Anti-Osteoporotic Activity of Harpagoside by Upregulation of the BMP2

Jan 20, 2017 - Harpagoside (1) is an iridoid glycoside isolated from the radix of Harpagophytum procumbens var. sublobatum, commonly called Devil's cl...
0 downloads 0 Views 5MB Size
Download PDF
Article pubs.acs.org/jnp

Anti-Osteoporotic Activity of Harpagoside by Upregulation of the BMP2 and Wnt Signaling Pathways in Osteoblasts and Suppression of Differentiation in Osteoclasts Hwa-Jin Chung,†,‡,# Won Kyung Kim,† Jedo Oh,† Me-riong Kim,‡ Joon-Shik Shin,‡ Jinho Lee,‡,# In-Hyuk Ha,‡ and Sang Kook Lee*,† †

College of Pharmacy, Natural Products Research Institute, Seoul National University, Seoul 151-742, Korea Jaseng Spine and Joint Research Institute, Jaseng Medical Foundation, Seoul 135-896, Korea

‡

ABSTRACT: Harpagoside (1) is an iridoid glycoside isolated from the radix of Harpagophytum procumbens var. sublobatum, commonly called Devil’s claw. The anti-osteoporotic effect of 1 was investigated in both in vitro cell cultures and in vivo using an ovariectomized (OVX) mouse model. Compound 1 induced bone formation by stimulating osteoblast proliferation, alkaline phosphatase activity, and mineralization in osteoblastic MC3T3-E1 cells. Treatment with 1 increased the mRNA and protein expression of bone formation biomarkers through regulation of the BMP2 and Wnt signaling pathway in MC3T3-E1 cells. Compound 1 also suppressed the RANKLinduced osteoclastogenesis of cultured mouse bone marrow cells. Oral administration of 1 restored the OVX-induced destruction of trabecular bone. The bone mineral density of the femur was also increased significantly by 1. The elevated serum levels of osteocalcin, C-terminal telopeptide, and tartrate-resistant acid phosphatase in the OVX mice were decreased by treatment with 1. These findings suggest that compound 1 may protect against bone loss induced by OVX in mice by regulating stimulation of osteoblast differentiation and inhibition of osteoclast resorption. Therefore, harpagoside (1) is a potential candidate for management of postmenopausal osteoporosis.

O

intracellular signaling pathways. Among them, the bone morphogenetic proteins (BMPs) and Wnt signaling pathways are considered to play a main role in osteoblast differentiation and bone formation.11−13 Osteoclasts are differentiated from hematopoietic progenitor cells within the monocyte/macrophage lineage. 14 The activation and differentiation of osteoclasts are modulated by RANKL. RANKL induces osteoclastogenesis by sending important signals to osteoclast progenitors through the membrane-anchored receptor RANK in osteoclasts.15 Tartrate-resistant acid phosphatase (TRAP) is an important cytochemical marker enzyme that functions as a cell growth and differentiation factor. TRAP is involved in the differentiation and formation of osteoclasts in association with osteopontin (OPN)/bone sialoprotein dephosphorylation and iron transport. An imbalance in the regulation of the two subprocesses of bone remodeling, bone resorption and bone formation, contributes to the development of many metabolic bone diseases, such as osteoporosis and rheumatism.16,17 Harpagoside (compound 1) is found in natural products such as Harpagophytum procumbens, Scrophularia ningpoensis, and Scrophularia buergeriana.18−20 These natural products have

steoporosis is an age-dependent metabolic bone disease characterized by reduced bone mass, structural deterioration of bone tissue, and increased risk of fractures.1,2 Bone is an active tissue consisting of different cell types, including osteoblasts, which are involved in bone mineralization, and osteoclasts, which play a role in bone resorption.3,4 Therefore, bone volume is regulated by the comparative rates of osteoblast bone formation and osteoclast bone resorption. In bone tissue, the formation and maintenance of bone are regulated by boneforming osteoblasts and bone-resorbing osteoclasts, and an imbalance between osteoblast and osteoclast levels may lead to bone loss-associated diseases.4,5 Osteoblasts are derived from osteoprogenitor cells and stimulate an increase of bone mass by inducing the secretion of osteoids and limiting the activity of osteoclasts. Receptor activator of nuclear factor kB ligand (RANKL) and macrophage colony-stimulating factor (M-CSF), which are expressed by osteoblasts, are essential cytokines for osteoclast formation from osteoclast precursors.6,7 M-CSF plays important roles in proliferation and subsequent osteoclast differentiation and induction of RANK expression. Secretion of osteoprotegerin (OPG), a decoy receptor of RANKL, interrupts the interaction between RANKL and RANK on osteoclast cells, thereby suppressing osteoclastogenesis.8 The ratio of OPG to RANKL plays an essential role in maintaining bone homeostasis.9,10 The activation of osteoblast differentiation is controlled by various © 2017 American Chemical Society and American Society of Pharmacognosy

