Analysis of Host-Inducing Proteome Changes in Bifidobacterium

Analysis of Host-Inducing Proteome Changes in Bifidobacterium longum NCC2705 Grown in Vivo Jing Yuan,#,† Bin Wang,#,| Zhongke Sun,‡ Xin Bo,‡ Xitong Yuan,† Xiang He,† Hongqing Zhao,† Xinying Du,† Fang Wang,† Zheng Jiang,† Ling Zhang,† Leili Jia,† Yufei Wang,† KaiHua Wei,§ Jie Wang,§ Xuemin Zhang,§ Yansong Sun,† Liuyu Huang,*,† and Ming Zeng*,| Institute of Disease Control and Prevention, Academy of Military Medical Sciences, Beijing, China, College of Food Science and Engineering, Northwest Sci-Tech University of Agriculture and Forestry, Yangling, China, National Center of Biomedical Analysis, Beijing, China, and National Institute for the Control of Pharmaceutical and Biological Products, Beijing, China Received August 02, 2007

To investigate the molecular mechanisms underlying the adaptation of Bifidobacterium longum to the intestinal tract, we utilized a new model for rabbit intestinal culture of B. longum and reported the changes in proteomic profiles after incubation in the in vivo environment. By 2D-PAGE coupled with matrix-assisted laser desorption ionization time-of-flight mass spectrometry (MALDI-TOF-MS) and/or electrospray ionization tandem mass spectrometry (ESI-MS/MS) analyses, proteomic profiles of B. longum strain NCC2705 grown in the in vivo and in vitro environments were compared. Confirmed by semiquantitative RT-PCR, which exhibited at least a 3-fold change or greater, 19 up-regulated proteins, 14 down-regulated proteins, and 4 proteins with mobility changes were identified during intestinal growth. These identified proteins include key stress proteins, metabolism-related proteins, and proteins related to translation. Our results indicate that some useful proteins are expressed at higher levels in cells during intestinal growth. These proteins reflected the adaptation of B. longum NCC2705 to the intestine, such as EF-Tu which contributes to the retention or attachment as a Bifidobacterium adhesinlike factor, bile salt hydrolase (BSH) which might play an important role in the molecular mechanisms for the initial interaction of probiotic with the intestinal environment, and stress proteins which defend B. longum against the action of bile salts and other harmful ingredients of the gastrointestinal tract (GIT). The most striking fact of our observation was that four proteins GlnA1, PurC, LuxS, and Pgk exhibit clear post-translational modification. Western blot (WB) analysis and Pro-Q Diamond staining revealed that substances of the GIT trigger Pgk and LuxS phosphorylation at Ser/Thr residues for bacteria grown in vivo. These proteins were identified for the first time as bifidobacterial phosphoproteins. Our data suggest that the phosphorylated autoinducer-2 production protein LuxS of B. longum NCC2705 (LuxS-P) is the active form of LuxS and that LuxS-P may play a key role in the regulation of quorum sensing. Keywords: B. longum strain NCC2705 • comparative proteomics • rabbit intestinal culture • Western blot analysis • Pro-Q Diamond Stain • phosphoprotein

Introduction Bifidobacteria are the predominant commensal bacteria in the intestinal microflora and exert various health benefits in humans. By liberating lactic and acetic acids, Bifidobacteria * Corresponding authors. Prof. Liuyu Huang, Institute of Disease Control and Prevention, Academy of Military Medical Sciences, 109 Xiaotun Road, Fengtai District, Beijing, 100071. Dr. Ming Zeng, National Institute for the Control of Pharmaceutical and Biological Products, 2 Tiantanxili, Beijing, 100050. Tel: +86-10-66933356. Fax: +86-10-66933356 or +86-10-52203301. E-mail: [email protected]; [email protected]. # These authors contributed equally to this work. † Academy of Military Medical Sciences. | National Institute for the Control of Pharmaceutical and Biological Products. ‡ Northwest Sci-Tech University of Agriculture and Forestry. § National Center of Biomedical Analysis. 10.1021/pr0704940 CCC: $40.75

 2008 American Chemical Society

prevent the colonization of potential bacterial pathogens in the colon, thereby maintaining a balance of normal intestinal flora.1 Clinical and animal studies have provided evidence that certain strains of Bifidobacterium animalis (lactis), Bifidobacterium longum, Bifidobacterium infantis, and Bifidobacterium breve may be beneficial to the prevention and/or treatment of gastroenteritis, necrotizing enterocolitis, and chronic intestinal inflammation.2 The complex homeostasis between intestinal probiotics and the host is an intriguing immunological paradox as the normal mucosal immune system acquires tolerance (hyporesponsiveness) to the enteric microbiota, while protective cell-mediated and humoral immune responses to enteropathogens are maintained.3,4 Bifidobacteria comprise up to 90% of all bacteria in faecal samples of breast-fed infants and 3–5% Journal of Proteome Research 2008, 7, 375–385 375 Published on Web 11/21/2007

research articles of the adult faecal microflora by fluorescent in situ hybridization (FISH).2,5 While the bacterial composition and the pattern of bacterial colonization in the premature neonatal or infant gastrointestinal tract (GIT) are different from that found in the adult intestine, Bifidobacteria undoubtedly constitute one of the predominant species of the human colonic and faecal microflora. Studies in the animal model have shown that association of germ-free rabbits with Bifidobacteria species has a profound impact on the anatomical, physiological, and immunological development of the host, including that on epithelial cell functions.3,4 Although human beings are in contact with components of this microflora from their birth, it is not well understood how resident bacteria shape our physiology. However, the molecular mechanisms underlying the protective effects of probiotic Bifidobacteria in the GIT are unclear. Bifidobacteria are Gram-positive, obligate anaerobic bacteria in the Actinomycetales branch of the high-G+C microorganisms. The genome of the B. longum strain NCC2705 has been sequenced recently [gi:23464628, containing 1727 open reading frames (ORFs)] according to the National Center for Biotechnology Information (NCBI). Under stress conditions, Bifidobacteria activate the synthesis of proteins such as molecular chaperones and proteases to maintain their viability, which enables these bacteria to promote the health of the host. Although the annotated genome sequences of B. longum NCC2705 suggest a number of physiological traits that may partially explain the successful adaptation and survival of Bifidobacteria in the GIT,7 the functional information about the proteins encoded by the B. longum genome is needed to achieve a comprehensive understanding of the mechanisms involved in their survival under stress conditions. Recently, Bifidobacteria have been studied for their potential use in secreting proteins of biotechnological interest, as well as for the delivery of pharmacologically active substances. These studies will benefit from a detailed understanding of how the proteome relates to Bifidobacterium physiology. In a previous study, we compiled the first proteomic reference map for the important probiotic organism B. longum NCC2705. A total of 708 spots representing 369 protein entries were identified by matrix-assisted laser desorption ionization timeof-flight mass spectrometry (MALDI-TOF-MS) and/or electrospray ionization tandem mass spectrometry (ESI-MS/MS)8 (available at www.mpiib-berlin.mpg.de/2D-PAGE and www. proteomics.cn). In the present study, we took advantage of a new model for rabbit intestinal culture of the B. longum NCC2705 to investigate protein changes that result from the bacteria being exposed to the harsh environment of the intestine.

