brown solid (600 mg). 1H NMR (300 MHz, DMSO-d6), δ 12.85 (s, 1H), 8.39 (d, 1H, J = 7.5), 8.12 (t, 1H, J = 7.5), 7.73(d, 1H, J = 7.2), 7.66 (d, 1H, J = 7.8), 7.58 (d, 1H, J = 7.2), 7.32−7.19 (m, 2H), 3.70 (br, 2H), 3.49 (br, 2H), 3.41 (br, 4H), 1.42 (s, 9H); 99.3% pure by LCMS-ES 408.54 [M + H]+. tert-Butyl 4-(6-(Benzo[d]oxazol-2-yl)picolinoyl)piperazine-1-carboxylate (16). A solution of 4 (500 mg) in DMF (10 mL) was treated with EDCI (1.5 equiv), HOBt (1.5 equiv), DIPEA (3 equiv), and tert-butyl piperazine-1-carboxylate (1.1 equiv) at 0 °C. The mixture was stirred and gradually warmed to RT over 16 h. After concentration of the mixture, the residue was extracted into EtOAc and washed with water. The organic layer was concentrated to give a solid, which was washed with pentane to yield a light-brown solid (120 mg). 1H NMR (300 MHz, DMSO-d6), δ 8.42 (d, 1H, J = 7.2), 8.20 (t, 1H, J = 7.8), 7.93−7.85 (m, 2H), 7.84−7.79 (m, 1H), 7.56−7.44 (m, 2H), 3.70 (br, 2H), 3.48 (br, 4H), 3.38 (br, 2H), 1.42 (s, 9H); 99.4% pure by LCMS-ES 431.37 [M + Na]+, 447.36 [M + K]+. 4-(6-(1H-Benzo[d]imidazol-2-yl)picolinoyl)piperazin-1-ium chloride (17·HCl). Compound 15 (600 mg) was treated with methanolic HCl (6 mL) at 0 °C. The mixture was stirred and gradually warmed to RT over 3 h. Evaporation of the excess methanolic HCl gave a lightbrown solid (500 mg). 1H NMR (300 MHz, DMSO-d6), δ 9.61 (br, 2H), 8.67 (br, 1H), 8.31 (t, 1H J = 7.8), 7.84 (br, 3H), 7.50 (br, 2H), 3.97 (br, 2H), 3.76 (br, 2H), 3.35−3.15 (br, 4H); 95.0% pure by LCMS-ES 308.26 [M + H]+. (6-(1H-Benzo[d]imidazol-2-yl)pyridin-2-yl)(piperazin-1-yl)methanone (17). Salt 17·HCl (12 mg) was neutralized with satd aq NaHCO3 followed by lyophilization to give a pale-brown solid (9 mg). 1 H NMR (300 MHz, DMSO-d6), δ 12.93 (br, 1H), 8.4 (d, 1H, J = 10121



