Anti-inflammatory Mechanism of Ginseng Saponin Metabolite Rh3 in

Mar 23, 2015 - By treatment of BV2 cells with AICAR (a pharmacological activator of AMPK), we found that AMPK is an upstream regulator of phosphatidyl...
0 downloads 8 Views 2MB Size
Download PDF
Article pubs.acs.org/JAFC

Anti-inflammatory Mechanism of Ginseng Saponin Metabolite Rh3 in Lipopolysaccharide-Stimulated Microglia: Critical Role of 5′Adenosine Monophosphate-Activated Protein Kinase Signaling Pathway Yu Young Lee,†,‡ Jin-Sun Park,†,‡ Eun-Jung Lee,‡ Sang-Yun Lee,§ Dong-Hyun Kim,§ Jihee Lee Kang,∥ and Hee-Sun Kim*,‡ ‡

Department of Molecular Medicine, Tissue Injury Defense Research Center, and ∥Department of Physiology, Tissue Injury Defense Research Center, Ewha Womans University Medical School, Seoul 158-710, Republic of Korea § Department of Life and Nanopharmaceutical Sciences, College of Pharmacy, Kyung Hee University, Seoul 130-701, Republic of Korea S Supporting Information *

ABSTRACT: Ginsenoside Rh3 is a bacterial metabolite of Rg5, which is the main constituent of heat-processed ginseng. The present study was undertaken to examine the anti-inflammatory effect of ginsenoside Rh3 in lipopolysaccharide (LPS)-stimulated microglia. Rh3 inhibits the expressions of inducible nitric oxide synthase (iNOS) and proinflammatory cytokines, such as tumor necrosis factor (TNF)-α and interleukin (IL)-6, at mRNA and protein levels, while Rh3 enhanced anti-inflammatory hemeoxygenase-1 expression. Moreover, Rh3 inhibited nuclear factor-κB (NF-κB) by upregulation of sirtuin 1 (SIRT1) and enhanced Nrf2 DNA-binding activities. Analysis of signaling pathways revealed that Rh3 enhanced the phosphorylation of 5′adenosine monophosphate-activated protein kinase (AMPK) and inhibited Akt and janus kinase 1 (JAK1)/signal transducer and activator of transcription 1 (STAT1) induced by LPS. By treatment of BV2 cells with AICAR (a pharmacological activator of AMPK), we found that AMPK is an upstream regulator of phosphatidylinositol 3-kinase (PI3K)/Akt and JAK1/STAT1. Furthermore, AMPK knockdown experiments demonstrated the anti-inflammatory role of AMPK in LPS/Rh3-treated BV2 microglia. Our data collectively suggest that Rh3 exerts an anti-inflammatory effect in microglia by modulating AMPK and its downstream signaling pathways. KEYWORDS: ginsenoside Rh3, microglia, neuroinflammation, AMPK, signaling molecules

■

INTRODUCTION Microglia, the primary immune cells residing in the brain, regulate innate immune responses in the central nervous system to protect neurons. Their activation causes release of neurotrophic factors supporting neuronal cell survival or neurotoxic factors, such as nitric oxide (NO) and proinflammatory cytokines.1−3 A number of studies report that activated microglia may cause neuroinflammation by releasing pro-inflammatory cytokines, leading to neurodegenerative diseases, such as Alzheimer’s disease and Parkinson’s disease.4,5 Therefore, microglial activation must be tightly regulated to avoid neurotoxic consequences. In accordance with this, the development of anti-inflammatory agents, which can control microglial activation, is necessary for prevention and treatment of various neurodegenerative diseases. 5′-Adenosine monophosphate-activated protein kinase (AMPK), known as a multi-functional energy sensor in many organ systems, is a heterotrimeric serine/threonine protein kinase consisting of a catalytic subunit (α) and two regulatory subunits (β and γ). Recent studies demonstrate that AMPK can regulate both energy homeostasis and inflammatory defense.6−9 In the brain, activation of AMPK inhibits lipopolysaccharide (LPS)-induced expression of pro-inflammatory cytokines and inducible nitric oxide synthase (iNOS) by modulating nuclear © 2015 American Chemical Society

factor-κB (NF-κB) and Ccaat-enhancer-binding protein (C/ EBP) in primary rat astrocytes and microglia.10 AMPK activation also inhibits the expression of pro-inflammatory mediators in the serum and cerebral cortex of LPS-injected rats.11 In addition, activation of AMPK suppresses interferon-γ (IFN-γ)-induced cytokines and chemokines by blocking signal transducer and activator of transcription 1 (STAT1) expression in rat primary astrocytes and microglia.11 Thus, AMPK may be an interesting target for neuroprotective drugs in inflammatory conditions, such as Alzheimer’s disease and Parkinson’s disease.10,11 The pharmacological properties of ginseng are mainly attributed to ginsenosides, which are the active components found in the extracts of ginseng, the root of Panax ginseng C.A. Meyer (family Araliaceae). Ginsenosides are widely used for their pharmacological effects on diabetes, allergies, cancers, and hypertension.12,13 In particular, a ginseng heating process is frequently used in Asian countries. Rg5, the main constituent of heat-processed ginseng, exerts anticancer, antiallergic, and Received: Revised: Accepted: Published: 3472

December March 17, March 23, March 23,

18, 2014 2015 2015 2015 DOI: 10.1021/jf506110y J. Agric. Food Chem. 2015, 63, 3472−3480

Article

Journal of Agricultural and Food Chemistry

Figure 1. Chemical structure of ginsenoside Rg5 and Rh3.