Experimental Details Strains, Medium, and in Vitro Growth Condition. B. longum strain NCC2705 (kindly provided by Nestle Research Center, Lausanne, Switzerland) was grown anaerobically at 37 °C in 400 mL of De Man-Rogosa-Sharpe (MRS) broth9 containing 0.05% L-cysteine or modified Garches medium prepared in the laboratory as previously described by Caescu.10 Anaerobic conditions were achieved using anaerobic jars supplemented with Anaerocult N. In Vivo/in Vitro Culture Assay by a Rabbit Intestinal Model. The in vivo/in vitro culture assay was performed according to Niesel and colleagues11 with major modifications. Stationary cultures of B. longum NCC2705 cells were diluted 376

Journal of Proteome Research • Vol. 7, No. 01, 2008

Yuan et al. 1:50 in MRS and grown to an OD600 of 0.9 corresponding to 1.5 × 108 colony forming units/mL. The bacterial culture was washed twice with prewarmed RPMI. An amount of 20 mL of bacterial culture was placed in dialysis tubing with a molecular weight cutoff of 20 000 Da (for interchange of the smaller host signal proteins/molecules in the intestine). The tubing containing the B. longum culture was either incubated in vitro for four hours at 37 °C or implanted in a rabbit intestine. After the rabbits were anesthetized, the B. longum NCC2705 culture prepared as described above was implanted aseptically within the large intestine through a 1 cm incision, then the incision was closed using surgical staples. The rabbit generally became ambulatory within 4 h. The dialysis bag containing the B. longum culture was incubated for 4 h, after which B. longum was harvested. The cells were centrifuged for 10 min at 8000g in a Sigma 3K12 centrifuge (Sigma, St. Louis, MO, USA), and washed 4 times with 40 mL ice-cold low-salt washing buffer (3 mM KCl, 1.5 mM KH2PO4, 68 mM NaCl, 9 mM NaH2PO4).8 The experiment was performed at least six times. Preparation of Whole Cells Protein Extract. Cell pellets were resuspended in 5 mL of lysis buffer (7 M urea, 2 M thiourea, 4% (w/v) CHAPS and 50 mM DTT) containing complete protease inhibitors (Roche Diagnostics, Mannheim, Germany). The cells were lysed by sonication for 10 min (cycles of 2 s of sonication followed by a 2 s rest) on ice with a Sonifier 750 (Branson Ultrasonics Corp., Danbury, CT, USA) set at a 20% duty cycle. After adding 2.5 mg of RNase A and 100 units of RQ1 DNase, the cell lysate was incubated for 1 h at 15 °C to solubilize proteins and then centrifuged for 20 min at 20 000g to pellet the insoluble components. The supernatant was collected, and protein concentration was measured by the PlusOne 2-D Quant Kit (GE Healthcare Life Sciences, Uppsala, Sweden). The resulting samples were stored at -70 °C in 1 mg aliquots. Two-Dimensional Polyacrylamide Gel Electrophoresis. Isoelectric focusing (IEF), the first step of the two-dimensional electrophoresis, was carried out as described previously8 using immobilized pH gradient (IPG) strips in three pH ranges (pH 3–10, nonlinear/linear, 18 cm; pH 4–7 and pH 4.5–5.5, linear, 18 cm; Amersham Pharmacia Biotech, Sweden). IEF was conducted at 20 °C for 60 000 Vhrs in the IPGphor system (GE Healthcare Life Sciences), after which the samples were further separated by vertical slab sodium dodecylsulfate-polyacrylamide gel electrophoresis (SDS-PAGE) (12.5% gel, run for about 4 h at 30 mA/gel) using Bio-Rad protean II Xi (Bio-Rad Laboratories, Hercules, CA, USA). The gels were stained with Coomassie brilliant blue G-250 (Amresco, Solon, OH, USA), then scanned with ImageScanner (GE Healthcare Life Sciences). Image analysis was carried out with ImageMaster 2D Elite version 5.0 software. The relative volume of each spot was obtained by determining the spot intensity in pixel units and normalizing that value to the sum of the intensities of all the spots of the gel. Proteins were considered differentially expressed if their relative volume deviated more than 3-fold. Each experiment was performed at least three times. In-Gel Protein Digestion. The Coomassie-stained protein spots were excised, and the protein was digested as previously described.12 Briefly, the Coomassie-stained protein spots were cut out of the gel and destained with three incubations in 50 µL of 25 mM ammonium bicarbonate/50% acetonitrile (ACN) for 30 min at room temperature. The destained gel pieces were completely dried in a Speedvac vacuum concentrator (Savant Instruments, Farmingdale, NY, USA). The samples were res-

research articles

Host-Inducing Proteome Changes in Bifidobacterium longum olubilized in 3 µL of 25 mM ammonium bicarbonate containing 10 ng of trypsin at 4 °C for 1 h. After 12 h incubation at 37 °C, the gels were dried in a high vacuum centrifuge to evaporate solvent. Then, the samples were incubated with 8 µL of 5% trifluoroacetic acid (TFA) at 37 °C for 1 h to extract the protein sample. The supernatant was transferred to the microtube containing the supernatant from the TFA extraction. Finally, 8 µL of 100% ACN was used for extraction of hydrophobic peptides. This final supernatant was combined with the two previous supernatants, dried in the Speedvac vacuum concentrator, and resolubilized with 2 µL of 0.5% TFA. MALDI-TOF-MS and Protein Identification. MALDI-TOFMS measurements were performed on a Bruker Reflex III MALDI-TOF-MS (Bruker Daltonik GmbH, Bremen, Germany) working in reflectron mode, on which a 337 nm wavelength nitrogen laser (model LSI 337i, Bruker) was equipped. The mass range of peptides was detected from 800 to 4500 Da. Mass accuracy for MALDI-TOF-MS is typically 50 ppm, and the resolution is 12 000. External calibration was applied to the instrument using Bruker PepMix including angiotensin II (m/z 1046.5418), angiotensin I (m/z 1296.6848), substance P (m/z 1347.7354), bombesin (m/z 1619.8223), ACTH Clip 18–39 (m/z 2465.1983), and somatostatin 28 (m/z 3147.4710), and internal calibration was carried out using enzyme autolysis peaks. The matrix was a saturated solution of R-cyano-4hydroxycinnamic acid in 50% acetonitrile and 0.1% TFA. A mixture of 2 µL of the matrix solution and sample solution with a 1:1 (v/v) ratio was mixed and applied onto the Score384 target well. The following parameters in MALDI-MS analysis were used: 20 kV accelerating voltage and 23 kV reflecting voltage. PeakClean software (http://www.proteomics.com.cn/tools/PkClean/) was used to remove contaminant peaks including matrix peaks, solvent peaks, and enzyme autolysis peaks. All peaks at first were automatically labeled by FlexAnalysis v2.0 (Bruker) with the Centriod peak-picking algorithm, S/N more than 10, relative peak intensity more than 1%. Then, all peak annotations were checked manually to prevent any nonmonoisotopic peak labeling. The mascot search engine uses mass spectrometry data to identify proteins from primary sequence databases as previously described.8 Peptide mass fingerprinting (PMF) searches were performed by using the program Mascot v1.7.02 developed by Matrix Science Ltd. (http:\\www.matrixscience.com) licensed in-house (http://www.proteomics.cn). Monoisotopic peptide masses were used to search the databases, allowing a peptide mass accuracy of 100 ppm (300 ppm in some cases) and one partial cleavage. Mass tolerance was ( 0.2 Da peptide. Oxidation of methionine and carboxyamidomethylation of cysteine were considered in the process. For protein identification by PMF, peptide masses were searched against a local protein database of B. longum NCC2705 (licensed in-house, v 050126, 1727 sequences) using Mascot software, as well as against the NCBI nonredundant protein databases (with free access on the Internet, NCBInr v050623, 2 564 994 sequences of all bacteria). We did not identify any protein with more than one name and one accession number in the above databases. Thresholds refer to significant p values (p < 0.05) of Mascot results. For unambiguous identification of proteins, more than five peptides must be matched and the sequence coverage must be greater than 15%. Nanospray ESI MS/MS. The peptide solution collected after in-gel protein digestion was dried, reconstituted in 30 µL of 0.1% TFA in 30% acetonitrile/water, and then desalted with