Article

Methyl (E)-5-(2-(8-Hydroxy-1,4-dioxaspiro[4.5]decan-8-yl)vinyl)furan-2-carboxylate (26). A solution of 20 (200 mg, 1.0 equiv) and methyl 5-bromofuran-2-carboxylate (25, 1.5 equiv) in Et3N (2 mL) was degassed with argon for 10 min. Then, Pd(OAc)2 (0.025 equiv) and DPPF (0.05 equiv) were added and the solution was degassed for 10 min. The resulting reaction mixture was stirred and heated at 100 °C for 16 h. After concentration of the reaction mixture, a light-brown solid (130 mg) was isolated by column chromatography (EtOAc/ hexane 3:7). 1H NMR (400 MHz, DMSO-d6), δ 7.29 (d 1H, J = 4.0), 6.63 (d 1H, J = 3.6), 6.52 (d, 1H, J = 16.0), 6.46 (d, 1H, J = 16.4), 4.76 (s, 1H), 3.86 (s, 4H), 3.80 (s, 3H), 1.87−1.78 (m, 2H), 1.74−1.64 (m, 2H), 1.60−1.47 (m, 4H); 91.6% pure by LCMS-ES 291.34 [M − OH]+. Methyl (E)-5-(2-(1-Hydroxy-4-oxocyclohexyl)vinyl)furan-2-carboxylate, (27). To a mixture of 26 (130 mg) in acetone/H2O (1:1) was added TsOH (0.1 equiv) at 0 °C. The mixture was stirred at 0 °C and gradually warmed to RT over 24 h. The solution was neutralized with satd aq NaHCO3, concentrated, diluted with water, and extracted with EtOAc. The organic solution was concentrated to give a brown solid, which was purified by column chromatography with a gradient eluent, EtOAc/hexane 1:5 to 3:7, to give a light-brown solid (100 mg). 1 H NMR (300 MHz, CDCl3), δ 7.15 (d 1H, J = 3.3), 6.60 (d 2H), 6.37 (d, 1H, J = 3.6), 3.90 (s, 3H), 2.86−2.72 (m, 2H), 2.36 (br, 1H), 2.31 (br, 1H), 2.06 (d, 2H, J = 3.9), 2.03 (d, 2H, J = 3.6), 1.63 (s, 1H); 95.8% pure by LCMS-ES 247.17 [M − OH]+. E-5-(2-(1-Hydroxy-4-oxocyclohexyl)vinyl)furan-2-carboxylic Acid (28). To a mixture of 27 (100 mg) in THF/H2O 3:2 was added LiOH· H2O (2.5 equiv) at 0 °C; the mixture was stirred at 0 °C to RT over 16 h. The solution was concentrated and washed with Et2O; the water layer was acidified with 2 N HCl to pH 4. The aqueous solution was extracted with EtOAc, which was concentrated to give a light-brown solid (70 mg). A sample was purified by column chromatography (EtOAc/hexane/HOAc 1:1:0.01) to give a beige solid (10 mg). 1H NMR (400 MHz, DMSO-d6), δ 13.01 (br 1H), 7.20 (d 1H, J = 3.6), 6.60 (d 1H, J = 3.6), 6.60 (d 1H, J = 15.9), 6.49 (d 1H, J = 15.9), 5.21 (s, 1H), 2.76−2.58 (m, 2H), 2.13 (br, 1H), 2.09 (br, 1H), 2.04−1.80 (4H); 98.0% pure by LCMS-ES 249.26 [M − H]−, 499.20 [2M − H]−, 233.19 [M − OH]+ E-5-(2-(8-Hydroxy-1,4-dioxaspiro[4.5]decan-8-yl)vinyl)furan-2carboxylic Acid (29). To a solution of 26 (100 mg) in THF:H2O:MeOH (2:1:0.5 mL), LiOH (3 equiv) was added; the resulting mixture was stirred at RT over 16 h. The mixture was then concentrated, and the solid was dissolved in minimum amount of H2O and acidified with 2 N HCl to pH 4. Extraction with EtOAc followed by concentration of the organic layer yielded a light-brown solid (54 mg), which was used for next reaction without further purification. The solid was a binary mixture of 29/30 72:26. LCMS-ES 29 277.26 [M − OH]+ and 30 233.25 [M + H]. E-5-(2-(4-Oxocyclohex-1-en-1-yl)vinyl)furan-2-carboxylic Acid (30). To the binary mixture of 29/30 (50 mg) in THF (0.3 mL), 3 N HCl (0.1 mL) was added at 0 °C. The mixture was stirred and gradually warmed to RT over 6 h. The mixture was concentrated, diluted with water, extracted with EtOAc, and reconcentrated to yield a brown solid (20 mg). 1H NMR (300 MHz, DMSO-d6), δ 12.98 (br 1H), 7.20 (d 1H, J = 3.3), 6.95 (d 1H, J = 16.5), 6.65 (d 1H, J = 3.3), 6.45 (d, 1H, J = 15.9), 6.11 (t, 1H, J = 3.9), 3.05 (br, 2H), 2.65 (t, 2H, J = 6.9), 2.55−2.45 (2H overlapped with DMSO-d5); 99.3% pure by LCMS-ES 233.21 [M + H]+, 231.27 [M − H]−, 463.15 [2M − H]−. 8-Ethynyl-8-((tetrahydro-2H-pyran-2-yl)oxy)-1,4-dioxaspiro[4.5]decane (32). Dihydropyran (1.5 equiv) and PPTS (0.1 equiv) was added to a solution of 3136 (18.0 g, 1 equiv) in DCM (600 mL) at 0 °C with stirring. The resulting solution with stirring gradually warmed to RT over 16 h, then Et3N (1.0 mL) was added. A pale-yellow liquid (16.0 g) was isolated by column chromatography (EtOAc/hexane 1:19). The compound (1H NMR in Supporting Information) was used in the next step without further purification. E-4,4,5,5-Tetramethyl-2-(2-(8-((tetrahydro-2H-pyran-2-yl)oxy)1,4-dioxaspiro[4.5]decan-8-yl)vinyl)-1,3,2-dioxaborolane (33). To a solution of 32 (14.0 g, 1 equiv), 4,4,5,5-tetramethyl-[1,3,2]dioxaborolane (1.2 equiv), and Cp2ZrCl2H (0.15 equiv) cooled to 0