Received: October 20, 2016 Published: January 20, 2017 434

DOI: 10.1021/acs.jnatprod.6b00964 J. Nat. Prod. 2017, 80, 434−442

Journal of Natural Products

Article

differentiation of osteoblasts and the mechanism of action of mineralization in preosteoblastic cells from mouse calvaria cells and in osteoblast-like cells from rat calvariae.3 In bone, ALP is expressed on the surfaces of bone-forming osteoblasts, and it has been used as a histochemical biomarker for osteoblasts. Indeed, its enzymatic functions play important roles in osteoid formation and mineralization.31−33 To evaluate the effects of 1 on osteoblast differentiation, ALP staining and activity were assessed in osteoblastic MC3T3-El cells. Primarily, the cytotoxicity of 1 against MC3T3-E1 cells was determined by MTT assay. No significant cytotoxic effect of 1 was observed up to 4 μM (>90% cell viability) (Figure 2A). Therefore, further analysis of its mechanisms of action was performed in cells treated with up to 4 μM 1. The MC3T3-El cells were cultured with 1 in the presence of ascorbic acid and β-glycerophosphate under differentiation conditions for 4 days. Compound 1 increased APL activity and staining in the cells in a concentration-dependent manner (Figure 2B). Mineralization of the extracellular matrix is one of the main biomarkers for osteoblastic maturation. Alizarin red S staining was performed to assess extracellular matrix calcium deposition.34 MC3T3-El cells were simultaneously treated with 1 for 14 days, resulting in a concentration-dependent increase in calcification nodules as indicated by the red color (Figure 2C). The increases of ALP activity and calcium deposition suggest that 1 effectively stimulates osteoblast differentiation. Effect of 1 on Osteoblastic Gene and Protein Expression. OPG and RANKL are considered to be critical for maintaining bone homeostasis. In particular, the ratio of OPG/RANKL, both of which are produced by osteoblasts, is a key factor involved in osteoclast regulation that indicates the extent of bone resorption.10,35 To further elucidate the mechanism of action of 1 on osteoblast differentiation, the mRNA and protein expression of osteogenic differentiation mediators were analyzed by real-time RT-PCR and Western blot. As shown in Figure 3, treatment with 1 induced the mRNA and protein expression of OPG, whereas it suppressed the mRNA and protein expression of RANKL. In addition, 1 increased the OPG/RANKL ratio in MC3T3-E1 cells (p
85% cell survival) (Figure 5A). BMCs were allowed to differentiate into osteoclast cells in the presence of M-CSF and RANKL for 5 days. Treatment with 1 inhibited the formation of TRAP-positive cells, which are biomarkers for RANKL-induced osteoclast differentiation (Figure 5B). Compound 1 also suppressed the protein expressions of TRAP, NFATc1, and c-Fos, biomarkers of osteoclastic cells, in RANKL-induced BMCs (Figure 5C). These findings demonstrate that 1 has a potential to inhibit osteoclastic differentiation in BMCs. 438

DOI: 10.1021/acs.jnatprod.6b00964 J. Nat. Prod. 2017, 80, 434−442

Journal of Natural Products

Article

Table 1. Effect of 1 on the Serum Parameters in OVX Micea sham calcium concentration (mg/dL) potassium concentration (mg/dL) ALP activity (U/L) TRAP activity (U/L) OCN level (ng/mL) CTx level (ng/mL)

9.1 ± 0.4 8.0 ± 0.3 67.6 ± 3.1b 9.1 ± 0.9b 148.9 ± 5.3b 69.5 ± 4.3b

OVX 9.3 8.2 84.9 19.8 176.9 95.7

± ± ± ± ± ±

0.3 0.4 4.2 1.0 4.7 3.8

E2 (10 μg/kg)