Table 1. Oligonucleotides Used for Gene Expression Analysis (RT-PCR) oligonucleotide

nucleotide sequence (5′f3′)

fusA primer 1 fusA primer 2 clpP2 primer 1 clpP2 primer 2 tkt primer 1 tkt primer 2 tuf primer 1 tuf primer 2 tal primer 1 tal primer 2 bsh primer 1 bsh primer 2 gpm primer 1 gpm primer 2 16S rDNA primer 1 16S rDNA primer 2

GGAGCGCTCCCTGCGTGTGCTCG GGAAGCTGCCCCGAAGGCCAAG GGCAAGTGAAGAAGCAAAGTTCG GGACGAGGTGTTGGAACACCGCCT GACCGAATTCAAGGAGACCGAGC GGCTCGCGTCGTGTCCGTGCCGTC CAGAAAAAGAACATTACG TCAAGGATTTCAGTAACTTGACC GACCTCATCGCCAACAAGAACG ACGTCAGACAGCACGGAATCC GTGCACTGGTGTCCGTTTCTCCG GGAGCTCATCAGCGTCGCCCG GGGCGCACGCGGCTGTAGAC GCCGCTCAGGGCCAGAAGTG TCCAGTTGATCGCATGGTCa GGGAAGCCGTATCTCTACGAa

a Primer specific to sequences within 16S rDNA of B. longum and designed to a produce a cDNA of 831 bp.

ZipTip C18 pipet tips (Millipore, Bedford, MA, USA). ESI-MS/ MS was carried out with a hybrid quadrupole orthogonal acceleration tandem mass spectrometer (Q-TOF2) (Micromass, Manchester, UK). The capillary voltage in MS and MS/MS experiments was set to an average of 900 V, with the sample cone set to 30 V. A microchannel plate detector (MCP) was applied with 2200 V. The collision gas was argon at a pressure of 0.1 MPa, and the collision energy was 50 V. Glufibrinopeptide was used to calibrate the instrument in the MS/MS mode, and internal calibration was carried out using enzyme autolysis peaks. MS/MS peak lists were created by MaxEnt3 (MassLynx v3.5, Micromass, Manchester, UK), and amino acid sequences were interpreted manually using MassSeq (Micromass, Manchester, UK). Every spectrum was processed by MaxEnt3 for deconvolution. Gene Expression Analysis by Semiquantitative RT-PCR. Selected differentially expressed genes were further evaluated by semiquantitative reverse transcription-PCR (RT-PCR) analysis.12 Total RNAs were extracted from B. longum NCC2705 cultures in vivo or in vitro by using the EPICENTRE MasterPureTM RNA Purification kit (Epicenter Technologies, Madison, WI). The RNA concentrations were determined by spectrophotometry at 260 nm. The PCR amplication reaction was performed using an Omniscript Reverse Transcription kit (Qiagen) with 2 µg of total RNA as the template, under the following conditions: 94 °C for 5 min followed by 25–30 cycles at 94 °C for 1 min, 55–70 °C for 1 min, and 72 °C for 1 min; and then 1 cycle of 72 °C for 5 min to complete the reaction. Specific target RT-PCR products were normalized to an established endogenous internal control transcript, a primer pair designed to amplify a fragment of 831 bp from the B. longum 16S rDNA (16S rDNA) transcript,13 the expression of which is relatively constant in bacteria. The primers used for RT-PCR assays listed in Table 1 were designed to generate PCR products of comparable sizes. Negative controls consisted of PCRs performed without each of the two sets of primers, reverse transcriptase, and Taq polymerase (Promega) to confirm the absence of contaminating DNA in the RNA preparations. The results were Journal of Proteome Research • Vol. 7, No. 01, 2008 377

research articles

Yuan et al.

Figure 1. Two-dimensional gel electrophoresis patterns of the whole cell proteins of B. longum grown intestinally (A) and in vitro (B). The identified spots were labeled on the integrated 2-DE map of pH 4–7 and pH 4.4–5.5 and identified by MALDI-TOF MS and/or ESIMS/MS analysis.

analyzed with Quantity One quantitation software (Bio-Rad) as described previously.14 Phosphorylation Analysis of Proteins with Mobility Changes by Western Blot and Pro-Q Diamond Stain. Square sections of 2.0 cm × 2.0 cm of 2-D gels containing spots that 378


represent proteins with mobility changes were cut out, and the proteins were transferred from gel to a PVDF membrane (0.45 µm; Milipore) on a Trans-blot SD (Bio-Rad). The membranes were blocked by 5% defatted milk powder in TBST (0.05% Tween 20, 125 mM NaCl, 25 mM Tris-Cl, pH 7.4). Immunoblot

Host-Inducing Proteome Changes in Bifidobacterium longum

Figure 2. Confirmation of differentially expressed proteins by semiquantitative RT-PCR analysis of partial interesting gene transcripts. The expression of 16S rDNA was used as an internal control for equal loading. (A) Comparison of the protein synthesis pattern of B. longum NCC2705 cultivated in vivo (V) or in vitro (T) (zoomed in sections from gel shown in Figure 1). (B) Primers specific for genes of interest and 16S rDNA were used to amplify fragments by RT-PCR.

analysis was performed with horseradish peroxidase (HRP) conjugated antibodies that recognize phosphorylated threonine, tyrosine, or serine residues (all from Upstate Biotechnology). The antigen–antibody complexes were visualized by chemiluminescence (Perkin-Elmer Life Sciences). In addition, gels in which there were spots with altered mobility were stained with Pro-Q Diamond phosphoprotein gel stain (Molecular Probes, Eugene, OR) according to the manufacturer’s protocol. These gels were visualized using the Typhoon Ty9410 scanner (GE Healthcare Life Sciences). Phosphopeptides and phosphorylation sites were searched against the PHOSIDA database (www.phosida.com) of Bacillus subtilis.15,16 Codon Adaptation Index and Grand Average Hydropathicity. The codon adaptation index (CAI) of all ORFs identified of B. longum NCC2705 was generated by the software CodonW17 in two steps. First, a correspondence analysis (COA) of the codon usage of all ORFs identified was performed, and 1% of the total genes were used for calculating the ω values. Then, the CAI values were calculated by software CodonW using those ω values. The same software was used for the calculation of the grand average hydropathicity (GRAVY) of each protein as described previously.18 Statistical Analysis. Each experiment was performed at least three times. Statistical significance was determined using a Student’s t-test.