Table 1. Primers Used in RT-PCR Reactions gene

forward primer (5′ → 3′)

reverse primer (5′ → 3′)

size (bp)

TNF-α iNOS IL-6 HO-1 SIRT1 GAPDH

CCTATGTCTCAGCCTCTTCT CCCTTCCGAAGTTTCTGGCAGCAGC CCACTTCACAAGTCGGAGGCTT ATACCCGCTACCTGGGTGAC CACCGATCCTCGAACAATTC ATGTACGTAGCCATCCAGGC

CCTGGTATGAGATAGCAAAT GCCTGTCAGAGCCTCGTGGCTTTGG CCAGCTTATCTGTTAGGAGA TGTCACCCTGTGCTTGACCT CCCAGCTCCAGTCAGAACTA AGGAAGGAAGGCTGGAAGAG

354 450 395 209 640 420

radical-scavenging activities.14−17 After intake, Rg5 is metabolized by intestinal bacteria and transformed to Rh3, which is taken up by the body.16 Some evidence shows that Rh3 has anti-inflammatory effects in a chronic dermatitis model16 and neuroprotective effects in a scopolamine-induced memory deficit model,18 but its effect on neuroinflammation has not been well explored. Therefore, we examined the antiinflammatory effect of Rh3 in LPS-induced microglia and investigated its underlying molecular mechanism.

■

medium (DMEM) supplemented with 10% heat-inactivated fetal bovine serum, streptomycin (10 μg/mL), and penicillin (10 units/mL) at 37 °C. Primary microglial cells were cultured from the cerebral cortices of 1−2-day-old Sprague−Dawley rat pups as described previously.23 The purity of microglial cultures was greater than 95%, which was confirmed by western blot and immunocytochemistry analyses using an antibody specific to ionized calcium-binding adapter protein-1 (data not shown). The use of rat for primary culture was approved by the Institutional Animal Care and Use Committee in the Medical School of Ewha Womans University (ESM13-0242). Measurement of Cytokine and Nitrite Levels. BV2 cells (1 × 105 cells per well in a 24 well plate) or primary microglia (2.5 × 105 cells per well in a 48 well plate) were pretreated with Rh3 or AICAR for 1 h and stimulated with LPS (0.1 μg/mL for BV2 cells and 10 ng/ mL for primary microglia). The supernatants of the cultured microglia were collected 24 h after LPS stimulation, and the concentrations of tumor necrosis factor (TNF)-α and interleukin (IL)-6 were measured by enzyme-linked immunosorbent assay (ELISA) as previously described.24 Accumulated nitrite was measured in the cell supernatant by Griess reagent. RT-PCR. BV2 cells (7.5 × 105 cells on a 6 cm dish) or rat primary microglia (7 × 106 cells on a 6 cm dish) were treated with LPS in the presence of Rh3, and total RNA was extracted with TRI reagent (Sigma). For RT-PCR, total RNA (1 μg) was reverse-transcribed in a reaction mixture containing 1 unit of RNase inhibitor, 500 ng of random primers, 3 mM MgCl2, 0.5 mM dNTP, 1× RT buffer, and 10 units of reverse transcriptase (Promega). The synthesized cDNA was used as a template for PCR using GoTaq polymerase (Promega), and the primers are shown in Table 1. GAPDH was used as an internal control for normalizing target gene expression. EMSA. Nuclear extracts from treated microglia were prepared as described previously. 24 Double-stranded DNA oligonucleotides containing the NF-κB or antioxidant response element consensus sequences (Promega) were end-labeled by [γ-32P] ATP. Nuclear proteins (5 μg) were incubated with 32P-labeled probe on ice for 30 min and resolved on a 5% acrylamide gel as previously described.24 Intracellular Reactive Oxygen Species (ROS) Measurement. Intracellular accumulation of ROS was measured with H2DCF-DA (Sigma) by modifying previously reported methods.25 In brief, BV2 microglial cells were stimulated with LPS for 16 h and stained with 20 μM H2DCF-DA in Hank’s balanced salt solution buffer for 1 h at 37 °C. 2′,7′-Dichlorofluorescein (DCF) fluorescence intensity was measured at 485 nm excitation and 535 nm emission on a fluorescence plate reader (Molecular Devices, Sunnyvale, CA). For image analysis of ROS production, BV2 cells were placed on coverslips and treated with Rh3 1 h prior to LPS treatment. Cells were stained with H2DCF-

MATERIALS AND METHODS

Isolation of Ginsenoside Rh3. Heated red ginseng extract was prepared as previously described,18,19 and its main constituent ginsenoside Rg5 was isolated following a previously described procedure.19,20 Briefly, ginsenoside Rg5 (0.2 g) was incubated with human fecal suspension (approximately 1 g) in anaerobic medium (0.5 L) according to a previously described method.21 The reaction mixture was extracted with n-BuOH (1 L) twice and evaporated (dried extract, 0.15 g). The n-BuOH extract was subjected to silica gel column chromatography (2 × 15 cm), eluted with a stepwise gradient of CHCl3 and methanol, and then underwent further chromatography on silica gel columns, employing the same eluent systems, to yield ginsenoside Rh3 (43 mg) (Figure 1). The extracted ginsenoside Rh3 was identified by comparison to an authentic standard by nuclear magnetic resonance spectrometry (Bruker AMX 400, 400 MHz) and fast atom bombardment mass spectrometry (FAB-MS). Ginsenoside Rh3 (purity, >95%), colorless powder (MeOH); melting point (mp), 161−162 °C; FAB-MS (m/z), 605 (M + H)+. Reagents. All reagents used for cell culture were obtained from Gibco BRL (Grand Island, NY). LPS (Escherichia coli serotype 055:B5), 5-aminoimidazole-4-carboxamide-1-β- D -ribofuranoside (AICAR), and nicotinamide were purchased from Sigma Chemical Co. (St Louis, MO). Antibodies against phospho-/total forms of mitogen-activated protein kinases (MAPKs) and Akt were purchased from Cell Signaling Technology (Beverley, MA). Antibodies against hemeoxygenase-1 (HO-1) and phospho-forms of janus kinase 1 (JAK1) and STAT1 were purchased from Santa Cruz Biotechnology (Santa Cruz, CA). Phosphatidylinositol 3-kinase (PI3K)/Akt- and JAK/STAT-specific inhibitors (LY294002, Ruxolitinib) were obtained from Calbiochem (La Jolla, CA) and MedChem Express (Princeton, NJ), respectively. Griess reagent for NO measurement, all of the reagents for reverse transcription polymerase chain reaction (RTPCR), and oligonucleotides for electrophoretic mobility shift assay (EMSA) were purchased from Promega (Madison, WI). Microglial Cell Cultures. Immortalized murine BV2 microglial cells22 were grown and maintained in Dulbecco’s modified Eagle’s 3473