1 (2 mg/kg)

5 (mg/kg)

10 (mg/kg)

9.1 ± 0.6 7.9 ± 0.2 59.9 ± 3.1b 10.8 ± 1.0b 141.9 ± 4.9b 76.6 ± 4.7b

9.3 ± 0.5 7.9 ± 0.3 78.5 ± 3.6b 10.4 ± 1.1b 170.0 ± 5.6b 88.5 ± 3.6b

9.6 ± 0.6 8.0 ± 0.3 82.6 ± 5.2 8.9 ± 1.0b 162.7 ± 6.1b 85.9 ± 4.1b

10.3 ± 0.4 8.2 ± 0.3 78.8 ± 4.8 7.7 ± 0.7b 156.9 ± 7.9b 80.7 ± 3.8b

a The serum levels of calcium, potasium, ALP, CTx, OCN, and TRAP were analyzed as described in the Experimental Section. Data are presented as mean ± SD (n = 8). bP < 0.01 indicates statistically significant differences from the OVX mice group.

Effect of 1 on Bone Loss in an OVX-Induced Mouse Model. The OVX-induced bone loss mouse model has been widely used to mimic postmenopausal osteoporosis with estrogen insufficiency.43,44 Indeed, OVX has been shown to lead to apparent deterioration of three-dimensional trabecular microarchitecture in mice.45 To investigate the anti-osteoporotic effect of 1 in bone tissue, in vivo experiments were carried out using a mouse model with bone loss induced by OVX. As shown in Figure 6A, the increased body weight in the OVX group was greater than that in the sham group at 12 weeks. Oral administration of 1 alleviated the increase of body weight compared to the OVX group. Analysis with 3D-μCT revealed increased destruction of trabecular bone in the femur in the OVX-induced group compared with the sham group. However, 1 prevented this destruction of bone and enhanced recovery of bone in a dose-dependent manner. Under the same experimental conditions, the preventive activity of the trabecular bone microarchitecture was similarly confirmed by treatment with estradiol (E2), which was used as a positive control (Figure 6B). Analysis of the microstructural index revealed that the reduction in the bone mineral density (BMD) in the OVX group was increased by 1 in a dose-dependent manner. The BV/TV, Tb.No, and Tb.Th levels in the OVX group were lower than those in the sham group, but treatment with 1 resulted in a significant recovery of these levels. In addition, the changes in the Tb.Sp and SMI levels in the OVX group were suppressed by 1 (Figure 6C). These findings suggest that administration of 1 improves bone properties in bone loss induced by OVX and estrogen deficiency. Effects of 1 on Serum Biochemical Markers in OVX Mice. Bone turnover is able to be monitored by measuring biochemical markers of bone resorption and bone formation.46 Blood samples were collected for biochemical analysis of serum parameters. As shown in Table 1, no significant differences were found in the serum levels of calcium and potassium in the 1-treated, sham, and OVX groups. The serum levels of ALP and OCN, biomarkers of bone formation, were increased in the OVX group compared with the sham group. Treatment with 1 reduced ALP and OCN serum levels, but also the ALP serum level. The serum level of C-terminal telopeptide (CTx), a bone resorption marker, was increased in the OVX group, but the level was alleviated by treatment with 1. The increased serum level of TRAP, which is responsible for increased osteoclastogenesis and differentiation of osteoclasts for bone resorption, in the OVX group, was also suppressed by 1. These results indicate that 1 prevents bone loss via inhibiting bone turnover. In summary, the present findings provide evidence that 1 has a protective effect on bone loss in vitro and in vivo. A plausible mechanism of action for the anti-osteoporotic activity of 1 is induction of osteoblast differentiation and suppression of osteoclast formation. Therefore, the present study supports the

pharmacological basis for the further study of 1 as a potential therapeutic agent for protection against the osteoporotic response.