Results and Discussion Two-Dimensional Gel Analysis of Differentially Expressed Proteins in the in Vivo/in Vitro Culture Assay Using a Rabbit Intestinal Model. To identify possible genes expressed during intestinal growth, B. longum NCC2705 was grown either in vitro or intestinally, and protein expression was analyzed by 2D-PAGE (Figure 1). The expression patterns of the cultures

research articles

grown in vitro were very similar to those grown in the rabbit intestines, and many landmark spots have counterparts. Assessing the quantitative differences in relative volume by image analysis revealed a total of 96 spots whose expression was altered in the intestinal culture, including 38 spots that exhibited a change of 3-fold or greater (Figure 1). To confirm the results from the comparative proteomics experiments, total RNA was isolated from B. longum cultures and probed for expression of genes which encode the proteins that displayed at least a 3-fold change in volume by RT-PCR. Specific target RT-PCR products were normalized to the internal control 16S rDNA transcript, the expression of which is relatively constant in bacteria. The comparisons provided a semiquantitative estimate of the expression levels of these genes. As depicted in Figure 2A and B, the RT-PCR data generally confirmed both the up- and down-regulation in the transcriptional level of genes of interest in cells grown in vivo, as seen in the image analysis of the 2-D gels. All of the 38 spots representing 33 proteins were identified by MALDI-TOF and/or ESI-MS/MS mass spectrometry (see Supporting Information). These proteins (19 up-regulated and 14 down-regulated proteins) included: (1) key stress proteins such as chaperone, the trigger factor chaperone protein, and the ATP-dependent Clp protease proteolytic subunit 2; (2) metabolism-related proteins, especially those related to the bifid shunt pathway, indicating that they likely are necessary for sustenance during in vivo growth; (3) proteins related to translation, such as elongation factor Tu and elongation factor G, which comprise a significant number of the identified proteins; (4) transcriptional regulators such as autoinducer-2 production protein LuxS; and (5) some hypothetical proteins, which could be positive modulators to adaptation to the GIT. The prediction of the cellular localizations of 33 identified proteins was conducted using PSORT version 2.0 (www.psort. org). The majority of proteins identified was predicted to localize in the cytoplasm. The codon adaptation index (CAI) of B. longum NCC2705 proteins ranged from 0.0681 to 0.795. According to this, all the identified proteins had a CAI above 0.6 and, therefore, were probably highly abundant proteins, such as translation elongation factor Tu. All the identified proteins possessed a negative grand average of hydropathicity (GRAVY),18 indicating that they are hydrophilic proteins. Information on all identified proteins was listed in Tables 2 and 3. A striking observation was the up-regulation of choloylglycine hydrolase (also called bile salt hydrolase, BSH, BL0796, EC 3.5.1.24) in cells grown in vivo compared with those grown in vitro. In addition, the sequence YFGR in an amino acid motif, XYFGRNLDX, which was highly conserved within all BSHs reported in Bifidobacteria, was identified by ESI-MS/MS in this work (Table 3 and Figure 3). The crystal structure of BSH reported from B. longum reveals that it is a member of the N-terminal nucleophil hydrolase structural superfamily possessing the characteristic RββR tetralamellar tertiary structure arrangement, with a subunit molecular weight of 35 024 Da.19 BSH catalyzes the hydrolysis of glycine- and/or taurineconjugated bile salts into amino acid residues and deconjugated bile salts (bile acids). It likely plays a role in utilizing the liberated amino acids or increasing resistance to the toxic levels of bile salts in the GIT. Bile salts are also considered important regulators of gene expression in the liver and intestine.20 High BSH activity in probiotic cultures could be beneficial due to their potential to reduce serum cholesterol. We postulate that Journal of Proteome Research • Vol. 7, No. 01, 2008 379

380

locus

BL0009 BL0002 BL1097 BL1097 BL0401 BL1097 BL0059 BL1098 BL1455 BL0944

BL1623 BL0986

BL1623 BL0947 BL1152 BL0716 BL0140

BL0352 BL1097 BL0715 BL1394 BL0715 BL0796

BL0121 BL0121 BL0274 BL0401 BL0735 BL0794 BL0978 BL1049

BL1152 BL1300

BL1386 BL1422 BL1656 BL1684 BL1800

spot no.

1 2 3 4 5 6 7 8 10 11

16 23

24 25 26 27 29


30 31 32 33 34 35

13 14 T3 T10 T8 20 22 T15

T16 T4

T18 18 T2 21 T9

gi|23465947 gi|23465980 gi|23466203 gi|23466232 gi|23466344

gi|23465718 gi|23465861

gi|23464747 gi|23464747 gi|23464876 gi|23464999 gi|23465313 gi|23465370 gi|23465547 gi|23465616

gi|23464951 gi|23465666 gi|23465295 gi|23465954 gi|23465295 gi|23465372

gi|23466172 gi|23465520 gi|23465718 gi|23465296 gi|23464760

gi|23466172 gi|23465555

gi|23464637 gi|23464630 gi|23465666 gi|23465666 gi|23464999 gi|23465666 gi|23464686 gi|23465667 gi|23466011 gi|23465517

NCBI GI identifier

E E G H F

T E

D D G J F F G G

++ J G J G M

G O T G G

G T

T O J J J J ++ J O O

COG

theor. mass

peptides matched

95 102 220 150 223 152

145 117 94 66 119

145 155

11 12 20 13 16 12

10 11 7 6 10

10 16

Intestinal Growth 223 16 192 16 168 14 136 11 161 15 160 12 117 14 234 28 163 15 131 11

score

5 23 7 6 4

25 12

5 5 7 7 5 9 10 14

17 4 16 6 5 4

2 5 11 5 20

2 18

5 6 6 8 7 4 11 15 13 4

peptides not matched

Proteins Down-Regulated during Intestinal Growth hypothetical protein BL0121 50596 201 17 hypothetical protein BL0121 50596 188 15 probable sugar kinase 59005 84 9 possible acetyltransferase 38322 161 15 PurH 58377 169 15 aspartate carbamoyltransferase 36145 194 18 LacZ 114378 72 11 conserved hypothetical protein with possible 37336 81 11 phosphatase function autoinducer-2 production protein LuxS 15643 55 7 phosphoribosylformimino-5-aminoimidazole 25788 129 12 carboxamide ribotide isomerase DppA2 59024 143 11 anthranilate phosphoribosyltransferase 1 36015 111 14 phosphoglycerate mutase 28817 226 16 dihydropteroate synthase 1 30520 147 14 adenylosuccinate lyase 53708 156 11

Proteins Up-Regulated during hypothetical protein BL0009 34522 chaperone 56803 elongation factor Tu 43909 elongation factor Tu 43909 possible acetyltransferase 38322 elongation factor Tu 43909 narrowly conserved hypothetical protein 40822 elongation factor G 78087 hypothetical protein BL1455 51878 ATP-dependent Clp protease proteolytic 25869 subunit 2 probable ribose 5-phosphate isomerase 25253 conserved hypothetical protein with a 29189 response regulator receiver domain probable ribose 5-phosphate isomerase 25253 trigger factor chaperone 49611 autoinducer-2 production protein LuxS 15643 transketolase 75868 hypothetical protein in PgaM 23624 phosphoglycerate mutase family hypothetical protein BL0352 36634 elongation factor Tu 43909 transaldolase 39682 conserved hypothetical protein with duf90 47731 transaldolase 39682 choloylglycine hydrolase 35102

protein description

Table 2. Differentially Regulated B. longum NCC2705 Proteins (>3-Fold) Identified by PMFa,b,c

32 45 72 54 44

66 51

48 45 20 46 44 58 30 32

41 28 57 40 57 50

35 31 74 24 74

35 56

71 44 41 49 56 44 45 45 31 32

sequence coverage%

5 5 5.8 5.19 5.33

5.29 4.77

4.66 4.66 5.02 5.03 5.36 5.17 4.86 4.56

5.38 4.88 4.87 4.82 4.87 4.71

4.83 4.43 5.29 4.97 5.44

4.83 4.85

5.39 4.72 4.88 4.88 5.03 4.88 5.06 4.83 6.11 5.11

theor. pI

CW U U C C

C C

E E C C C C C C

U C C C C C

C C C C C

C C

C C C C C C C C C C

location*

dppA2 trpD gpm folP purB

hisA

purH pyrB lacZ

tal

tuf tal

tkt

tig

clpP2

fusA

tuf

groEL tuf tuf

gene

69.547 38.461 28.88 29.365 54.796

18.984 25.916

64.601 64.601 68.845 58.667 65.904 37.375 70.859 41.827

34.833 60.792 55.664 57.672 55.664 46.727

28.44 41.7 18.984 85.848 26.508

28.44 37.136

36.397 70.738 60.792 60.398 58.667 53.528 48.558 92.413 30.19 26.641

exptlMW (kd)

5 5.12 5.33 5.31 5.35

5.11 4.75

4.59 4.61 5.09 4.95 5.43 5.29 5.13 4.56

4.91 4.99 4.86 5.9 4.86 4.78

4.84 4.74 5.11 5 5.67

4.84 4.89

5.76 4.76 4.99 4.97 4.95 4.94 5.17 4.83 4.9 4.85

exptl pI

research articles Yuan et al.