DOI: 10.1021/jf506110y J. Agric. Food Chem. 2015, 63, 3472−3480

Article

Journal of Agricultural and Food Chemistry

Figure 2. Rh3 inhibits NO, TNF-α, IL-6, and ROS production and enhances HO-1 expression in LPS-stimulated microglia. (A) BV2 cells or rat primary microglia were pretreated with Rh3 1 h prior to LPS (100 ng/mL) and incubated for 16 h. The supernatants were obtained, and the amounts of nitrite, TNF-α, and IL-6 were measured. (B) BV2 cells treated with the above conditions were stained with 20 μM H2DCF-DA, and DCF fluorescence intensity was measured. (C) Confocal image analysis of intracellular ROS production. (D) Levels of HO-1 protein expression in BV2 cells were determined by western blot analysis. The data are expressed as the mean ± SEM for three independent experiments. (∗) p < 0.05 versus cells treated with LPS alone. are presented as the mean ± standard error of the mean (SEM), and statistical comparisons between groups were performed using one-way analysis of variance followed by Newman−Keuls multiple comparison test. p values less than 0.05 were deemed to indicate statistical significance.

DA for 1 h, mounted onto a microscope slide, and analyzed using confocal laser scanning microscopy. Western Blot Analysis. Cell extracts were prepared as described previously.24 Proteins were separated by 12% sodium dodecyl sulfate− polyacrylamide gel electrophoresis (SDS−PAGE) and transferred to nitrocellulose membrane (Amersharm, Piscataway, NJ). The membranes were blocked with 5% skim milk in 10 mM Tris−HCl containing 150 mM NaCl and 0.5% Tween 20 (TBST) and then incubated with primary antibodies (1:1000) recognizing the phosphoor total forms of extracellular signal-regulated kinase (ERK), p38 MAPK, c-Jun N-terminal kinase (JNK), or Akt. Primary antibodies recognizing JAK1, STAT1, or HO-1 were also used. β-Actin was used as the loading control for normalizing protein expression. After thoroughly washing with TBST, horseradish peroxidase-conjugated secondary antibodies (1:1000 dilution in TBST; New England Biolabs, Beverly, MA) were applied and blots were developed using an enhanced chemiluminescence detection kit (Thermo Fisher Scientific, Waltham, MA). Knockdown of AMPK by Small Interfering RNA (siRNA). BV2 cells (0.5 × 105 cells per well in a 12 well plate) were transiently transfected with 100 pM AMPK siRNA using Ambion siPORT NeoFX transfection reagent following the protocols of the manufacturer (Ambion). A scrambled control siRNA was used as a negative control. The siRNA sequences were as follows: AMPK-α1 siRNA (5′GCAGAAGUUUGUAGAGCAA-3′) and control siRNA (5′-AAUCGCAUAGCGUAUGCCGUU-3′). The cells were harvested 48 h after siRNA transfection, and the expression levels of AMPK protein were measured by western blotting. Statistical Analysis. Unless otherwise stated, all experiments were performed with triplicate samples and repeated at least 3 times. Data

■

RESULTS

Rh3 Inhibits LPS-Induced Production of NO, TNF-α, and IL-6 in BV2 Cells and Primary Cultured Microglia. BV2 cells were treated with Rh3 for 1 h before stimulation with LPS, and the effects of Rh3 on the LPS-induced production of NO and cytokines were examined. As shown in Figure 2A, Rh3 significantly inhibited NO, TNF-α, and IL-6 production in LPS-stimulated BV2 cells. The anti-inflammatory effects of Rh3 were also observed in rat primary microglia (Figure 2A). Rh3 did not have any cytotoxicity in the concentrations used in this study in both the BV2 and primary microglial cells at least for 48 h (data not shown). Rh3 Suppresses LPS-Induced ROS Production and Upregulates HO-1 Expression. Previous studies indicate that ROS play a crucial role in oxidative and inflammatory responses.1,4 To determine the effect of Rh3 on ROS production in LPS-stimulated BV2 cells, we measured intracellular ROS scavenging activities of Rh3 using the DCF-DA method. As shown in Figure 2B, Rh3 had an inhibitory effect on LPS-induced ROS production in BV2 cells. Confocal microscopic analysis also showed the inhibition of LPS-induced 3474