■

EXPERIMENTAL SECTION

Chemicals. α-Modified minimal essential medium (α-MEM), fetal bovine serum (FBS), sodium pyruvate, L-glutamine, an antibiotic− antimycotic solution, and trypsin-EDTA were purchased from Invitrogen Co. (Grand Island, NY, USA). RANKL and M-CSF were obtained from R&D Systems (Minneapolis, MN, USA). Ascorbic acid, β-glycerophosphate, 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT), and other chemicals were obtained from Sigma (St. Louis, MO, USA) unless otherwise indicated. Plant Material. H. procumbens radix was purchased in October 2012 from an herbal market in Seoul, South Korea. The plant material was identified by J.H.L. (one of the authors). A voucher specimen was deposited at the herbarium of the Jaseng Medical Foundation. Extraction and Isolation. H. procumbens radix (4 kg) was extracted with MeOH (5 L) under reflux for 5 h (Figure 1A). The MeOH solution was concentrated under reduced pressure to yield a dried MeOH extract. The MeOH extract (1.2 kg) was suspended in distilled water and fractionated with methylene chloride (MC), ethyl acetate (EA), and H2O, successively. The EA extract (40 g) was repeatedly separated using silica gel (MC/MeOH = 9:1) and an ODS column (65% MeOH) to yield harpagoside (4.2 g). This compound was identified as the iridoid glycoside harpagoside (1) by comparison of its physical and spectroscopic data with published values.30 HPLC Analysis. High-performance liquid chromatography (LCMS-2020 Shimadzu, ODS C18, 150 × 4.6 mm i.d. 5 μm) analysis of harpagoside (1) (tR 26.8 min) was performed with a H2O (0.1% TFA)/acetonitrile (0.1% TFA) gradient (97:3, 0 → 0.01 min 90:10, 0.01 → 10 min 77:33, 10 → 20 min 20:80, 20 → 25 min 20:80, 25 → 30 min 97:3, 30 → 31 min 97:3, 31 → 45 min, total of 45 min, flow rate: 0.4 mL/min, detector: MS). The purity determined for 1 was greater than 95% (Figure 1A and B). Cell Culture. Mouse calvaria MC3T3-E1 cells, obtained from the American Type Culture Collection (ATCC, Rockville, MD, USA), were cultured in α-MEM supplemented with 10% heat-inactivated FBS, 100 units/mL penicillin, 100 μg/mL streptomycin, and 0.25 μg/ mL amphotericin B. Cells were incubated in a humidified atmosphere at 37 °C and 5% CO2. Evaluation of Growth Inhibitory Potential. MC3T3-E1 cells (1 × 104 cells/mL in 96-well plates) were treated with various concentrations of 1 and incubated at 37 °C in a humidified atmosphere with 5% CO2. After 72 h of treatment with 1, MTT (5 mg/mL in PBS) was added to the media (at a final concentration of 500 μg/mL) and further incubated for 4 h. The media was discarded, and 200 μL of DMSO was added to each well to dissolve formazan. Absorbance was measured at a wavelength of 570 nm. The effect of 1 on cell viability was assessed as a percentage relative to solvent-treated controls, and IC50 values were calculated by nonlinear regression analysis (percent survival versus concentration). ALP Activity. ALP activity was assessed according to a previously described method.47 MC3T3-E1 cells were incubated in osteogenic medium containing 400 μM ascorbic acid and 5 mM βglycerophosphate. Cells (2 × 104 cells/mL) were incubated in the 439