E F gi|23465645 gi|23465675 BL1076 BL1107 T6/T7 9/15

a The scores greater than 45 are significant (p < 0.05). b Abbreviation of cellular role categories. Categories were taken from the TIGR-CMR (www.tigr.org), and the abbreviation was used to mark the categories. J, Translation; A, RNA processing and modification; K, Transcription; L, Replication, recombination, and repair; D, Cell cycle control, mitosis, and meiosis; V, Defense mechanisms; T, Signal transduction mechanisms; M, Cell wall/membrane biogenesis; N, Cell motility; U, Intracellular trafficking and secretion; O, Post-translational modification, protein turnover, chaperones; C, Energy production and conversion; G, Carbohydrate transport and metabolism; E, Amino acid transport and metabolism; F, Nucleotide transport and metabolism; H, Coenzyme transport and metabolism; I, Lipid transport and metabolism; P, Inorganic ion transport and metabolism; Q, Secondary metabolites biosynthesis, transport, and catabolism; R, General function prediction only; S, Function unknown; -, not in COGs. c Abbreviation of cellular locations. Protein cellular location was annotated by psort v.2.0 (www.psort.org). C, cytoplasmic; CM, cytoplasmic membrane; E, extracellular; U, unknown. U**, this protein may have multiple localization sites.

4.84 4.85 66.124 30.093 glnA1 purC C C 4.81 4.85 48/30 57/36

4.86 5.11 52.95 18.984 pgk C C 5.22 5.29 57/33 74/66

Proteins Phosphorylated with Difference in Position phosphoglycerate kinase 46545 65/98 9/7 4/2 autoinducer-2 production 15643 91/81 7/7 11/25 protein LuxS glutamine synthetase 1 53206 219/75 16/13 6/43 phosphoribosylaminoimidazole28374 164/164 11/11 5/5 succinocarboxamidesynthase G T BL0707 BL1152 36/37 T16/26

gi|23465287 gi|23465718

locus spot no.

Table 2. Continued

NCBI GI identifier

COG

protein description

theor. mass

score

peptides matched

peptides not matched

sequence coverage%

theor. pI

location*

gene

exptlMW (kd)

exptl pI


research articles

BSH expression might have been induced by bile salts in the GIT when B. longum NCC2705 was deposited in the rabbit intestine. If so, BSH would play an important role in the initial interaction of probiotic B. longum with the intestinal environment. Also of interest was the increased expression (more than 5-fold) of elongation factor Tu (EF-Tu; BL1097) during intestinal growth (Figure 2A,B). Four isoforms with different charges were identified by MALDI-TOF (see Table 2), which might be a result of post-translational proteolytic processing and modification. EF-Tu is a guanosine nucleotide binding protein that plays a central role in protein synthesis in the cytoplasm. Interestingly, recent evidence suggests that EF-Tu is a novel surface protein possessing the characteristics of an adhesion factor21–23 and that it is able to induce a proinflammatory response.24 We suggest that EF-Tu expression is up-regulated during intestinal growth to promote adhesion of Bifidobacterium in the GIT. Three stress proteins involved in protein folding, assembly, and degradation [GroEL (BL0002), trigger factor chaperone (BL0947, Tig), and ATP-dependent Clp protease proteolytic subunit 2 (BL0944, ClpP2)] showed increased synthesis during growth in vivo. These extensively studied proteins are induced by salt stress, mild acid treatment, and UV irradiation in B. longum NCC2705 and were identified as highly abundant proteins in the present study. Controlled degradation of cytoplasmic proteins has long been considered essential for survival of bacteria under conditions of stress, due to the requirement for efficient removal of misfolded or otherwise damaged proteins.25,26 In the GIT, Bifidobacteria must defend themselves against the action of bile salts and other harmful agents to retain viability, so they may promote survival by increasing the levels of stress proteins. Moreover, Bifidobacteria are reported to possess only one route for the metabolism of glucose, the fructose-6-phosphate phosphoketolase (F6PPK, or bifid shunt) pathway.27,28 Three of nine enzymes of the bifid shunt were expressed at higher levels during intestinal growth in this study, including transaldolase (BL0715, spot 32, EC 2.2.1.2), transketolase (BL0716, spot 19, EC 2.2.1.1), and a probable ribose 5-phosphate isomerase (BL1623, spot 16, EC 5.3.1.6). It is noteworthy that the expression of phosphoglycerate mutase (BL1656, spot T3, EC 5.4.2.1), which is involved in the fermentation of nondigestible dietary carbohydrates, and carbohydrate hydrolyzing enzyme LacZ (BL0978, spot 22) also increased under in vivo culture. Bifidobacteria colonize the lower GIT, an environment poor in monoand disaccharides because they are consumed by the host and microflora in the upper GIT. As previous studies suggested, B. longum instead metabolizes a variety of plant-derived dietary fibers.6,29 Our results confirmed that proteins involved in the bifid shunt pathway and glycosyl hydrolases are up-regulated significantly in the intestinal environment, suggesting that B. longum NCC2705 can take full advantage of these enzymes to minimize crossfeeding of competitors. This likely helps B. longum compete for uptake of structurally diverse oligosaccharides released from the plant. Proteins with Mobility Changes. Proteomic analysis allows a global examination of post-translational modifications, many of which are manifested in changes of charge or molecular weight. In this experiment, eight spots representing four proteins, glutamine synthetase 1 (BL1076, GlnA1), phosphoribosylaminoimidazole-succinocarboxamide synthase (BL1107, PurC), autoinducer-2 production protein LuxS (BL1152, LuxS), and phosphoglycerate kinase (BL0707, Pgk), showed clear changes of position, which might result from post-translational Journal of Proteome Research • Vol. 7, No. 01, 2008 381

research articles

Yuan et al.

Table 3. Proteins Identified by ESI-MS/MS spot NCBInr no. accession no.

locus

protein description

sequence matched coverage % peptide no.