DOI: 10.1021/jf506110y J. Agric. Food Chem. 2015, 63, 3472−3480

Article

Journal of Agricultural and Food Chemistry

Figure 3. Rh3 suppresses LPS-induced mRNA expression of iNOS, TNF-α, and IL-6 and increases HO-1 expression by modulating NF-κB and Nrf2 activity. (A) To examine mRNA expression of iNOS, TNF-α, IL-6, and HO-1, BV2 cells were pretreated with Rh3 1 h before incubation with LPS (100 ng/mL) for 6 h. The mRNA levels of iNOS, TNF-α, IL-6, and HO-1 were determined by RT-PCR. The results are representative of three independent experiments (left panel). Quantitative analysis of mRNA expression was performed by densitometric analysis. GAPDH was used as an internal control. The data are expressed as the mean ± SEM for three independent experiments (right panel). (∗) p < 0.05 versus cells treated with LPS alone. (B) EMSA for NF-κB DNA-binding activity. Nuclear extracts were prepared from BV2 cells after treatment with LPS (100 ng/mL) for 3 h in the presence or absence of Rh3, and gel shift assay was performed using NF-κB oligonucleotide probe. “F” indicates free probe. (C) Amount p65 or p50 protein was determined in the same nuclear extracts used in the EMSA, by western blot. Lamin A was used as the loading control for nuclear protein. (D) Effect of Rh3 on SIRT1 mRNA expression in BV2 cells stimulated with LPS for 3 h. The results are representative of three independent experiments. Quantitative analysis of mRNA levels of SIRT1 was performed by densitometric analysis. The data are expressed as the mean ± SEM for three independent experiments. (∗) p < 0.05 versus cells treated with LPS alone. (E) Effect of nicotinamide (NAM) on NF-κB DNA-binding activity. Nuclear extracts were prepared from BV2 cells after treatment with LPS (100 ng/mL) for 3 h in the presence or absence of Rh3 (50 μM) or Rh3 (50 μM) + nicotinamide (50 μM), and EMSA was performed. (F) EMSA for Nrf2 DNA-binding activity.

modulating pro-inflammatory gene expression. Rh3 inhibited LPS-induced NF-κB DNA-binding activity (Figure 3B). However, it did not affect the nuclear translocation of p65 or p50 subunit protein (Figure 3C). Because SIRT1 is known to inhibit NF-κB signaling via deacetylation of the p65 subunit, we investigated whether Rh3 affects SIRT1 expression. RT-PCR analysis showed that Rh3 increased SIRT1 expression (Figure 3D). Next, to see whether the upregulation of SIRT1 led to NF-κB inhibition in Rh3-treated BV2 cells, we examined the effects of SIRT1 inhibitor, nicotinamide, on NF-κB activity. EMSA data showed that nicotinamide reversed the Rh3mediated inhibition of NF-κB in LPS-stimulated BV2 cells (Figure 3E). The data suggest that SIRT1 is at least partly involved in Rh3-mediated inhibition of NF-κB signaling. Moreover, Rh3 increased Nrf2 binding to antioxidant response element, which is important for HO-1 gene expression (Figure 3F). Rh3 Enhances AMPK Phosphorylation and Inhibits Phosphorylation of Akt and JAK1/STAT1 in LPS-

ROS production by Rh3, which is consistent with DCF-DA data (Figure 2C). In addition, Rh3 significantly increased LPSinduced expression of HO-1 (Figure 2D), which is an important molecule involved in cellular defense against oxidative stress.26,27 Rh3 Inhibits LPS-Induced mRNA Expression of iNOS and Pro-inflammatory Cytokines and Increases HO-1 Expression by Modulating the NF-κB/Nrf2 Axis and Sirtuin 1 (SIRT1) Expression. Next, we examined the effect of Rh3 on the transcription of iNOS, TNF-α, IL-6, and HO-1 genes in LPS-stimulated BV2 cells. Rh3 significantly inhibited the mRNA expression of iNOS, TNF-α, and IL-6 and increased HO-1 mRNA expression (Figure 3A). A similar pattern of transcriptional regulation by Rh3 was observed in primary microglia (data not shown). These results suggest that Rh3 regulates the expression of iNOS, TNF-α, IL-6, and HO-1 at the mRNA level. To analyze the molecular mechanism underlying the anti-inflammatory effect of Rh3, we examined the effect of Rh3 on NF-κB, a key transcription factor 3475

DOI: 10.1021/jf506110y J. Agric. Food Chem. 2015, 63, 3472−3480

Article

Journal of Agricultural and Food Chemistry

Figure 4. Rh3 enhances AMPK phosphorylation and inhibits the phosphorylation of Akt and JAK1/STAT1 in LPS-stimulated BV2 cells. Cell extracts were prepared from BV2 cells treated with LPS for 1 h in the absence or presence of Rh3 and were subjected to immunoblot analysis. The data show the effect of Rh3 on phosphorylation of (A) AMPK, (B) Akt, and (C) JAK1/STAT1. The results are representative of three independent experiments. p-Akt was normalized by total Akt, and p-AMPK, p-JAK1, and p-STAT1 were normalized by β-actin. Quantification data are shown in the bottom panel. The data are expressed as the mean ± SEM for three independent experiments. (∗) p < 0.05 versus cells treated with LPS alone.

