Chapter 10
Downloaded via TUFTS UNIV on July 10, 2018 at 17:13:00 (UTC). See https://pubs.acs.org/sharingguidelines for options on how to legitimately share published articles.
Anti-Human Immunodeficiency Virus Activity and Mechanisms of Unmodified and Modified Antisense Oligonucleotides T. Hatta, S.-G. Kim, S. Suzuki, K. Takaki, and H. Takaku Department of Industrial Chemistry, Chiba Institute of Technology, Tsudanuma, Narashino, Chiba 275, Japan We demonstrated that unmodified and modified (phosphorothioate) oligonucleotides prevent c D N A synthesis by A M V or H I V reverse transcriptases. Antisense oligonucleotide/RNA hybrids specifically arrest primer extension. The blockage involves the degradation of the R N A fragment bound to the antisense oligonucleotide by the reverse-transcriptase-associated RNase H activity. However, the phosphorothioate oligomer inhibited polymerization by binding to the A M V RT rather than to the template R N A ; whereas, there was no competitive binding of the phosphorothioate oligomer on the HIV RT during reverse transcription. We also describe the anti-HIV activities of phosphorothioate oligonucleotides and point out some of the problems that still need to be solved. Antisense R N A or antisense oligodeoxyribonucleotides within cells targeted toward the R N A transcript of a specific gene can inhibit the expression or promote the degradation of the transcript, resulting in suppression of the function coded for by the gene. The addition of chemically modified antisense oligomers to culture medium and their uptake by cells has been used to inhibit the expression of spécifie target genes (1-4). TTiese compounds have been used as antisense inhibitors of gene expressions in various culture systems and are considered to be potential therapeutic agents (5,5). Antisense oligonucleotides complementary to viral R N A inhibit viral replication in cells cultured with Rous sarcoma virus (7), Human immunodeficiency virus (5-77), Vesicular stomatitis virus (72,73), Herpes simplex virus (12-14), and Influenza virus (75,76). However, the mechanism by which the antisense oligonucleotide inhibited retroviral protein synthesis, syncytia formation, and reverse transcriptase activity has not been fully elucidated. Recently, Toulmé et al. have reported that unmodified oligonucleotides indeed arrested c D N A synthesis by A M V and M M L V RTs, which have RNase H activity, but that α-oligonucleotide analogues did not (77,78). On the other hand, Matsukura et al. reported that the inhibition of de novo infection by S-ODNs is both composition- and length-dependent. For example, homooligo S-dC28 is a better inhibitor than S-dC20 or S-ODNs (20-mer, coding exon I of art/trs gene in HIV) (9). However, S-dC28 did not inhibit the p24 gag expression in chronically infected Τ cells; whereas, S-ODNs complementary to the initiation sequence of HIV-rev inhibited the production of several viral proteins in chronically 0097-6156/94/0580-0154S08.00/0 © 1994 American Chemical Society
Sanghvi and Cook; Carbohydrate Modifications in Antisense Research ACS Symposium Series; American Chemical Society: Washington, DC, 1994.
10.
HATTAETAL.
155
Anti-HIV Activity of Oligonucleotides
HIV-infected Τ cells (79). On the other hand, Lisziewicz et al. (20) have reported that chemotherapy based on specifically targeted antisense oligonucleotide phosphorothioates is an effective means of reducing the viral burden in HIV-1 infected individuals at clinically achievable oligonucleotide concentrations. However, despite advances in AIDS therapy, there still remains the issue of how to select an effective target sequence and length for the phosphorothioate oligonucleotides. To define the dependence on both the target sequences and length of the phosphorothioate oligonucleotides of optimal anti-HIV activity, we synthesized phosphorothioate oligonucleotide analogues. We present here a detailed analysis of the effect of unmodified and modified (phosphorothioate) oligodeoxyribonucleotides (27) on c D N A synthesis by A M V and HIV (22) RTs. We also describe the synthesis of one normal chain and the chain of either the whole-PS group or that capped with PS at both 3' and 5'-ends in sense, random, homo-oligomeric or antisense sequences with five target sites (gag, pol, rev, tat, and tar) within the HIV gene (Figure 1). The phosphorothioate oligonucleotides that are nuclease-resistant analogues of oligodeoxyribonucleotides can be used to prevent reverse transcription. Mechanisms of the Inhibition of Reverse Transcription by Unmodified and Modified Antisense DNA Materials. The unmodified oligonucleotide derivatives 5'-d[TTGTGTCAAAAGCAA -GT] [17 cap (n)], 5'-d[CACCAACTTCTTCCACA] [17 sc (n)], and 5'-d[TGCCCAG G G C C T C A C ] [15 sc (n)], and modified (phosphorothioate) oligodeoxyribonucleotide derivatives 5-d[TsTsGsTsGsTsCsAsAsAsAsGsCsAsAsGsT] [17 cap (s)] and 5'd[CsAsCsCsAsAsCsTsTsCsTsTsCsCsAsCsA] [17 sc (s)] were synthesized on a Biosearch synthesizer. The oligonucleotide derivatives were purified by reverse phase HPLC on an oligo-DNA column. Purified oligomers were evaluated by resolving P-labeled by electrophoresis samples on 20% polyacrylamide/7 M urea gels. 32
Methods. Rabbit β-Globin R N A (50 ng, containing 0.3 pmol of intact β-globin), primer (50 pmol), and the desired amount of antisense oligonucleotides were preincubated for 30 minutes at 39° C. After adding 1 ml of 10 χ RT buffer (1M Tris/HCl, pH 8.3, 720 m M KC1, 100 m M MgCl2, 100 m M dithiothreitol) containing 8 units of RNasin, 2 pmol of [a-32p]dCTP (3000Ci/mmol; Ci= 37GBq; NEN), 5 nmol of the three dNTPs, and 2.5 nmol of dCTP, the volume of the mixture was adjusted to 10 μΐ with sterile water. A M V R T (1-10 units-i.e., 0.13-1.3 pmol) was then added. The reaction with HIV R T was allowed to proceed with 1 unit, incubated for 1 hour at 39°C. The c D N A was chloroform-extracted according to standard procedures and loaded on a 10% P A G E . The results obtained for c D N A synthesis were corrected for the number of labels incorporated into each fragment. The cDNA Synthesis by AMV-RT Using Unmodified and Modified Antisense Oligonucleotides. Reverse transcription of rabbit β-globin mRNA by A M V RT was primed with 17 sc, complementary to oligonucleotide 113-129 (Figure 2), giving rise to the predicted c D N A fragment of about 130 nucleotides (Figure 3a). In contrast, when the polymerization was performed in the presence of 17 cap (n) (0.05-2 μΜ), an oligonucleotide targeted to the cap region of the mRNA, a shortened D N A fragment, was synthesized at the expense of the full-length product. The size of the c D N A fragment corresponded to the distance between the primer and binding site of the antisense oligonucleotides (Figure 2). Therefore, the hybridization of this antisense oligonucleotide with the complementary sequence of the b-globin m R N A prevents transcription of this region. The inhibitory efficiency was dependent on the 17 cap (n) concentration. At concentrations as low as 1.0 μΜ, 17 cap (n), 96% inhibition of
Sanghvi and Cook; Carbohydrate Modifications in Antisense Research ACS Symposium Series; American Chemical Society: Washington, DC, 1994.
156
C A R B O H Y D R A T E MODIFICATIONS IN ANTISENSE R E S E A R C H
re v^^tcu
1 tag
ΠΕΙ
pot
rem
GZDD
splice acceptor site of po/
leader sequence of p24 gag 1180 1 I
4486
1200
4505
t
T
AUUACCCUAUAGUGCAGAACAUCCAGGGGA rfrnnATATCACfiTCTTCTAGG-n
y
5"
S-ODNs-gflg-to
GGGAUC/i/Ai/i/ACACCCACACCAGAAAUUCA 3' Hi A A T AATfiTCCC T f i T C O T CTT) S-ODNs-po/-Jfl homooligomeric sequences
splice acceptor site of tat 5350 I
1 '
5370 I
drrrcccccccc^ryrrrccccccccc
d(GGTAAAAGTCTTAACCCACA) S-ODNs-wx-ία
y
5530
splice acceptor site of rev j 5550
5
s-dCj,
*rrrrrrJrcrrrrrrcr.crr. ^^rww-rrrrrfY-r HA A AAA AAAAAA|*rAAAj*jAAAA d r r r i ' l ' l ' l 11Τ1Ί 11111 ΓΤΤ
VAVCCAUUUUCAGAAUUGGGUGUCGACAO «
S-dCjo S-dC S-dA» S-OTM S-dG^ l3
ovulational start site of rev 5570 I
AVAACAAAAGCCUUAGGCAUCUCCXJAUGPCAGGAAGAAGCGGAGACAGC \'
(lfCrrrTTCOOAATCCGTAGAGG) S-ODNs-r