DOI: 10.1021/acs.jnatprod.6b00964 J. Nat. Prod. 2017, 80, 434−442

Journal of Natural Products

Article

Murine Bone-Marrow-Derived Osteoclasts. BMCs (1 × 104 cells/mL) were isolated from 4-week-old mice as previously described.49 The cells were plated into 96-well plates in 30 ng/mL M-CSF for 24 h. Next, the cells were treated with the indicated concentrations of 1 in the presence of 100 ng/mL RANKL and 30 ng/ mL M-CSF. The media was replaced with and without 1 every 2 days, and cells were harvested for analysis on day 5. TRAP Staining. Osteoclast differentiation was assessed by TRAP (Sigma-Aldrich, St. Louis, MO, USA) staining and activity. Five days after stimulating cells with M-CSF (30 ng/mL) and RANKL (100 ng/ mL) in the presence or absence of 1, the cells were washed with PBS and fixed with 4% paraformaldehyde for 5 min. The cells were then rinsed in deionized water and incubated in tartrate staining solution for 1 h at 37 °C in the dark. Next, they were rinsed in deionized water and allowed to air-dry. TRAP-positive multinucleated cells containing three or more nuclei were counted as osteoclasts. Preparation of Total Cell Lysates. MC3T3-E1 cells were stimulated with 400 μM ascorbic acid and 5 mM β-glycerophosphate and incubated with or without various concentrations of 1 for 48 h. BMCs were stimulated with M-CSF (30 ng/mL) and RANKL (100 ng/mL) in the presence or absence of 1 for 48 h. To obtain total cell lysates, cells were washed with ice-cold PBS and lysed in boiling 2× sample loading buffer (250 mM Tris-HCl (pH 6.8), 4% SDS, 10% glycerol, 0.006% bromophenol blue, 50 mM sodium fluoride, 5 mM sodium orthovanadate, and 2% β-mercaptoethanol). Cell lysates were boiled for an additional 20 min and stored at −20 °C. The protein content of cell lysates was determined by the BCA method. Western Blot Analysis. Equal amounts of cell lysates (40−50 μg) were subjected to 8% and 10% SDS-PAGE and electrotransferred onto polyvinylidene difluoride membranes (Millipore, MA, USA). Membranes were blocked in PBST (PBS with 0.1% Tween-20) containing 5% nonfat dry milk for 1 h at room temperature. After washing three times with PBST, membranes were incubated with primary antibodies against TRAP, NFATc1, c-Fos, ALP, OPN, OCN, OPG, RANKL, BMP2, Smad, and Runx2 (Santa Cruz Biotechnology, Santa Cruz, CA, USA), DKK1 and p-β-catenin (Cell Signaling, Danvers, MA, USA), cMyc, cyclin D1, and β-catenin (BD Biosciences, San Diego, CA, USA), and β-actin (Sigma) for 3 h at room temperature or overnight at 4 °C. Membranes were washed three times with PBST and incubated with corresponding secondary antibodies (Santa Cruz) for 90 min at room temperature. The blots were washed three times with PBST and visualized using an enhanced chemiluminescence Western blotting detection system (Lab Frontier, Suwon, Korea). Animals. ICR mice (18−20 g, 9 weeks old) were purchased from Central Laboratory Animal Inc. (Seoul, Korea). The animals were housed under standard laboratory conditions with free access to food and water. The temperature was thermostatically regulated to 22 ± 2 °C, and a 12 h light/dark schedule was maintained. The mice were allowed 1 week for acclimatization to the laboratory environment prior to being used in the experiments. All animal experiments were carried out in accordance with the Institutional Animal Care and Use Committee Guidelines of Seoul National University (permission number: SNU-120609-1). At 9 weeks of age, the mice were ovariectomized bilaterally, and eight mice underwent sham operation. After 1 week of recovery from surgery, the OVX mice were randomly divided into five groups of eight mice each (the OVX control, 17β-estradiol (E2) (10 μg/kg), and 1 (2, 5, or 10 mg/kg) groups). 1 was orally administered in distilled water (0.2 mL) for 12 weeks, and the same volume of distilled water was used for the sham and OVX control groups. Sham, OVX, and E2 were administered through an oral gavage. After 12 weeks of treatment, the animals were sacrificed, and blood samples were collected for serum isolation. Femur bones were dissected and divested of soft tissue for trabecular microarchitecture analysis. Analysis of Bone Microarchitecture. The bone microarchitecture of the femur was examined by microcomputed tomography (μCT system, SkyScan 1076) in an area 0.6−2.1 mm from the growth plate. The X-ray source was set at a voltage of 50 kV and a current of 200 μA and filtered using a 0.5 mm aluminum filter. The scanning angular rotation was 180° with angular steps of 0.5°. The voxel size was set at