Stimulated BV2 Cells. To investigate the signaling pathways involved in the anti-inflammatory effect of Rh3, we examined the effect of Rh3 on the phosphorylation of AMPK, which is an important anti-inflammatory signaling molecule.6−8 We found that Rh3 enhanced LPS-induced AMPK phosphorylation (Figure 4A). Next, we examined the effect of Rh3 on LPSinduced phosphorylation of three types of MAPKs, Akt (a downstream substrate of PI3K), JAK1, and STAT1, which are upstream signaling molecules that regulate gene expression of pro-inflammatory cytokines.28−31 Rh3 had an inhibitory effect on Akt, JAK1, and STAT1 phosphorylation (panels B and C of Figure 4), but it did not affect the phosphorylation of MAPKs in LPS-induced BV2 cells (see Supplementary Figure 1 of the Supporting Information). To further investigate the role of PI3K/Akt and JAK1/STAT1 in Rh3-mediated anti-inflammation, we treated BV2 cells with PI3K/Akt or JAK/STAT pathway-specific inhibitors (LY294002, Ruxolitinib) before stimulation with LPS. We found that both inhibitors significantly inhibited the production of TNF-α, IL-6, NO, and ROS induced by LPS (see Supplementary Figure 2 of the Supporting Information). These results suggest that AMPK, PI3K/Akt, and JAK1/STAT1 signaling pathways are largely involved in the anti-inflammatory effect of Rh3 in LPSstimulated BV2 cells. AMPK Is an Upstream Signal of PI3K/Akt and JAK1/ STAT1 and Mediates the Anti-inflammatory Effect of Rh3 in LPS-Stimulated BV2 Cells. To investigate a possible involvement of AMPK in Rh3-mediated anti-inflammation, BV2 cells were treated with AICAR, an AMPK activator. AICAR decreased LPS-induced phosphorylation of Akt and JAK1/STAT1 (Figure 5), suggesting that AMPK is an upstream signal of PI3K/Akt and JAK1/STAT1. In addition, AICAR, like Rh3, inhibited NO, TNF-α, IL-6, and ROS production, suppressed NF-κB DNA-binding activity, and upregulated SIRT1 (a negative regulator of NF-κB) expression (panels A−C of Figure 6). Furthermore, AICAR upregulated HO-1 expression by enhancing Nrf2 DNA-binding activity (panels D and E of Figure 6). These results suggest that Rh3 exerts anti-inflammatory/antioxidant effects in microglia by modulating AMPK. To confirm this possibility, we examined whether knockdown of AMPK by siRNA reversed the antiinflammatory effect of Rh3. As shown in Figure 7, in comparison to the control siRNA group, AMPK siRNA

Figure 5. AICAR, an AMPK activator, has an inhibitory effect on LPSinduced phosphorylation of Akt, JAK1, and STAT1. (A) Cell extracts were prepared from BV2 cells treated with LPS for 1 h in the presence of AICAR and were subjected to immunoblot analysis using antibodies against phospho- or total forms of Akt. The total form of Akt was used as an internal control. (B) Effect of AICAR on the phosphorylation of JAK1 and STAT1. The results are representative of three independent experiments. Quantification data are shown in the bottom panel. The data are expressed as the mean ± SEM for three independent experiments. (∗) p < 0.05 versus cells treated with LPS alone.

attenuated Rh3- and AICAR-mediated inhibition of TNF-α, IL-6, NO, and ROS production. We observed that AMPK siRNA also augmented LPS-induced inflammatory responses (Figure 7B). However, the percent increase of inflammatory responses induced by AMPK knockdown compared to control siRNA was much higher in the LPS + Rh3- or LPS + AICARtreated group than the LPS-only group. These results collectively suggest that AMPK is at least partly involved in the anti-inflammatory effect of Rh3 in LPS-stimulated microglia.

■

DISCUSSION In the present study, we demonstrated that Rh3 has an antiinflammatory effect in activated microglia. Rh3 significantly inhibited the production of NO, TNF-α, and IL-6 in LPSstimulated BV2 cells and rat primary microglia. In addition, Rh3 decreased levels of intracellular ROS, which is associated with upregulated antioxidant enzyme HO-1 expression. RT-PCR analysis showed that Rh3 regulated iNOS, TNF-α, IL-6, and HO-1 at a transcriptional level. Further mechanistic studies revealed that the inhibition of NF-κB and enhancement of Nrf2 3476

DOI: 10.1021/jf506110y J. Agric. Food Chem. 2015, 63, 3472−3480

Article

Journal of Agricultural and Food Chemistry

Figure 6. AICAR suppresses LPS-induced NO, TNF-α, IL-6, and ROS production and induces HO-1 expression by modulating NF-κB and Nrf2 DNA-binding activities. (A) BV2 cells were pretreated with AICAR 1 h prior to incubation with LPS (100 ng/mL) for 16 h, and the amounts of NO, TNF-α, and IL-6 released into the media and level of intracellular ROS were measured. The data are expressed as the mean ± SEM for three independent experiments. (∗) p < 0.05 versus cells treated with LPS alone. (B) EMSA for NF-κB DNA-binding activity. Nuclear extracts were prepared from BV2 cells after treatment with LPS for 3 h in the presence of AICAR, after which EMSA was performed. The results are representative of three independent experiments. (C) Effect of AICAR on SIRT-1 mRNA expression was determined by RT-PCR analysis. (D) Levels of HO-1 protein were determined by western blot analysis. Quantification of three independent experiments is shown in the bottom panel. (E) EMSA for Nrf2 DNA-binding activity. The results are representative of three independent experiments.

pathways are involved in the anti-inflammatory effect of Rh3. We showed that upregulation of SIRT1 is responsible for NFκB inhibition. Of interest, Rh3 inhibited the phosphorylation of PI3K/Akt and JAK1/STAT1 and upregulated AMPK. Finally, we found that AMPK modulated downstream signaling molecules, such as PI3K/Akt, JAK1/STAT1, and the NF-κB/ Nrf2 axis, suggesting that AMPK plays a pivotal role in the antiinflammatory mechanism of Rh3. A number of studies indicate that the activity of AMPK can regulate the inflammatory responses induced by NF-κB.6−8 AMPK does not directly target NF-κB but rather mediates the inhibition of NF-κB by modulating SIRT1, PGC-1α, p53, and FoxO.6 For example, SIRT1 inhibits NF-κB signaling via deacetylation of the p65 subunit.32,33 To confirm whether Rh3 acts through the AMPK-SIRT1-NF-κB signaling pathway, we compared the effects of Rh3 and AICAR, a chemical activator of AMPK. Indeed, we found that AICAR treatment increased SIRT1 expression and decreased NF-κB activity and expression of downstream pro-inflammatory genes, similar to Rh3 treatment. These findings suggest that the AMPK-SIRT1-NFκB signaling pathways are at least partly involved in the antiinflammatory mechanism of Rh3 in LPS-stimulated microglia. In the present study, we also found the association of AMPK with other inflammatory signaling molecules, such as PI3K/Akt and JAK1/STAT1. AICAR inhibited the phosphorylation of Akt and JAK1/STAT1 in LPS-stimulated microglia, suggesting that AMPK is an upstream regulator of PI3K/Akt and JAK1/ STAT1 signaling pathways. Consistent with this finding, several papers report that AMPK activation can inhibit JAK−STAT signaling. AMPK inhibits IL-6-stimulated STAT3 phosphor-