7.2), 8.10 (t, 1H, J = 7.8), 7.72 (d, 1H, J = 7.5), 7.59 (t, 2H, J = 7.8), 7.31−7.19 (m, 2H), 3.63 (br, 2H), 3.32 (br, 2H, overlap with H2O signal), 2.81 (br, 2H), 2.68 (br, 2H); 98.0% pure by LCMS-ES 308.36 [M + H]+. 4-(6-(Benzo[d]oxazol-2-yl)picolinoyl)piperazin-1-ium Chloride (18·HCl). Compound 16 (200 mg) was treated with methanolic HCl (6 mL) at 0 °C. The mixture was stirred and gradually warmed to RT over 3 h. Evaporating the solvent, then washing with pentane and Et2O gave of a light-brown solid (160 mg). 1H NMR (300 MHz, DMSO-d6), δ 9.30 (br, 2H), 8.45 (d, 1H, J = 8.1), 8.24 (t, 1H, J = 7.8), 7.94−7.84 (m, 3H), 7.57−7.45 (m, 2H), 3.95 (br, 2H), 3.79 (br, 2H), 3.26 (br, 2H), 3.18 (br, 2H); 98.1% pure by LCMS-ES 309.26 [M + H]+. (6-(Benzo[d]oxazol-2-yl)pyridin-2-yl) (piperazin-1-yl)methanone (18). Salt 18·HCl (25 mg) was neutralized with satd aq NaHCO3 followed by lyophilization to give a light-brown solid (20 mg). 1H NMR (300 MHz, DMSO-d6), δ 8.40 (d, 1H, J = 7.8), 8.18 (t, 1H, J = 7.8), 7.89 (t, 2H, J = 7.2), 7.78 (d, 1H, J = 7.5), 7.55−7.44 (m, 2H), 3.65 (br, 2H), 3.40 (br, 2H overlap with H2O signal), 2.84 (br, 2H), 2.72 (br, 2H); 98.7% pure by LCMS-ES 309.37 [M + H]+. (4-(6-(1H-Benzo[d]imidazol-2-yl)picolinoyl)piperazin-1-yl)(6(benzo[d]oxazol-2-yl)pyridin-2-yl)methanone (19). Acid 3 (4.0 g) in DMF (5 mL) was treated with EDCI (1.5 equiv), HOBt (1.5 equiv), DIPEA (3 equiv), and 18·HCl (5.1 g) at 0 °C. The mixture was stirred and gradually warmed to RT over 16 h. Dilution of the reaction mixture with ice-cold water gave a pale-brown solid. Filtration, drying, and washing with Et2O and pentane gave a beige solid (5.0 g). Combiflash chromatography (MeOH/DCM) on 4.8 g yielded off-white solid (3.6 g), mp 322.6−326.2 °C. 1H NMR (400 MHz, DMSO-d6), δ 12.94 (s, 0.5H), 12.92 (s, 0.5H), 8.48−8.33 (m, 2H), 8.28−8.06 (m, 2H), 7.95−7.69 (m, 5H), 7.54−7.46 (m, 2H), 7.42−7.18 (m, 3H), 3.90 (s, 2H), 3.82 (br, 2H), 3.76−3.52 (br, 4H); 99.9% pure by LCMS-ES 530.40 [M + H]+. Ethyl (E)-3-(2-(8-Hydroxy-1,4-dioxaspiro[4.5]decan-8-yl)vinyl)benzoate (22). A solution of 8-vinyl-1,4-dioxaspiro[4.5]decan-8-ol35 (20, 500 mg, 1 equiv), ethyl 3-iodobenzoate (21, 0.8 equiv), and PPh3 (0.02 equiv) in Et3N (8 mL) was degassed with argon for 10 min. Then, Pd(OAc)2 (0.02 equiv) was added and the mixture was again degassed for 10 min. The resulting reaction mixture was heated at 95 °C for 16 h. After workup, a pale-brown solid (500 mg) was isolated by column chromatography (EtOAc/hexane 3:7). 1H NMR (300 MHz, DMSO-d6), δ 7.95 (s 1H), 7.80 (d 1H, J = 7.2), 7.71 (d 1H, J = 8.4), 7.47 (t 1H, J = 7.8), 6.65 (d 1H, J = 16.2), 6.49 (d, 1H, J = 15.9), 4.65 (br 1H), 4.32 (q, 2H, J = 6.9), 3.87 (s, 4H), 1.99−1.65 (m, 4H), 1.64−1.48 (m, 4H), 1.33 (t 3H, J = 7.2); 95.1% pure by LCMS-ES 315.38 [M − OH]+. E-3-(2-(8-Hydroxy-1,4-dioxaspiro[4.5]decan-8-yl)vinyl)benzoic Acid (23). A solution of 22 (500 mg) in THF/H2O/EtOH (4:2:1, 17.5 mL) was cooled to 0 °C; LiOH (2.5 equiv) was added. The mixture was stirred while rising to RT over 16 h. Concentration of the mixture gave a yellow solid, which was dissolved in the minimum amount of water and then acidified with 1 N HCl to pH 3−4. Purification by column chromatography (EtOAc/hexane 7:3) gave a pale-yellow solid (220 mg). 1H NMR (300 MHz, DMSO-d6), δ 12.95 (br 1H), 7.95 (s 1H), 7.78 (d 1H, J = 7.5), 7.67 (d 1H, J = 7.5), 7.44 (t 1H, J = 8.1), 6.64 (d 1H, J = 15.9), 6.48 (d, 1H, J = 16.2), 4.65 (s 1H), 3.86 (s, 4H), 1.88−1.60 (m, 4H), 1.56−1.49 (m, 4H); 94.5% pure by LCMS-ES 287.34 [M − OH]+. E-3-(2-(1-Hydroxy-4-oxocyclohexyl)vinyl)benzoic Acid (24). In THF at 0 °C with stirring, 2 N HCl (1.5 mL) was added to 23 (100 mg). The mixture was stirred and gradually warmed to RT over 6 h. The solution was then concentrated, diluted with water, extracted with EtOAc, and reconcentrated to give a pale-yellow solid (20 mg), mp 148.5−150.2 °C. 1H NMR (300 MHz, DMSO-d6), δ 12.99 (bs 1H), 7.98 (s, 1H), 7.80 (d 1H, J = 7.5), 7.68 (d 1H, J = 7.8), 7.46 (t 1H, J = 7.5), 6.74 (d 1H, J = 16.2), 6.56 (d, 1H, J = 16.2), 6.10 (t, 1H), 5.13 (s 1H), 2.74−2.59 (m, 2H), 2.16 (br, 1H), 2.11 (br, 1H), 2.03− 1.84 (m, 4H); 99.4% pure by LCMS-ES 259.37 [M − H]− 519.48 [2M − H]−. 10122