presence or absence of various concentrations of 1. After 4 days, the cells were washed with PBS and fixed using 70% ethanol for 5 min, and they were then extracted in lysis solution (10 mm Tris and 0.1% Triton X-100 buffer (pH 7.5)). Enzymatic activity was determined using p-nitrophenylphosphate (p-NPP) as a substrate. The color change of p-NPP to p-nitrophenol was measured at a wavelength of 405 nm. The protein concentrations in the cell lysates were measured by Bradford assay at 595 nm). Mineralization Assay. The calcium deposition of MC3T3-E1 cells was modified by a previously reported method.48 MC3T3-E1 cells (2 × 104 cells/mL) were stimulated with 400 μM ascorbic acid and 5 mM β-glycerophosphate and incubated at various concentrations with or without 1 for 14 days. Cells were washed two times with PBS and fixed using 70% ethanol for 30 min. The fixed MC3T3-E1 cells were stained for 5 min with 2% Alizarin red S solution (pH 4.0). The plate was washed several times with distilled water, and the cells were observed by microscopy. The cells were solubilized with 10% cetylpyridinium chloride for 15 min, and the absorbance was measured at 570 nm. Real-Time Reverse Transcription-Polymerase Chain Reaction (Real-Time RT-PCR). MC3T3-E1 cells were stimulated using 400 μM ascorbic acid and 5 mM β-glycerophosphate with or without 1 for 48 h. Total cellular RNA was extracted with TRIzol reagent (Sigma) according to the manufacturer’s recommendations. One microgram of total RNA was reverse transcribed using oligo-(dT)15 primers and avian myeloblastosis virus reverse transcriptase (Promega, Madison, WI, USA). Real-time PCR was conducted with a MiniOpticon system (BioRad, Hercules, CA, USA) using 5 μL of reverse transcription product iQ SYBR Green Supermix (Bio-Rad) and primers in a total volume of 20 μL. The standard thermal cycler conditions were employed as follows: 95 °C for 20 s and 40 cycles of 95 °C for 20 s, 56 °C for 20 s, and 72 °C for 30 s, followed by 95 °C for 1 min and 55 °C for 1 min. The threshold cycle (CT), which is the fractional cycle number when the amount of amplified target gene reaches a fixed threshold, was determined by MJ Opticon Monitor software. The mean threshold cycle (Ct) value for each transcript was normalized by dividing it by the mean Ct value of the β-actin transcript for that sample. Normalized transcript levels were expressed relative to those of the control samples. The real-time PCR primer sequences used are listed in Table 2.

Table 2. Sequences of Target Gene-Specific Primers Used in Real-Time PCR target gene realtime PCR

ALP OPN OCN OPG RANKL BMP2 Runx2

β-catenin β-actin

sequence sense antisense sense antisense sense antisense sense antisense sense antisense sense antisense sense antisense sense antisense sense antisense

5′-ATGCCCTGAAACTCCAAA-3′ 5′-AGACGCCCATACCATCTC-3′ 5′-GCTTGGCTTATGGACTGA-3′ 5′-GGCAACAGGGATGACATC-3′ 5′-CAGACAAGTCCCACACAG-3′ 5′-GCAGAGTGAGCAGAAAGA-3′ 5′-TGGGAGAAGAACCTTATTTTG-3′ 5′-CCAGCATCCTCTTTCATAAAG-3′ 5′-CCATGAAAACGCAGATTTG-3′ 5′-CCATGAAAACGCAGATTTG-3′ 5′-TGAGGATTAGCAGGTCTTTG-3′ 5′-CACAACCATGTTCCTGATAAT-3′ 5′-TGCTTCATTCGCTACACAAA-3′ 5′TTGCAGTCTTCCTGGAGAAAGTT3′ 5′-CCGTTCGCCTTCATTATGGA-3′ 5′-CCTAACTAAGCTTTGGAACGG-3′ 5′-AAGGCCAACCGTGAAAAGAT-3′ 5′-GTGGTACGACCAGAGGCATAC-3′ 440