ylation and pro-inflammatory gene expression in hepatocyte cell lines.34 AMPK-mediated induction of an orphan nuclear receptor protein, small heterodimer partner, was suggested as one possible mechanism of STAT3 inhibition.35 In addition, AMPK blocks IFN-γ-induced STAT1 expression in rat primary astrocytes and microglia.11 As to the effect of AMPK on PI3K/ Akt signaling, a recent study reports that AMPK activation blocks LPS/IFN-γ-induced phosphorylation of Akt and, thus, inhibits inflammation in mouse mesangial cells.36 Therefore, our results suggest that AMPK activation by Rh3 may contribute to its anti-inflammatory effect via inhibition of PI3K/Akt and JAK1/STAT1 signaling pathways in LPSstimulated microglia. Besides its anti-inflammatory effect, Rh3 also showed an antioxidant effect in LPS-stimulated BV2 cells by decreasing ROS production and inducing HO-1 expression via the Nrf2/ antioxidant response element (ARE) pathway. Previous studies demonstrate an AMPK-dependent inhibition of ROS synthesis in human umbilical vein endothelial cells (HUVECs), LPSstimulated macrophages, and vascular smooth muscle cells.37−39 Silencing of AMPK increases nicotinamide adenine dinucleotide phosphate (NADPH) oxidase expression and decreases antioxidant enzymes in HUVECs.39,40 These studies suggest that AMPK activation limits excessive ROS synthesis by NADPH oxidase. Furthermore, some studies indicate that AMPK stimulates antioxidant Nrf2 signaling. Liu et al.41 reports that AMPK induces HO-1 expression via the Nrf2 signaling pathway in endothelial cells. In addition, the crosstalk between Nrf2 and AMPK signaling pathways has been shown to be important for the anti-inflammatory effect of berberine in LPS3477

DOI: 10.1021/jf506110y J. Agric. Food Chem. 2015, 63, 3472−3480

Article

Journal of Agricultural and Food Chemistry

Figure 7. Knockdown of AMPK attenuates the anti-inflammatory effects of Rh3. (A) AMPK protein reduction by siRNAs was confirmed by western blotting. The data are representative of three independent experiments. Quantification data are shown in the right panel. (∗) p < 0.05 versus the control siRNA-treated group. (B) Effects of AMPK siRNA on TNF-α, IL-6, NO, and ROS production in LPS-stimulated BV2 cells. Cells transfected with AMPK siRNA were treated with LPS (100 ng/mL) in the presence or absence of Rh3 (50 μM) or AICAR (1 mM) for 16 h, and the amounts of NO, TNF-α, and IL-6 released into the media and level of intracellular ROS were measured. Values are expressed as the mean ± SEM for three replicates using different cell cultures. (∗) p < 0.05 versus the control siRNA-treated group.

■

stimulated macrophages and endotoxin-shocked mice.42 Therefore, the results of the present study suggest that AMPK activation is largely involved in Rh3-mediated ROS inhibition and Nrf2/HO-1 upregulation, contributing to anti-inflammatory/antioxidant effects in LPS-stimulated microglia. In summary, this study is the first to demonstrate the antiinflammatory effect of Rh3 in LPS-stimulated microglia and its underlying molecular mechanisms. We showed that Rh3 inhibited microglial activation, at least partly, by modulating AMPK and its downstream signaling molecules, such as PI3K/ Akt, JAK1/STAT1, and NF-κB/Nrf2. These findings suggest that Rh3 may offer therapeutic potential for the treatment of various neuroinflammatory disorders that are accompanied by microglial activation.

■

AUTHOR INFORMATION

Corresponding Author

*Telephone: 82-2-2650-5823. Fax: 82-2-2653-8891. E-mail: [email protected]. Author Contributions †

Yu Young Lee and Jin-Sun Park contributed equally to this work. Funding

This research was supported by the Basic Science Research Program through the National Research Foundation of Korea (NRF) funded by the Ministry of Science, Information and Communications Technology (ICT) & Future Planning (Grants 2012R1A2A2A01045821 and 2012R1A5A2A32671866). Notes

The authors declare no competing financial interest.

■

ABBREVIATIONS USED AMPK, 5′-adenosine monophosphate-activated protein kinase; ARE, antioxidant response element; ERK, extracellular signalregulated kinase; HO-1, heme oxygenase-1; iNOS, inducible nitric oxide synthase; JAK, janus kinase; JNK, c-Jun N-terminal kinase; MAPK, mitogen-activated protein kinase; NF-κB, nuclear factor-κB; PI3K, phosphatidylinositol 3-kinase; ROS, reactive oxygen species; siRNA, small interfering RNA; SIRT, sirtuin; STAT, signal transducer and activator of transcription; TNF, tumor necrosis factor

ASSOCIATED CONTENT

S Supporting Information *

Effect of Rh3 on the phosphorylation of three types of MAPKs in LPS-stimulated BV2 cells (Figure S1) and effect of PI3K/ Akt- or JAK/STAT-specific inhibitor on TNF-α, IL-6, NO, and ROS production in LPS-stimulated BV2 cells (Figure S2). This material is available free of charge via the Internet at http:// pubs.acs.org. 3478