T6

gi|23465645 BL1076 glutamine synthetase 1

10

4

32

gi|23465295 BL0715 transaldolase

18

5

2

gi|23464630 BL0002 chaperone

5

2

T2

gi|23466203 BL1656 phosphoglycerate mutase

54

9

35

gi|23465372 BL0796 choloylglycine hydrolase

24

6

peptide sequence

DGKPLFYDEK LVPGFEAPVNLVYSAR IPLAGTSPAAK LSPTPLEYELYFHI IESGSLQDLIANK NVVGVTTNPSIFQK ALSQVGPYDAQLK EIAEATDFVDGR DVTDKLEADGVAAFIK VGAATEVEAK AAIEEGLLPGGGVALVQAAAK TVLIAAHGNSLR MLDNLSEEEIAK AINTANIALDAADR NVLPDIVFTSLLR VKPYFESAIEPELK YAGDPVPEAECLANVVER GEYLDPEAAAAGAAAVAAQGQK TNQFTGWVDVPLTEQGEAEAK LWIPVQR FSDDEGNTYFGR NFDSVDEVEEALR MGDGQFER TLFTSGYSSK TNTYYMNTYDDPAIR SYAMADYDMDSSELISVAR

a Percentage of identity between the amino acids present in MS/MS tag and the sequences in databases. < 0.05); total score is the sum of every ion score.

proteolytic processing or other modifications. In comparison with in vitro culture, the following spot pairs had different pI values in intestinal cultures: spot pair 36/37, Pgk (BL0707), which appeared in the relatively acidic region, and two proteins (such as spot pair T6/T7, GlnA1, BL1076, and spot pair 9/15, PurC, BL1107) which appeared in the alkaline region (Figure 4A). Changes in position of these proteins might result from either the cleavage of acidic regions or alkaline regions or phosphorylation. Unfortunately, we failed to find any data to support phosphorylation residue from either PMF or ESI-MS/ MS. Protein phosphorylation is a reversible post-translational modification (PTM) that has tremendous regulatory and signaling potential.30 While protein phosphorylation on the hydroxyl group of the side chains of serine, threonine, and tyrosine for signal transduction cascades is well-established as a key regulatory post-translational modification in eukaryotes, little is known about its extent and function in prokaryotes. Interestingly, a recent study of Gram-positive and Gram-negative bacteria has shown phosphorylation of a number of proteins, including certain biosynthetic and metabolic enzymes. Signaling via serine, threonine, and/or tyrosine phosphorylation is often implicated in the regulation of bacterial virulence31,32 and, in some cases, interferes with eukaryotic signal transduction, thereby rendering the host more prone to infection and microbial adhesion.33,34 To determine whether the changes in protein mobility reflect protein phosphorylation, Pro-Q Diamond Staining of proteins with differences in position were performed. We detected that BL0707 and BL1152, two of four proteins, underwent phosphorylation in the samples incubated in the rabbit intestine. To further determine their phosphorylation sites, Western blot analysis was performed using antibodies against phosphorylated serine, threonine, and tyrosine 382


b

total scoreb % identifya delta

206

452

118 773

486

100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100

0.01

0.09

0.1 0.09

0.06

Ion scores greater than 44 are significant (p

(P-Ser, P-Thr, and P-Tyr, respectively). Both Pgk and LuxS were phosphorylated on serine and threonine residues (Figure 4B). This is the first time these proteins have been identified as bifidobacterial phosphoproteins. Macek and colleagues employed a gel-free approach to obtain a site specific, in vivo phosphoproteome of B. subtilis.15 Detailed information on identified phosphopeptides can be accessed in the PHOSIDA database (www.phosida.com). They identified two phosphorylation sites in B. subtilis Pgk: serine183 of the sequence DVLGKAVSNPDRPFT and the threonine299 of the sequence AIDIGTKTRETYADV. After analyzing for homology to sequences in GenBank using the Basic Local Alignment Search Tool (BLAST) available on the NCBI Web site, the Pgk sequence from B. longum NCC2705 is very similar to that from B. subtilis (up to 54% identical residues). Interestingly, Pgk from B. longum has both a threonine phosphorylation site (residue 225, in the sequence EKEVKALSKATENPERPFT, which has homology to the serine residue phosphorylation site in B. subtilis) and a serine phosphorylation site (residue 345, in the sequence GLDIGPESQKLFHDKIVDSK, which has homology to the threonine phosphorylation site in B. subtilis). Despite the difference in residues, we believe the similarities in phosphorylation sites between these two bifidobacterial proteins suggest a similarity in mechanism, namely that Pgk in B. longum may become phosphorylated to form the phosphoenzyme intermediate. Surprisingly, two isoforms, differing in charge, of LuxS (spots 26 and T16, BL1152) were identified by MALDI-TOF and ESIMS/MS, with spot 26 showing increased abundance and spot T16 showing decreased abundance in vivo compared to in vitro culture (Figure 4A). Although we found that LuxS was phosphorylated on both serine and threonine residues, it has neither a phosphorylation motif nor a matchable phosphorpeptide in the PHOSIDA database of B. subtilis. Therefore, further func-


research articles

Figure 3. Identification of the choloylglycine hydrolase protein (BL0796) in B. longum NCC2705 by mass spectrometry. (A) Mass spectrum of the tryptic digest of spot 35, along with peptide mass fingerprinting results identifying the protein as BSH. § indicates the modification of oxidation at a Met residue. (B) Nano-ESI-MS/MS spectrum of the peptide at m/z 1407.51, confirming the sequence of the BSH peptide.

tional studies will be needed to confirm the exact amino acid residues undergoing phosphorylation. LuxS is the synthetase for a recently identified extracellular quorum sensing and communication molecule, AI-2. AI-2, which is found in the growth medium of LuxS-positive bacteria, can induce the AI-2 reporter species.35 LuxS and its product AI-2 may mediate interactions among bacteria of different genera. The LuxS/AI2-dependent quorum sensing (QS) system controls a variety of cellular processes, such as production of pathogenicity factors, toxin production, biofilm formation, and swarming motility.36–43 In recent years, it has been suggested that the LuxS/AI-2 system may be more involved in cell metabolism than in QS signaling in enteric bacteria. Winzer and colleagues have proposed that AI-2 may be toxic to the cell during exponential growth and is internalized at a later stage of growth during which controlled amounts can be degraded.44 It remains unclear whether the primary role of AI-2 and LuxS in enteric bacteria is metabolism or regulating gene expression by

monitoring cell population density as well as a method of interspecies communication.45 Thus far, LuxS/AI-2-dependent QS has been studied in diverse Gram-positive and Gram-negative bacteria.35,40 However, the presence of an AI-2-dependent activity and the impact of phosphorylated LuxS on the regulation of quorum sensing in B. longum NCC2705 have not yet been reported. In addition, no record of phosphorylated LuxS exists previously. The possibility that the LuxS/AI-2-dependent QS exerts a profound influence on the social behavior and developmental potential in B. longum is intriguing. We postulate that phosphorylated LuxS of B. longum NCC2705 is the active form, and LuxS-P plays a key role in the regulation of QS. LuxS phosphorylation may represent a mechanism that enteric bacteria have evolved to interfere with the signaling capabilities of neighboring species of bacteria. The greatest density of signaling molecules AI-2 occurs at high bacterial densities, and the largest population of bacterial species in the human body occurs in the Journal of Proteome Research • Vol. 7, No. 01, 2008 383

research articles

Yuan et al. Moreover, we failed to demonstrate that GlnA (BL1076) and PurC (BL1107) were phosphorylated. Of course, not all posttranslational modifications involve phosphorylation. GlnA, which catalyzes the amination of glutamic acid to form glutamine, has several known post-translational modifications. While adenylation of GlnA leads to inhibition of its enzymatic activity, oxidation and carbonylation have been associated with increased stability of the enzyme during cellular stress and aging.47 Our MALDI-TOF and ESI-MS/MS data did not suggest whether the protein in spot T7 represents a modified GlnA protein. Interestingly, Tanaka and colleagues revealed that bsh (choloylglycine hydrolase) is part of an operon containing at least two genes, bsh and glnE, glutamine synthetase adenylyltransferase, which is downstream of bsh in the operon.48 Therefore, bsh could be transcriptionally coupled to glnE. In the present work, BSH showed a 3.5-fold up-regulation in cells grown in rabbit intestines, so we have deduced that BSH upregulation could result in post-translational modification of GlnA by GlnE.