Article

°C, Et3N (0.5 equiv) was slowly added at 0 °C with stirring. When completed, the solution was heated to 70 °C for 16 h. The reaction mixture was diluted with hexanes. The precipitate was removed by filtration over short pad of silica gel and washed with hexanes. Upon concentrating the hexanes solution, a colorless oily liquid formed. Purification by column chromatography (EtOAc/hexane 1:19) afforded a white solid (7.0 g). 1H NMR (300 MHz, CDCl3), δ 6.59 (d 1H, J = 18.6), 5.57 (d 1H, J = 18.6), 4.62 (br, 1H), 4.02−3.88 (m, 5H), 3.48−3.37 (m, 1H), 2.09−1.45 (14H), 1.27 (s, 12H). Methyl (E)-6-(2-(8-((Tetrahydro-2H-pyran-2-yl)oxy)-1,4dioxaspiro[4.5]decan-8-yl)vinyl)picolinate (34). A solution of 33 (500 mg, 1.1 equiv), methyl 6-bromopicolinate (1.0 equiv), and K2CO3 (2.0 equiv) in a mixture of DME/H2O 9:1 (8 mL) was degassed with argon for 10 min. Then, Pd[(P(Ph)3]4 (0.04 equiv) was added. The resulting reaction mixture was heated at 100 °C for 16 h. Concentration of the mixture followed by column chromatography (EtOAc/hexane 1:3) yielded a pale-yellow liquid (350 mg). The product (81.1% pure by LCMS-ES 404.39 [M + H]+, 302.26 [M − 101]+) was used without further purification. Methyl (E)-6-(2-(1-Hydroxy-4-oxocyclohexyl)vinyl)picolinate (35). To a solution of 34 (230 mg, 1.0 equiv) in acetone/H2O 1:1 (6 mL), TsOH (0.1 equiv) was added The resulting reaction mixture was stirred at RT over 16 h. Concentration of the mixture followed by column chromatography (EtOAc/hexane 7:3) gave a pale-yellow liquid (110 mg). 1H NMR (300 MHz, DMSO-d6), δ 7.98−7.84 (m 2H), 7.72 (d, 1H, J = 7.5), 6.98 (d 1H, J = 16.2), 6.80 (d 1H, J = 15.9), 5.24 (s, 1H), 3.89 (s, 3H), 2.75−2.61 (m, 2H), 2.16 (br, 1H), 2.11 (br, 1H), 2.07−1.86 (m, 4H); 97.1% pure by LCMS-ES 276.38 [M + H]+. (E)-6-(2-(1-Hydroxy-4-oxocyclohexyl)vinyl)picolinic Acid (36). To a solution of 35 (75 mg) in THF/H2O 3:1 (3 mL), LiOH (2.5 equiv) was added at 0 °C. The mixture was stirred and gradually warmed to RT over 6 h. The reaction mixture was acidified with citric acid and extracted with a mixture of THF and EtOAc. Concentrating the organic solution gave an off-white solid (10 mg); mp 163.8−165.1 °C. 1 H NMR (300 MHz, DMSO-d6), δ 13.08 (br, 1H), 7.96−7.84 (m, 2H), 7.67 (d, 1H, J = 7.2), 7.05 (d, 1H, J = 16.2), 6.80 (d, 1H, J = 15.6), 5.22 (s, 1H), 2.75−2.61 (m, 2H), 2.16 (br 1H), 2.12 (br 1H), 2.07−1.85 (4H); 97.9% pure by LCMS-ES 262.27 [M + H]+. (E)-4-(2-(8-((Tetrahydro-2H-pyran-2-yl)oxy)-1,4-dioxaspiro[4.5]decan-8-yl)vinyl)picolinic Acid (37). A solution of 33 (300 mg, 1.2 equiv), methyl 4-bromopicolinate (1.0 equiv), an K2CO3 (2.0 equiv) in mixture of DME/H2O 9:1 (5 mL) was degassed with argon for 10 min. Then, Pd[(P(Ph)3]4 (0.04 equiv) was added. The resulting mixture was stirred and heated at 90 °C for 12 h. Concentrating the solution followed by column chromatography (EtOAc/hexane 1:3) yielded a pale-yellow liquid (200 mg). The product (79.2% pure by LCMS-ES 390.35 [M + H]+ and 1H NMR in Supporting Information) was used without further purification. (E)-4-(2-(1-Hydroxy-4-oxocyclohexyl)vinyl)picolinic Acid (38). To a solution of 37 (200 mg, 1.0 equiv) in acetone/H2O 1:1 (6 mL), TsOH (0.1 equiv) was added. The resulting reaction mixture was stirred at RT for 48 h. The reaction mixture was acidified with citric acid and extracted with a mixture of THF and EtOAc. The solution was concentrated to give an off-white solid (18 mg). 1H NMR (300 MHz, DMSO-d6), δ 8.60 (d, 1H, J = 4.5), 8.07 (br, 1H), 7.64 (dd, 1H, J = 4.5, 1.5), 6.93 (d, 1H, J = 16.2), 6.76 (d, 1H, J = 15.9), 5.26 (br, 1H), 2.72−2.59 (m, 2H), 2.18 (br 1H), 2.13 (br 1H), 2.06−1.83 (4H); 99.0% pure by LCMS-ES 262.27 [M + H]+. Methyl (E)-2-(2-(8-((Tetrahydro-2H-pyran-2-yl)oxy)-1,4dioxaspiro[4.5]decan-8-yl)vinyl)isonicotinate (39). A solution of 33 (437 mg, 1.2 equiv), methyl 2-bromoisonicotinate (1.0 equiv), and K2CO3 (2.0 equiv) in a mixture of DME/H2O 9:1 (7 mL) was degassed with argon for 10 min. Then, Pd[(P(Ph)3]4 (0.05 equiv) was added and the reaction mixture was degassed with argon for 10 min. The reaction mixture was stirred and heated at 90 °C for 12 h. Concentrating the solution followed by column chromatography (EtOAc/hexane 1:3) yielded a pale-yellow liquid (300 mg). The product (72.6% pure by LCMS-ES 404.54 [M + H]+ and 302.53 [M − 101]+, 1H NMR in Supporting Information) was used without further purification.