DOI: 10.1021/jf506110y J. Agric. Food Chem. 2015, 63, 3472−3480

Article

Journal of Agricultural and Food Chemistry

■

(22) Bocchni, V.; Mazzolla, R.; Barluzzi, R.; Blasi, E.; Sick, P.; Kettenmann, H. An immotalized cell line expresses properties of activated microglial cells. J. Neurosci. Res. 1992, 31, 616−621. (23) Park, J. S.; Park, E. M.; Kim, D. H.; Jung, K.; Jung, J. S.; Lee, E. J.; Hyun, J. W.; Kang, J. L.; Kim, H. S. Anti-inflammatory mechanism of ginseng saponins in activated microglia. J. Neuroimmunol. 2009, 209, 40−49. (24) Woo, M. S.; Jang, P. G.; Park, J. S.; Kim, W. K.; Joh, T. H.; Kim, H. S. Selective modulation of lipopolysaccharide-stimulated cytokine expression and mitogen-activated protein kinase pathways by dibutyryl-cAMP in BV2 microglial cells. Brain Res. Mol. Brain Res. 2003, 113, 86−96. (25) Lee, K. M.; Kang, H. S.; Yun, C. H.; Kwak, H. S. Potential in vitro protective effect of quercetin, catechin, caffeic acid and phytic acid against ethanol-induced oxidative stress in SK-Hep-1 cells. Biomol. Ther. 2012, 20, 492−498. (26) Syapin, P. J. Regulation of heme oxygenase-1 for treatment of neuroinflammation and brain disorders. Br. J. Pharmacol. 2008, 115, 623−640. (27) Keum, Y. S. Regulation of Nrf2-mediated phase II detoxification and anti-oxidant genes. Biomol. Ther. 2012, 20, 144−151. (28) Torres, M. Mitogen-activated protein kinase pathways in redox signaling. Front. Biosci. 2003, 8, d369−391. (29) Jana, M.; Jana, A.; Liu, X.; Ghosh, S.; Pahan, K. Involvement of phosphatidylinositol 3-kinase-mediated up-regulation of IκBα in antiinflammatory effect of gemfibrozil in microglia. J. Immunol. 2007, 179, 4142−4152. (30) Darnell, J. E., Jr.; Kerr, I. M.; Stark, G. R. Jak-STAT pathways and transcriptional activation in response to IFNs and other extracellular signaling proteins. Science 1994, 264, 1415−1421. (31) Shuai, K.; Liu, B. Regulation of JAK−STAT signaling in the immune system. Nat. Immunol. 2003, 3, 900−911. (32) Yang, S. R.; Wright, J.; Bauter, M.; Seweryniak, K.; Kode, A.; Rahman, I. Sirtuin regulates cigarette smoke-induced proinflammatory mediator release via RelA/p65 NF-κB in macrophages in vitro and in rat lungs in vivo: Implications for chronic inflammation and aging. Am. J. Physiol.: Lung Cell. Mol. Physiol. 2007, 292, L567−576. (33) Yang, Z.; Kahn, B. B.; Shi, H.; Xue, B. Macrophage α1 AMPactivated protein kinase (α1AMPK) antagonizes fatty acid-induced inflammation through SIRT1. J. Biol. Chem. 2010, 285, 19051−19059. (34) Nerstedt, A.; Johansson, A.; Andersson, C. X. AMP-activated protein kinase inhibits IL-6-stimulated inflammatory response in human liver cells by suppressing phosphorylation of signal transducer and activator of transcription 3 (STAT3). Diabetologia 2010, 53, 2406−2416. (35) Kim, Y. D.; Kim, Y. H.; Cho, Y. M. Metformin ameliorates IL-6induced hepatic insulin resistance via induction of orphan nuclear receptor small heterodimer partner (SHP) in mouse models. Diabetologia 2012, 55, 1482−1494. (36) Peairs, A.; Radjavi, A.; Davis, S.; Li, L.; Ahmed, A.; Giri, S.; Reilly, C. M. Activation of AMPK inhibits inflammation in MRL/lpr mouse mesangial cells. Clin. Exp. Immunol. 2009, 156, 542−551. (37) Jeong, H. W.; Hsu, K. C.; Lee, J. W. Berberine suppresses proinflammatory responses through AMPK activation in macrophages. Am. J. Physiol.: Endocrinol. Metab. 2009, 296, E955−964. (38) Sung, J. Y.; Choi, H. C. Aspirin-induced AMP-activated protein kinase activation regulates the proliferation of vascular smooth muscle cells from spontaneously hypertensive rats. Biochem. Biophys. Res. Commun. 2011, 408, 312−317. (39) Colomb, S. L.; Moncada, S. AMPKα1 regulates the antioxidant status of vascular endothelial cells. Biochem. J. 2009, 421, 163−169. (40) Wang, S.; Zhang, M.; Liang, B. AMPKα2 deletion causes aberrant expression and activation of NAD(P)H oxidase and consequent endothelial dysfunction in vivo: Role of 26S proteasomes. Cir. Res. 2010, 106, 1117−1128. (41) Liu, X. M.; Peyton, K. J.; Shebib, A. R.; Wang, H.; Korthuis, R. J.; Durante, W. Activation of AMPK stimulates heme oxygenase-1 gene expression and human endothelial cell survival. Am. J. Physiol.: Heart Circ. Physiol. 2011, 300, H84−93.