Conclusion The ability of Bifidobacterium species to survive and persist in a competitive environment is correlated with particular genetic features. Although Bifidobacteria have been studied for over a century, the limitation of genetic tools and uniformity among studies has prevented a comprehensive and coherent view of their biosynthetic capabilities. Our comparative proteome analysis of B. longum NCC2705 by a new rabbit model extends previous studies about the physiological characteristics and supports the hypothesis formulated by Schell and colleagues regarding the adaptation to the human gastrointestinal tract.6 More importantly, our data confirmed the expression of some proteins related to their habitat.

Figure 4. Proteins with altered mobility were tested for phosphorylation. (A) Close-up view of the 2-D gels (V: B. longum NCC2705 cultivated in vivo; T: B. longum NCC2705 cultivated in vitro). (B) Pro-Q Diamond Stain (upper) and Western blot analysis (lower) of BL0707 and BL1152 phosphorylated in response to incubation in vivo.

gastrointestinal tract. Many other commensal and enteric pathogens are also capable of producing AI-2.46 We propose that at first B. longum may use these signals to recognize its presence within a host when large numbers of bacteria are present in the GIT. Furthermore, B. longum could respond to the presence of competitor bacteria by sequestering and destroying AI-2 produced by these other bacteria, thereby eliminating the competitors’ intercellular communication capabilities. On the other hand, when B. longum NCC2705 first enters the intestines, it may detect the high concentration of autoinducers and regulate some genes accordingly, with the activated LuxS-P producing its own autoinducers. This may be advantageous to B. longum because it could increase the expression of some metabolic genes required to propagate to a high cell density quickly. Once metabolism increases, the liberated lactic and acetic acids for protective effects of probiotic Bifidobacteria in the gut would improve, which in turn prevents the colonization of potential pathogens. 384


In the present paper, we use a new model for rabbit intestinal culture of B. longum strain NCC2705 and report changes in gene expression after in vivo incubation. Our results showed that the expression of some useful proteins related to important physiological processes was up-regulated in cells during intestinal growth. These proteins, such as BSH, and EF-Tu reflect the adaptation of B. longum NCC2705. Our most striking observation was that four proteins, GlnA1, PurC, LuxS, and Pgk, showed clear post-translational modification. Western blot analysis and Pro-Q Diamond Stain revealed that survival in the GIT triggers Pgk and LuxS phosphorylation at Ser/Thr residues. These proteins are identified for the first time as bifidobacterial phosphoproteins. In conclusion, we demonstrated that many proteins involved in host interactions were differentially regulated to trigger innate signal regulation, adhesion factors, and metabolic gene expression when probiotic bacteria were introduced into the intestinal environment. This response may enable B. longum to adapt and exert its protective effects in the host.

Acknowledgment. We thank Nestle Research Center for kindly providing B. longum strain NCC2705 and helpful information. We are grateful to Peter R. Jungblut for advice on compiling this paper for technical assistance and helpful discussions. This work was supported by a grant from the National Natural Science Foundation of China (30771809) to Jing Yuan and a grant from the National Natural Science Foundation of China (30770028) to Ming Zeng.

research articles


Supporting Information Available: Zip files to support reported data. This material is available free of charge via the Internet at http://pubs.acs.org. References (1) Ishibashi, N.; Yamazaki, S. Probiotics and safety. Am. J. Clin. Nutr. 2001, 73, 465S–470S. (2) Bezkorovainy, A. Probiotics: determinants of survival and growth in the gut. Am. J. Clin. Nutr. 2001, 73, 399S–405S. (3) Sheil, B.; MacSharry, J.; O’Callaghan, L. Role of interleukin (IL-10) in probiotic-mediated immune modulation: an assessment in wildtype and IL-10 knock-out mice. Clin. Exp. Immunol. 2006, 144 (2), 273–280. (4) Gagnon, M.; Kheadr, E. E.; Le, B. G.; Fliss, I. In vitro inhibition of Escherichia coli O157:H7 by bifidobacterial strains of human origin. Int. J. Food Microbiol. 2004, 92, 69–78. (5) Riedel, C. U.; Foata, F.; Goldstein, D. R. Interaction of Bifidobacteria with Caco-2 cells-adhesion and impact on expression profiles. Int. J. Food Microbiol., 1 2006, 110 (1), 62–68. (6) Schell, M. A.; Karmirantzou, M.; Snel, B. The genome sequence of Bifidobacterium longum reflects its adaptation to the human gastrointestinal tract. Proc. Natl. Acad. Sci. U.S.A 2002, 99, 14422– 14427. (7) Savijoki, K.; Suokko, A.; Palva, A. Effect of heat-shock and bile salts on protein synthesis of Bifidobacterium longum revealed by [35S]methionine labeling and two-dimensional gel electrophoresis. FEMS Microbiol. Lett. 2005, 248, 207–215. (8) Jing, Y.; Li, Z.; Xiankai, L.; Ting, L.; et al. A Proteome Reference Map and Proteomics Analysis of Bifidobacterium longum NCC2705. Mol. Cell. Proteomics. 2006, 5 (6), 1105–1118. (9) De Man, J.; Rogosa, M.; Sharp, M. A medium for the cultivation of lactobacilli. J. Appl. Bacteriol. 1960, 23, 130–135. (10) Caescu, C. I.; Vidal, O.; Krzewinski, F.; Artenie, V.; Bouquelet, S. Bifidobacterium longum requires a fructokinase (Frk; ATP:Dfructose 6-phosphotransferase, EC 2.7.1.4) for fructose catabolism. J. Bacteriol. 2004, 186, 6515–6525. (11) Robb, C. W.; Orihuela, C. J.; Ekkelenkamp, M. B.; Niesel, D. W. Identification and characterization of an in vivo trgulated D15/ Oma87 homologue in Shigella flexneri using differential display polymerase chain reaction. Gene 2001, 262, 169–177. (12) Gorg, A.; Weiss, W.; Dunn, M. J. Current two-dimensional electrophoresis technology for proteomics. Proteomics 2004, 4, 3665– 3685. (13) Matsuki, T.; Watanabe, K.; Tanaka, R.; Fukuda, M.; Oyaizu, H. Distribution of bifidobacterial species in human intestinal microflora examined with 16S rRNA-gene-targeted species-specific primers. Appl. Environ. Microbiol. 1999, 65, 4506–4512. (14) Desjardin, L. E.; Hayes, L. G.; Sohaskey, C. D.; Wayne, L. G.; Eisenach, K. D. Microaerophilic induction of the Crystallin chaperone protein homologue (hspX) mRNA of Mycobacterium tuberculosis. J. Bacteriol. 2001, 183, 5311–5316. (15) Macek, B.; Mijakovic, I.; Olsen J. V.; Gnad, F.; Kumar, C. et al. The Serine/Threonine/Tyrosine phosphoproteome of the model bacterium Bacillus subtilis. M600464-MCP200 2007. (16) Olsen, J. V.; Blagoev, B.; Gnad, F.; Macek, B.; Kumar, C.; Mortensen, P.; Mann, M. Global, in-vivo and site-specific phosphorylation dynamics of signaling networks. Cell 2006, 127, 635–648. (17) Comeron, J. M.; Aguade, M. An evaluation of measures of synonymous codon usage bias. J. Mol. Evol 1998, 47, 268–274. (18) Drews, O.; Reil, G.; Parlar, H.; Gorg, A. Setting up standards and a reference map for the alkaline proteome of the Gram-positive bacterium Lactococcus lactis. Proteomics 2004, 4, 1293–1304. (19) Kim, G. B.; Yi, S. H.; Lee, B. H. Purification and Characterization of Three Different Types of Bile Salt Hydrolases from Bifidobacterium Strains. J. Dairy Sci 2004, 87, 258–266. (20) Kumar, R. S.; Brannigan, J. A.; Prabhune, A. A.; Pundle, A. V. Structural and functional analysis of a conjugated bile salt hydrolase from Bifidobacterium longum reveals an evolutionary relationship with penicillin V acylase. J. Biol. Chem. 2006, 281 (43), 32516–32525. (21) Nakamura, J.; Ito, D.; Nagai, K.; Umehara, Y.; Hamachi, M.; Kumagai, C. Rapid and sensitive detection of hiochi bacteria by amplification of hiochi bacterial common antigen gene by PCR method and characterization of the antigen. J. Ferment. Bioeng. 1997, 83, 161–167. (22) Marques, M. A.; Chitale, S.; Brennan, P. J.; Pessolani, M. C. Mapping and identification of the major cell wall-associated components of Mycobacterium leprae. Infect. Immun. 1998, 66, 2625–2631. (23) Dallo, S. F.; Kannan, T. R.; Blaylock, M. W.; Baseman, J. B. Elongation factor Tu and E1 subunit of pyruvate dehydrogenase