Methyl (E)-2-(2-(1-Hydroxy-4-oxocyclohexyl)vinyl)isonicotinate (40). To a solution of 39 (300 mg, 1.0 equiv) in acetone/H2O 1:1 (6 mL), TsOH (0.1 equiv) was added. The resulting reaction mixture was stirred at RT over 48 h. Concentrating the mixture followed by column chromatography (EtOAc/hexane 7:3) gave an off-white solid (160 mg). The product (88.8% pure by LCMS-ES 276.22 [M + H]+ and 1H NMR in Supporting Information) was used without further purification. (E)-2-(2-(1-Hydroxy-4-oxocyclohexyl)vinyl)isonicotinic Acid (41). To a solution of 40 (100 mg) in THF/H2O 3:1 (3 mL), LiOH (2.5 equiv) was added at 0 °C with stirring. The mixture was stirred and gradually warmed to RT over 16 h. The reaction mixture was acidified with citric acid and extracted with mixture of THF and EtOAc. Concentrating the extract gave an off-white solid (20 mg). 1H NMR (300 MHz, DMSO-d6), δ 13.62 (br, 1H), 8.69 (d, 1H, J = 4.8), 7.84 (br, 1H), 7.60 (dd, 1H, J = 4.8, 1.5), 7.01 (d, 1H, J = 15.6), 6.83 (d, 1H, J = 15.6), 5.21 (s, 1H), 2.75−2.43 (m, 2H), 2.16 (br, 1H), 2.11 (br, 1H), 2.07−1.84 (m, 4H); 92.6% pure by LCMS-ES 262.28 [M + H]+. Surface Plasmon Resonance Studies. Direct binding between LANCL2 proteins and the analogues was measured by SPR on a Biacore T-200 instrument. Experiments were performed at the Biacore Molecular Interactions Shared Resource of Georgetown University, Washington, DC. All experiments were done at 25 °C. LANCL2 was immobilized on a CM4 chip by an amine coupling method (∼4000 RU). MOPS (25 mM MOPS, 150 mM NaCl, 1% DMSO, and 0.05% Tween 20, pH 6.5) buffer was used the running buffer. For example, 7 was injected over the protein-coated surface at 5 different concentrations (0, 1.25, 2.5, 5.0, 10, 20 μM) in triplicate. Each injection was 60 s with 300 s stabilization time. The experiment did not require any regeneration buffer. Double reference subtraction was performed by using an empty reference flow cell and buffer only injections over protein-coated surfaces. Data analysis was done by using steady state affinity model in BiaEvaluation software. Validation of Computational Modeling Methods. To undergo this process, the original MOL2/PDB file LANCL2 was obtained and MOL2/PDB files for the analogues were generated. With the most popular molecular docking software, AutoDock Vina, an analogue was manually docked against LANCL2 with the top 20 output files saved as a single PDBQT file and separated for analysis in the molecular viewer UCSF Chimera. All measures of docking were consistent with the “Vina Tutorial” provided online by The Scripps Research Institute, who created the software. Only the number of conformations (num_modes = 100) and the exhaustiveness (exhaustiveness = 16) were altered. The exhaustiveness was set to 16 in order to double the amount of time spent identifying the global minimum conformation. The first step was to initiate “blind” docking, in which the grid box where the docking event took place covered the entire protein. This experiment enabled analyses of the different cavities, where conformers might bind. The grid box dimension for blind docking represented a rectangular cuboid (74 Å × 68 Å × 60 Å) with grid points separated by 1.000 Å and centered at the middle of the protein (47.046x, 53.123y, 48.510z). The top 20 docked conformations from blind docking were then assessed to investigate how each pose made contact with specific residues. Mice. C57BL/6 were purchased from The Jackson Laboratory, LANCL2−/− were purchased from KOMP UC Davis, and both were housed under specific pathogen-free conditions in ventilated racks. WT versus LANCL2−/− have been characterized (Supporting Information, Figure S2). Briefly, to characterize and determine the absence of the lancl2 gene in LANCL2−/− mice, we performed PCR using the following primers: CSD-LacF (GCTACCATTACCAGTTGGTCTGGTGTC), CSD-NeoF (GGGATCTCATGCTGGAGTTCTTCG), CSD-loxF (GAGATGGCGCAACGCAATTAATG), CSD-Lancl2-R (CCTTTGTCCATTGTTCCTTCACTCCC), Lanc2-rrT (ATCAAGGAAAGGGAACAAAAGAAAAGC), and Lancl2-F (TGACCAAAAGGGGATAGTGTCAGGG). The mice were maintained in the animal facilities at Biotherapeutics. All experimental protocols were approved by the Institutional Animal Care and Use Committee and met or exceeded guidelines of the NIH 10123



Article

Office of Laboratory Animal Welfare and Public Health Service policy. Animals were under strict monitoring throughout the duration of the project; all efforts were made to minimize unnecessary pain and distress. Mice were euthanized by CO2 narcosis followed by secondary cervical dislocation. cAMP Expression Measurements. C57BL/6J strain WT and LANCL2−/− male mice, over 8 weeks, were sacrificed and spleens were collected for splenocytes isolation. Cells were incubated in plates previously precoated with antimouse CD28 (1 μg/mL, BD Pharmingen, catalogue no. 553295) and antimouse CD3 (5 μg/mL, BD Pharmingen, catalogue no. 557306) for cell stimulation. Media consisted of cRPMI supplemented with 7 at 0, 1.25, 2.5, 5, and 10 μM. There were four replicates for each treatment plus four negative controls (without stimulation). After 20 h of incubation, a second 10 min hit treatment was done with 7 following the same concentrations of the 20 h hit treatment. Then, cells were washed with 1× PBS and harvested into 0.1 M HCl/H2O. Cell lysates were collected and cAMP intracellular concentration was measured by using a Direct cAMP EIA kit (Enzo Life Sciences, catalogue no. ADI-900−066). DSS-Induced Colitis. Colitis was induced in C57BL/6J or LANCL2−/− mice by administration of DSS to the drinking water. Colonic inflammation was assessed 7 d after DSS treatment. Mice were treated by single dose (8 mg/kg/d) studies. Analogue 7 was administered daily through orogastric gavage (orally) starting on day 0 when the DSS challenge was initiated. Histopathology. Colonic sections from IBD studies in mice were fixed in 10% buffered neutral formalin, later embedded in paraffin and then sectioned (5 μm) and stained with H&E stain for histological examination. Colons were graded with a compounded histological score including the extent of (1) leukocyte infiltration, (2) mucosal thickening, and (3) epithelial cell erosion. The sections were graded with a score of 0−4 for each of the previous categories, and data were analyzed as a normalized compounded score. Immunophenotyping and Cytokine Analysis by Flow Cytometry. For fluorescent staining of immune cell subsets 4−6 × 105 cells were incubated for 20 min with fluorochrome-conjugated primary mouse specific antibodies: anti-CD3 PE-Cy5 clone 145-2C11 (eBioscience), anti-F4/80 PECy5 (eBiosciences), anti-CD4 PE-Cy7 clone GK1.5 (eBioscience), anti-CD4 APC clone RM4-5, and antiCD25 Biotin clone 7D4 (BD Biosciences). Cells were washed with FACS buffer (1× PBS supplemented with 5% FBS and 0.09% NaN3). For intracellular staining of transcription factors and cytokines, cells were fixed and permeabilized by using a commercial kit according to the manufacturer’s instructions (eBioscience). Briefly, cells were fixed and permeabilized for 20 min, Fc receptors were blocked with mouse anti-CD16/CD32 FcBlock (BD Biosciences), and cells were stained with fluorochrome-conjugated antibodies toward antimouse, FOXP3 FITC clone FJK-16s, antimouse ROR gamma (t) PE clone B2B, and antimouse IL17-A APC clone eBio17B7 (eBioscience). All samples were stored fixed at 4 °C in the dark until acquisition on a FACS Aria flow cytometer (BD Biosciences). A live cell gate (FSC-A, SSC-A) was applied to all samples followed by single cell gating (FSC-H, FSC-W) before cells were analyzed for the expression of specific markers. Data analysis was performed with FACS Diva (BD Biosciences) and Flow Jo (Tree Star Inc.). Quantitative Real-Time PCR. Total RNA was isolated from mouse colons by using a Qiagen RNA Isolation Mini Kit according to the manufacturer’s instructions. Total RNA (1 μg) was used to generate a cDNA template with an iScript cDNA Synthesis Kit (BioRad). The total reaction volume was 20 μL, with the reaction incubated as follows in an MJ MiniCycler: 5 min at 25 °C, 30 min at 52 °C, 5 min at 85 °C, and hold at 4 °C. PCR was performed on the cDNA with Taq DNA polymerase (Invitrogen). Each gene amplicon was purified with the MiniElute PCR Purification kit (Qiagen) and quantified both on an agarose gel by using a DNA mass ladder (Promega) and with a nanodrop. These purified amplicons were used to optimize real-time PCR conditions and to generate standard curves in the real-time PCR assay. Primers were designed by using Oligo 6 software. Primer concentrations and annealing temperatures were optimized for the iCycler iQ system (Bio-Rad) for each set of primers