DOI: 10.1021/acs.jnatprod.6b00964 J. Nat. Prod. 2017, 80, 434−442

Journal of Natural Products

Article

8.9 μm. The morphometric index of the bone region was measured from microtomographic data using 3D imagery. Bone morphometric parameters, including bone volume (BV/TV), trabecular thickness (Tb.Th), trabecular separation (Tb.Sp), trabecular number (Tb.N), bone mineral density (BMD), and structure model index (SMI), were calculated with the CTan software (SkyScan, Kontich, Belgium). Serum Levels of Bone Markers. Serum calcium (Ca) and phosphorus (P) were evaluated as previously described.50 Serum concentrations of ALP and OCN were assayed using an ELISA kit (Biomedical Technologies Inc., Stoughton, MA, USA) and QuantiChrome ALP assay kit (DALP-250, BioAssay Systems, CA, USA) according to the manufacturer’s instructions, respectively. The serum level of CTx, which is related to bone resorption, with a high level indicating excessive osteoclastic activity, was also analyzed using a commercial ELISA kit (Serum CrossLaps, Nordic Bioscience, Herlev, Denmark). The TRAP concentration was determined by Mouse TRAP assay (Suomen Bioanalytikka Oy, Turku, Finland) as described in the kit. The serum protein levels were determined by comparison with a standard curve prepared from standards provided with the assays. Statistical Analysis. All experiments were repeated a minimum of three times. The data are presented as the mean ± SD for the indicated number of independently performed experiments. Statistical analyses were conducted with SPSS 23.0 software (SPSS, Chicago, IL, USA). The statistical significance within a parameter was evaluated by one-way analysis of variation (ANOVA) coupled with Dunnett’s t-test.

■

(12) Zhang, J. F.; Li, G.; Chan, C. Y.; Meng, C. L.; Lin, M. C.; Chen, Y. C.; He, M. L.; Leung, P. C.; Kung, H. F. Mol. Cell. Endocrinol. 2010, 314, 70−74. (13) Park, K. H.; Kang, J. W.; Lee, E. M.; Kim, J. S.; Rhee, Y. H.; Kim, M.; Jeong, S. J.; Park, Y. G.; Kim, S. H. J. Pineal Res. 2011, 51, 187− 194. (14) Dougall, W. C.; Chaisson, M. Cancer Metastasis Rev. 2007, 25, 541−549. (15) Rodan, G. A.; Martin, T. J. Science 2000, 289, 1508−1514. (16) Bord, S.; Ireland, D. C.; Beavan, S. R.; Compston, J. E. Bone 2003, 32, 136−141. (17) Ross, F. P.; Teitelbaum, S. L. Immunol. Rev. 2005, 208, 88−105. (18) Takayanagi, H.; Sato, K.; Takaoka, A.; Taniguchi, T. Immunol. Rev. 2005, 208, 181−193. (19) Tian, J.; Ye, X.; Shang, Y.; Deng, Y.; He, K.; Li, X. J. Sep. Sci. 2012, 35, 2659−2664. (20) Lee, M. K.; Choi, O. G.; Park, J. H.; Cho, H. J.; Ahn, M. J.; Kim, S. H.; kim, Y. C.; Sung, S. H. J. Sep. Sci. 2007, 30, 2345−2350. (21) Qi, J.; Chen, J. J.; Cheng, Z. H.; Zhou, J. H.; Yu, B. Y.; Qiu, S. X. Phytochemistry 2006, 67, 1372−1377. (22) Inaba, K.; Murata, K.; Naruto, S.; Matsuda, H. J. Nat. Med. 2010, 64, 219−222. (23) Sanders, M.; Grundmann, O. Altern. Med. Rev. 2011, 16, 228− 238. (24) Chrubasik, J. E.; Roufogalis, B. D.; Chrubasik, S. Phytother. Res. 2007, 21, 675−683. (25) Colas, C.; Popot, M. A.; Garcia, P.; Bonnaire, Y.; Bouchonnet, S. Biomed. Chromatogr. 2008, 22, 912−917. (26) Abdelouahab, N.; Heard, C. M. Planta Med. 2008, 74, 527−531. (27) Qi, J.; Li, N.; Zhou, J. H.; Yu, B. Y.; Qiu, S. X. Planta Med. 2010, 76, 1892−1896. (28) Baghdikian, B.; Lanhers, M. C.; Fleurentin, J.; Ollivier, E.; Maillard, C.; Balansard, G.; Mortier, F. Planta Med. 1997, 63, 171− 176. (29) Chung, H. J.; Cho, L.; Shin, J. S.; Lee, J. H.; Ha, I. H.; Park, H. J.; Lee, S. K. BMC Complementary Altern. Med. 2014, 14, 184. (30) Loew, D.; Möllerfeld, J.; Schrödter, A.; Puttkammer, S.; Kaszkin, M. Clin. Pharmacol. Ther. 2001, 69, 356−364. (31) Clarkson, C.; Staerk, D.; Hansen, S. H.; Smith, P. J.; Jaroszewski, J. W. J. Nat. Prod. 2006, 69, 1280−1288. (32) Owen, T. A.; Aronow, M. S.; Barone, L. M.; Bettencourt, B.; Stein, G. S.; Lian, J. B. Endocrinology 1991, 128, 1496−1404. (33) Katagiri, T.; Yamaguchi, A.; Ikeda, T.; Yoshiki, S.; Wozney, J. M.; Rosen, V.; Wang, E. A.; Tanaka, H.; Omura, S.; Suda, T. Biochem. Biophys. Res. Commun. 1990, 172, 295−299. (34) Isama, K.; Tsuchiya, T. Biomaterials 2003, 24, 3303−3309. (35) Pilichou, A.; Papassotiriou, I.; Michalakakou, K.; Fessatou, S.; Fandridis, E.; Papachristou, G.; Terpos, E. Clin. Biochem. 2008, 41, 746−749. (36) Zhang, R.; Oyajobi, B. O.; Harris, S. E.; Chen, D.; Tsao, C.; Deng, H. W.; Zhao, M. Bone 2013, 52, 145−156. (37) Hayashi, K.; Yamaguchi, T.; Yano, S.; Kanazawa, I.; Yamauchi, M.; Yamamoto, M.; Sugimoto, T. Biochem. Biophys. Res. Commun. 2009, 379, 261−266. (38) Rodríguez-Carballo, E.; Ulsamer, A.; Susperregui, A. R.; Manzanares-Céspedes, C.; Sánchez-García, E.; Bartrons, R.; Rosa, J. L.; Ventura, F. J. Bone Miner. Res. 2011, 26, 718−729. (39) Lo, Y. C.; Chang, Y. H.; Wei, B. L.; Huang, Y. L.; Chiou, W. F. J. Agric. Food Chem. 2010, 58, 6643−6649. (40) Teitelbaum, S. L. Science 2000, 289, 1504−1508. (41) Suda, T.; Takahashi, N.; Udagawa, N.; Jimi, E.; Gillespie, M. T.; Martin, T. J. Endocr. Rev. 1999, 20, 345−357. (42) Hotokezaka, H.; Sakai, E.; Ohara, N.; Hotokezaka, Y.; Gonzales, C.; Matsuo, K.; Fujimura, Y.; Yoshida, N.; Nakayama, K. J. Cell. Biochem. 2007, 101, 122−134. (43) Frolik, C. A.; Bryant, H. U.; Black, E. C.; Magee, D. E.; Chandrasekhar, S. Bone 1996, 18, 621−627.