(24)

(25) (26) (27) (28) (29) (30) (31) (32) (33) (34)

(35) (36) (37) (38) (39) (40) (41)

(42)

(43) (44) (45) (46) (47)

(48)

complex act as fibronectin binding proteins in Mycoplasma pneumoniae. Mol. Microbiol. 2002, 46, 1041–1051. Granato, D.; Bergonzelli, G. E.; Pridmore, R. D. Cell surfaceassociated elongation factor Tu mediates the attachment of Lactobacillus johnsonii NCC533 (La1) to human intestinal cells and mucins. Infect. Immun. 2004, 72 (4), 2160–2169. Gottesman, S.; Wickner, S.; Maurizi, M. R. Protein quality control: triage by chaperones and proteases. Genes Dev. 1997, 11, 815– 823. Dieter, W.; Nadine, Q.; Mathias, D.; Regine, H. A. Global role for ClpP-containing proteases in stationary-phase adaptation of Escherichia coli. J. Bacteriol. 2003, 185 (1), 115–125. Veerkamp, J. H. Catabolism of glucose and derivatives of 2-deoxy2-amino-glucose in Bifidobacterium bifidum var. pennsylvanicus. Arch. Biochem. Biophys. 1969, 129, 257–263. de, V. W.; Gerbrandy, S. J.; Stouthamer, A. H. Carbohydrate metabolism in Bifidobacterium bifidum. Biochim. Biophys. Acta 1967, 136, 415–425. Crociani, F.; Alessandrini, A.; Mucci, M. M.; Biavati, B. Degradation of complex carbohydrates by Bifidobacterium spp. Int. J. Food Microbiol. 1994, 24, 199–210. Pawson, T.; Scott, J. D. Protein phosphorylation in signaling--50 years and counting. Trends Biochem. Sci. 2005, 30, 286–290. Cozzone, A. J. Role of protein phosphorylation on serine/threonine and tyrosine in the virulence of bacterial pathogens. J. Mol. Microbiol. Biotechnol. 2005, 9, 198–213. ¨ ttner, K.; Biran, D.; Hecker, M. Highly Rosen, R.; Becher, D.; BU phosphorylated bacterial proteins. Protemics 2004, 4, 3068–3077. Hatakeyama, M.; Higashi, H. Helicobacter pylori CagA: a new paradigm for bacterial carcinogenesis. Cancer Sci. 2005, 96, 835– 843. Selbach, M.; Moese, S.; Hurwitz, R.; Hauck, C. R.; Meyer, T. F.; Backert, S. The Helicobacter pylori CagA protein induces cortactin dephosphorylation and Actin rearrangement by c-Src inactivation. Embo J. 2003, 22, 515–528. Waters, C. M.; Bassler, B. L. Quorum sensing: cell to cell communication in bacteria. Annu. Rev. Cell Dev. Biol. 2005, 21, 319– 346. Joyce, E. A. LuxS is required for persistent pneumococcal carriage and expression of virulence and biosynthesis genes. Infect. Immun. 2004, 72, 2964–2975. Kim, S. Regulation of Vibrio vulnificus virulence by the LuxS quorum-sensing system. Mol. Microbiol. 2003, 48, 1647–1664. Merritt, J.; Kreth, J.; Shi, W.; Qi, F. LuxS control bacteriocin production in Streptococcus mutants through a novel regulatory component. Mol. Microbiol. 2005, 57, 960–969. Xavier, K. B.; Bassler, B. L. Regulation of uptake and processing of the quorum-sensing autoinducer AI-2 in Escherichia coli. J. Bacteriol. 2005, 187, 238–248. Vendeville, A.; Winzer, K.; Heurlier, K.; Tang, C. M.; Hardie, K. R. Making “sense” of metabolism: autoinducer-2, LuxS and pathogenic bacteria. Nat. Rev. Microbiol. 2005, 3, 383–396. Sun, J.; Daniel, R.; Wagner-Dobler, I.; Zeng, A.-P. Is autoinducer-2 a universal signal for interspecies communication: a comparative genomic and phylogenetic analysis of the synthesis and signal transduction pathways. BMC Evol. Biol. 2004, 4, 36. Miller, S. T.; Xavier, K. B.; Campagna, S. R.; Taga, M. E.; Semmelhack, M. F. et al. A novel form of the bacterial quorum sensing signal AI-2 recognized by Salmonella typhimurium receptor LsrB. Mol. Cell 2004, 15, 677–687. Taga, M. E.; Miller, S. T.; Bassler, B. L. Lsr-mediated transport and processing of AI-2 in Salmonella typhimurium. Mol. Microbiol. 2003, 50, 1411–1427. Winzer, K.; Hardie, K. R.; Williams, P. Bacterial cell-to-cell communication: sorry, can’t talk now—gone to lunch! Curr. Opin. Microbiol. 2002, 5, 216–222. Li, J.; Wang, L.; Hashimoto, Y.; Tsao, C. Y. A stochastic model of Escherichia coli AI-2 quorum signal circuit reveals alternative synthesis pathways. Mol. Syst. Biol. 2006, 1–16. Walters, M.; Sircili, M. P.; Sperandio, V. AI-3 synthesis is not dependent on luxS in Escherichia coli. J. Bacteriol. 2006, 188 (16), 5668–5881. Staggers, J. E.; Hernell, O.; Stafford, R. J.; Carey, M. C. Physicalchemical behavior of dietary and biliary lipids during intestinal digestion and absorption. 1. Phase behavior and aggregation states of model lipid systems patterned after aqueous duodenal contents of healthy adult human beings. Biochemistry. 1990, 29, 2028–2040. Tanaka, H.; Hashiba, H.; Kok, J.; Mierau, I. Bile salt hydrolase of Bifidobacterium longum—biochemical and genetic characterization. Appl. Environ. 2000, 66 (6), 2502–2512.

PR0704940 Journal of Proteome Research • Vol. 7, No. 01, 2008 385

Analysis of Host-Inducing Proteome Changes in Bifidobacterium

Recommend Documents