using the system’s gradient protocol. PCR efficiencies were maintained between 92 and 105% and correlation coefficients >0.98 for each primer set during optimization and also during the real-time PCR of sample DNA. cDNA concentrations for genes of interest were examined by real-time qPCR with an iCycler IQ System and the iQ SYBR green supermix (Bio-Rad). A standard curve was generated for each gene by performing 10-fold dilutions of purified amplicons starting at 5 pg of cDNA and used later to calculate the starting amount of target cDNA in the unknown samples. SYBR green I, a general double-stranded DNA intercalating dye, may therefore detect nonspecific products and primer/dimers in addition to the amplicon of interest. To determine the number of products synthesized during the real-time PCR, each product underwent a melting curve analysis. Realtime PCR was used to measure the starting amount of nucleic acid of each unknown sample of cDNA on the same 96-well plate. Statistical Analysis. Parametric data were analyzed with the ANOVA followed by Scheffe’s multiple comparison method. Nonparametric data were analyzed by using the Mann−Whitney’s U test followed by a Dunn’s multiple comparisons test. ANOVA was performed by using the general linear model procedure of SAS, release 6.0.3 (SAS Institute). Statistical significance was assessed at a P ≤ 0.05.

■

ASSOCIATED CONTENT

* Supporting Information S

The Supporting Information is available free of charge on the ACS Publications website at DOI: 10.1021/acs.jmedchem.6b00412. Analogues used for in silico studies, general methods for synthesis, chromatograms, and spectra for new compounds; levels of 7 in colon and colonic contents; effect of oral 7 when compared to 7 rectal administration, and characterization of LANCL2−/− mice (PDF) Molecular formula strings (CSV)

■

AUTHOR INFORMATION

Corresponding Author

*Phone: 540-818-2844. E-mail: jbassaganya@ biotherapeuticsinc.com. ORCID

Josep Bassaganya-Riera: 0000-0003-2969-2197 Author Contributions

A.C. conducted analyses, designed and conducted experiments, performed experiments, wrote the manuscript; R.D.G. conducted analyses, designed the analogues, analyzed in silico studies, wrote the manuscript; R.H. designed, wrote the manuscript, and conducted experiments; N.P. conducted experiments; A.U. conducted experiments; J.B.R. directed studies, designed experiments, wrote the manuscript. Notes

The authors declare the following competing financial interest(s): The authors of this manuscript are either consultants or employees at Biotherapeutics Inc.

■

ACKNOWLEDGMENTS We thank Dr. Purushottam Tiwari for his technical support and the Biacore Molecular Interaction Shared Resource at the Lombardi Comprehensive Cancer Center, Georgetown University, which is supported by a grant P30 CA51008 from the NCI. We thank the NIH SBIR program (SBIR R43DK097940 and STTR R41DK099027) for funding. We thank the editors and reviewers for helpful comments. 10124