REFERENCES

(1) Glass, C. K.; Saijo, K.; Winner, B.; Marchetto, M. C.; Gage, F. H. Mechanisms underlying inflammation in neurodegeneration. Cell 2010, 140, 918−934. (2) Graeber, M. B.; Streit, W. J. Microglia: Biology and pathology. Acta. Neuropathol. 2010, 119, 89−105. (3) Cherry, J. D.; Olschowka, J. A.; O’Banion, M. K. Neuroinflammation and M2 microglia: The good, the bad, and the inflamed. J. Neuroinflammation 2014, 11, 98. (4) Mosher, K. I.; Wyss-Coray, T. Microglial dysfunction in brain aging and Alzheimer’s disease. Biochem. Pharmacol. 2014, 88, 594− 604. (5) Kannarkat, G. T.; Boss, J. M.; Tansey, M. G. The role of innate and adaptive immunity in Parkinson’s disease. J. Parkinson Dis. 2013, 3, 493−514. (6) Salminen, A.; Hyttinen, J. M. T.; Kaarniranta, K. AMP-activated protein kinase inhibits NF-κB signaling and inflammation: Impact on healthspan and lifespan. J. Mol. Med. 2011, 89, 667−676. (7) Salminen, A.; Kaarniranta, K. AMP-activated protein kinase (AMPK) controls the aging process via an integrated signaling network. Ageing Res. Rev. 2012, 11, 230−241. (8) Salt, I. P.; Palmer, T. M. Exploiting the anti-inflammatory effects of AMP-activated protein kinase activation. Expert Opin. Invest. Drugs 2012, 21 (8), 1155−1167. (9) Ramamurthy, S.; Ronnett, G. AMP-activated protein kinase (AMPK) and energy-sensing in the brain. Exp. Neurobiol. 2012, 21 (2), 52−60. (10) Giri, S.; Nath, N.; Smith, B.; Viollet, B.; Singh, A. K.; Singh, I. 5aminoimidazole-4-carboxamide-1-β-4-ribofuranoside inhibits proinflammatory response in glial cells: A possible role of AMPK-activated protein kinase. J. Neurosci. 2004, 24, 479−487. (11) Meares, G. P.; Qin, H.; Liu, Y.; Holdbrooks, A. T.; Benveniste, E. N. AMP-activated protein kinase (AMPK) restricts IFN-γ signaling. J. Immunol. 2012, 190, 372−380. (12) Blumenthal, M. Asian ginseng: Potential therapeutic uses. Adv. Nurse Pract. 2001, 2, 26−28. (13) Choi, I. H. Effects of Panax ginseng in neurodegenerative diseases. J. Ginseng Res. 2012, 36, 342−353. (14) Lee, K. Y.; Lee, Y. H.; Kim, S. I.; Park, J. H.; Lee, S. K. Ginsenoside-Rg5 suppresses cyclin E-dependent protein kinase activity via up-regulating p21Cip/WAF1 and down-regulating cyclin E in SKHEP-1 cells. Anticancer Res. 1997, 17, 1067−1072. (15) Kang, K. S.; Kim, H. Y.; Baek, S. H.; Yoo, H. H.; Park, J. H.; Yokozawa, T. Study on the hydroxyl radical scavenging activity changes of ginseng and ginsenoside-Rb2 by heating processing. Biol. Pharm. Bull. 2007, 30, 724−728. (16) Shin, Y. W.; Bae, E. A.; Kim, D. H. Inhibitory effect of ginsenoside Rg5 and its metabolite ginsenoside Rh3 in an oxazoloneinduced mouse chronic dermatitis model. Arch. Pharm. Res. 2006, 29, 685−690. (17) Kim, T. W.; Joh, E. H.; Kim, B.; Kim, D. H. Ginsenoside Rg5 ameliorates lung inflammation in mice by inhibiting the binding of LPS to toll-like receptor-4 on macrophages. Int. Immunopharmacol. 2012, 12, 110−116. (18) Kim, E. J.; Jung, I. H.; Van Le, T. K.; Jeong, J. J.; Kim, N. J.; Kim, D. H. Ginsenosides Rg5 and Rh3 protect scopolamine-induced memory deficits in mice. J. Ethnopharmacol. 2013, 146, 294−299. (19) Kim, W. Y.; Kim, J. M.; Han, S. B.; Lee, S. K.; Kim, N. D.; Park, M. K.; Kim, C. K.; Park, J. H. Steaming of ginseng at high temperature enhances biological activity. J. Nat. Prod. 2000, 63, 1702−1704. (20) Kim, D. S.; Baek, N. I.; Park, J. D.; Lee, Y. H.; Jeong, S. Y.; Lee, C. B.; Kim, S. I. Preparation and structure determination of a new glycoside, (20E)-ginsenoside Rh3, and its isomer from diol-type ginseng saponins. Yakhak Hoeji 1995, 39, 85−93. (21) Bae, E. A.; Han, M. J.; Choo, M. K.; Park, S. Y.; Kim, D. H. Metabolism of 20(S)- and 20(R)-ginsenoside Rg3 by human intestinal bacteria and its relation to in vitro biological activities. Biol. Pharm. Bull. 2002, 25, 58−63. 3479

DOI: 10.1021/jf506110y J. Agric. Food Chem. 2015, 63, 3472−3480

Article

Journal of Agricultural and Food Chemistry (42) Mo, C.; Wang, L.; Zhang, J.; Numazawa, S.; Tang, H.; Tang, X.; Han, X.; Li, J.; Yang, M.; Wang, Z.; Wei, D.; Xiao, H. The crosstalk between Nrf2 and AMPK signal pathways is important for the antiinflammatory effect of berberine in LPS-stimulated macrophages and endotoxin-shocked mice. Antioxid. Redox Signaling 2014, 20 (4), 574− 588.

3480

DOI: 10.1021/jf506110y J. Agric. Food Chem. 2015, 63, 3472−3480