■

Article

(15) Bassaganya-Riera, J.; Gandour, R.; Carbo, A.; Cooper, J. Novel Lanthionine Synthetase C-like 2-based Therapeutics. US 62/068,322, 2015; US 2016/0115153 A1, April 28, 2016. (16) Carbo, A.; Hontecillas, R.; Cooper, J.; Gandour, R.; Ehrich, M.; Bassaganya-Riera, J. Lanthionine Synthetase C-like Receptor 2 (LANCL2): A Novel Therapeutic Target for Inflammatory Bowel Disease. Gastroenterology 2015, 148, S-686−S-687. (17) Carbo, A.; Hontecillas, R.; Philipson, C.; Gandour, R.; Bassaganya-Riera, J. BT-11: A Novel Lanthionine Synthetase C-like 2-Based Therapeutic for IBD. Gastroenterology 2016, 150, S155. (18) Bissel, P.; Boes, K.; Hinckley, J.; Jortner, B. S.; Magnin-Bissel, G.; Werre, S. R.; Ehrich, M.; Carbo, A.; Philipson, C.; Hontecillas, R.; Philipson, N.; Gandour, R. D.; Bassaganya-Riera, J. Exploratory Studies With BT-11: A Proposed Orally Active Therapeutic for Crohn’s Disease. Int. J. Toxicol. 2016, 35, 521−529. (19) Ehrich, M.; Bissel, P.; Boes, K.; Hinckley, J.; Jortner, B.; MagninBissel, G.; Werre, S. R.; Carbo, A.; Hontecillas, R.; Philipson, C.; Gandour, R. D.; Bassaganya-Riera, J. Safety Profile of BT-11: A Novel LANCL2-Based Therapeutic for Crohn’s Disease. Society of Toxicology 2016 Meeting, San Diego, March 13−17, 2016, 2016; Abstract PS 1659. (20) Vieth, M.; Siegel, M. G.; Higgs, R. E.; Watson, I. A.; Robertson, D. H.; Savin, K. A.; Durst, G. L.; Hipskind, P. A. Characteristic Physical Properties and Structural Fragments of Marketed Oral Drugs. J. Med. Chem. 2004, 47, 224−232. (21) Patel, R. V.; Park, S. W. An Evolving Role of Piperazine Moieties in Drug Design and Discovery. Mini-Rev. Med. Chem. 2013, 13, 1579− 1601. (22) Shaquiquzzaman, M.; Verma, G.; Marella, A.; Akhter, M.; Akhtar, W.; Khan, M. F.; Tasneem, S.; Alam, M. M. Piperazine Scaffold: A Remarkable Tool in Generation of Diverse Pharmacological Agents. Eur. J. Med. Chem. 2015, 102, 487−529. (23) Bassaganya-Riera, J.; Guri, A. J.; Lu, P.; Climent, M.; Carbo, A.; Sobral, B. W.; Horne, W. T.; Lewis, S. N.; Bevan, D. R.; Hontecillas, R. Abscisic Acid Regulates Inflammation via Ligand-binding Domainindependent Activation of Peroxisome Proliferator-activated Receptor gamma. J. Biol. Chem. 2011, 286, 2504−2516. (24) Frackenpohl, J. M.; Müller, T.; Heinemann, T. I.; Von KoskullDöring, P.; Rosinger, C. H.; Häuser-Hahn, I.; Hills, M. J. Substituted 5-(Cyclohex-2-en-1-yl)-penta-2,4-dienes and 5-(Cyclohex-2-en-1-yl)pent-2-en-4-ines as Active Agents against Abiotic Stress in Plants. US 2014/0087949 A1, 2015. (25) Avni, D.; Ernst, O.; Philosoph, A.; Zor, T. Role of CREB in Modulation of TNFα and IL-10 Expression in LPS-stimulated RAW264.7 Macrophages. Mol. Immunol. 2010, 47, 1396−1403. (26) Sinha, B.; Semmler, J.; Eisenhut, T.; Eigler, A.; Endres, S. Enhanced Tumor Necrosis Factor Suppression and Cyclic Adenosine Monophosphate Accumulation by Combination of Phosphodiesterase Inhibitors and Prostanoids. Eur. J. Immunol. 1995, 25, 147−153. (27) Endres, S.; Fulle, H. J.; Sinha, B.; Stoll, D.; Dinarello, C. A.; Gerzer, R.; Weber, P. C. Cyclic Nucleotides Differentially Regulate the Synthesis of Tumour Necrosis Factor-alpha and Interleukin-1 beta by Human Mononuclear Cells. Immunology 1991, 72, 56−60. (28) Eisenhut, T.; Sinha, B.; Grottrup-Wolfers, E.; Semmler, J.; Siess, W.; Endres, S. Prostacyclin Analogs Suppress the Synthesis of Tumor Necrosis Factor-alpha in LPS-stimulated Human Peripheral Blood Mononuclear Cells. Immunopharmacology 1993, 26, 259−264. (29) Semmler, J.; Wachtell, H.; Endres, S. The Specific Type IV Phosphodiesterase Inhibitor Rolipram Suppresses Tumor Necrosis Factor-alpha Production by Human Mononuclear Cells. Int. J. Immunopharmacol. 1993, 15, 409−413. (30) Eigler, A.; Siegmund, B.; Emmerich, U.; Baumann, K. H.; Hartmann, G.; Endres, S. Anti-inflammatory Activities of cAMPelevating Agents: Enhancement of IL-10 Synthesis and Concurrent Suppression of TNF Production. J. Leukoc. Biol. 1998, 63, 101−107. (31) Piguet, C.; Buenzli, J. C. G.; Bernardinelli, G.; Hopfgartner, G.; Williams, A. F. Self-assembly and Photophysical Properties of Lanthanide Dinuclear Triple-helical Complexes. J. Am. Chem. Soc. 1993, 115, 8197−8206.

ABBREVIATIONS USED ABA, abscisic acid; Cmax, maximal concentration; CREB, cAMPresponse element-binding protein; DSS, dextran sodium sulfate; GI, gastrointestinal; IBD, inflammatory bowel disease; IL, interleukin; LANCL2, lanthionine synthetase C-like 2; MoA, mechanism of action; NCEs, new chemical entities; SPR, surface plasmon resonance; UC, ulcerative colitis

■

REFERENCES

(1) Spunt, S.; Furman, W.; La Quaglia, M.; Bondy, M.; Goldberg, R. Cancer Epidemiology in Older Adolescents and Young Adults 15 to 29 Years of Age. SEER AYA Monograph; National Cancer Institute: Bethesda, MD, 2008; pp 123−133. (2) Stenson, W. F. Interleukin-4 Hyporesponsiveness in Inflammatory Bowel Disease: Immune Defect or Physiological Response? Gastroenterology 1995, 108, 284−286. (3) De Mattos, B. R. R.; Garcia, M. P. G.; Nogueira, J. B.; Paiatto, L. N.; Albuquerque, C. G.; Souza, C. L.; Fernandes, L. G. R.; Tamashiro, W. M. d. S.; Simioni, P. U. Inflammatory Bowel Disease: An Overview of Immune Mechanisms and Biological Treatments. Mediators Inflammation 2015, 2015, 493012. (4) Crocker, I. C.; Zhou, C. Y.; Bewtra, A. K.; Kreutner, W.; Townley, R. G. Glucocorticosteroids Inhibit Leukotriene Production. Ann. Allergy, Asthma, Immunol. 1997, 78, 497−505. (5) D’Haens, G. R.; Sartor, R. B.; Silverberg, M. S.; Petersson, J.; Rutgeerts, P. Future Directions in Inflammatory Bowel Disease Management. J. Crohns Colitis 2014, 8, 726−734. (6) Lu, P.; Hontecillas, R.; Philipson, C. W.; Bassaganya-Riera, J. Lanthionine Synthetase Component C-like Protein 2: A New Drug Target for Inflammatory Diseases and Diabetes. Curr. Drug Targets 2014, 15, 565−572. (7) Sturla, L.; Fresia, C.; Guida, L.; Bruzzone, S.; Scarfi, S.; Usai, C.; Fruscione, F.; Magnone, M.; Millo, E.; Basile, G.; Grozio, A.; Jacchetti, E.; Allegretti, M.; De Flora, A.; Zocchi, E. LANCL2 is Necessary for Abscisic Acid Binding and Signaling in Human Granulocytes and in Rat Insulinoma Cells. J. Biol. Chem. 2009, 284, 28045−28057. (8) Bruzzone, S.; Magnone, M.; Mannino, E.; Sociali, G.; Sturla, L.; Fresia, C.; Booz, V.; Emionite, L.; De Flora, A.; Zocchi, E. Abscisic Acid Stimulates Glucagon-Like Peptide-1 Secretion from L-Cells and its Oral Administration Increases Plasma Glucagon-Like Peptide-1 Levels in Rats. PLoS One 2015, 10, e0140588. (9) Bruzzone, S.; Moreschi, I.; Usai, C.; Guida, L.; Damonte, G.; Salis, A.; Scarfi, S.; Millo, E.; De Flora, A.; Zocchi, E. Abscisic Acid is an Endogenous Cytokine in Human Granulocytes with Cyclic ADPRibose as Second Messenger. Proc. Natl. Acad. Sci. U. S. A. 2007, 104, 5759−5764. (10) Guri, A. J.; Evans, N. P.; Hontecillas, R.; Bassaganya-Riera, J. T cell PPARgamma is Required for the Anti-inflammatory Efficacy of Abscisic Acid against Experimental IBD. J. Nutr. Biochem. 2011, 22, 812−819. (11) Guri, A. J.; Hontecillas, R.; Bassaganya-Riera, J. Abscisic Acid Ameliorates Experimental IBD by Downregulating Cellular Adhesion Molecule Expression and Suppressing Immune Cell Infiltration. Clin. Nutr. 2010, 29, 824−831. (12) Guri, A. J.; Hontecillas, R.; Si, H.; Liu, D.; Bassaganya-Riera, J. Dietary Abscisic Acid Ameliorates Glucose Tolerance and Obesityrelated Inflammation in db/db Mice Fed High-fat Diets. Clin. Nutr. 2007, 26, 107−116. (13) Lu, P.; Bevan, D. R.; Lewis, S. N.; Hontecillas, R.; BassaganyaRiera, J. Molecular Modeling of Lanthionine Synthetase Component C-like 2: a Potential Target for the Discovery of Novel type 2 Diabetes Prophylactics and Therapeutics. J. Mol. Model. 2011, 17, 543−553. (14) Lu, P.; Hontecillas, R.; Horne, W. T.; Carbo, A.; Viladomiu, M.; Pedragosa, M.; Bevan, D. R.; Lewis, S. N.; Bassaganya-Riera, J. Computational Modeling-based Discovery of Novel Classes of Antiinflammatory Drugs that Target Lanthionine Synthetase C-like Protein 2. PLoS One 2012, 7, e34643. 10125



Article

(32) Shavaleev, N. M.; Scopelliti, R.; Gumy, F.; Bünzli, J.-C. G. Benzothiazole- and Benzoxazole-Substituted Pyridine-2-Carboxylates as Efficient Sensitizers of Europium Luminescence. Inorg. Chem. 2009, 48, 6178−6191. (33) Keurulainen, L.; Salin, O.; Siiskonen, A.; Kern, J. M.; Alvesalo, J.; Kiuru, P.; Maass, M.; Yli-Kauhaluoma, J.; Vuorela, P. Design and Synthesis of 2-Arylbenzimidazoles and Evaluation of Their Inhibitory Effect against Chlamydia pneumoniae. J. Med. Chem. 2010, 53, 7664− 7674. (34) Bystrov, V. F.; Belaya, Z. N.; Gruz, B. E.; Syrova, G. P.; Tolmachev, A. I.; Shulezhko, L. M.; Yagupol’skii, L. M. Reactivity Constants of Some 2-hetaryls. Zh. Obshch. Khim. 1968, 38, 1001− 1005. (35) Quin, L. D.; MacDiarmid, J. E. Synthesis of Hexahydrophosphindole Oxides with Oxygen Functions at C-6. J. Org. Chem. 1981, 46, 461−464. (36) Magnus, P.; Carter, P. A. A Model for the Proposed Mechanism of Action of the Potent Antitumor Antibiotic Esperamicin A1. J. Am. Chem. Soc. 1988, 110, 1626−1628.

10126


An N,N-Bis(benzimidazolylpicolinoyl)piperazine (BT-11): A Novel

Recommend Documents