AUTHOR INFORMATION

Corresponding Author

*Tel: +82-2-880-2475. Fax: +82-2-762-8322. E-mail: sklee61@ snu.ac.kr. ORCID

Sang Kook Lee: 0000-0002-4306-7024 Author Contributions #

H. J. Chung and J. H. Lee contributed equally to this work.

Notes

The authors declare no competing financial interest.

■

ACKNOWLEDGMENTS This work was supported by a grant from Jaseng Medical Foundation (5257-20150004).

■

REFERENCES

(1) Alexander, J. M.; Bab, I.; Fish, S.; Müller, R.; Uchiyama, T.; Gronowicz, G.; Nahounou, M.; Zhao, Q.; White, D. W.; Chorev, M.; Gazit, D.; Rosenblatt, M. J. Bone Miner. Res. 2001, 16, 1665−1673. (2) Hohenhaus, M. H.; McGarry, K. A.; Col, N. F. Drugs 2007, 67, 2311−2321. (3) Stein, G. S.; Lian, J. B. Endocr. Rev. 1993, 14, 424−442. (4) Papachroni, K. K.; Karatzas, D. N.; Papavassiliou, K. A.; Basdra, E. K.; Papavassiliou, A. G. Trends Mol. Med. 2009, 15, 208−216. (5) Harada, S.; Rodan, G. A. Nature 2003, 423, 349−355. (6) Rahman, M. M.; Bhattacharya, A.; Fernandes, G. J. Lipid Res. 2006, 47, 1739−1748. (7) Boyle, W. J.; Simonet, W. S.; Lacey, D. L. Nature 2003, 423, 337−342. (8) Teitelbaum, S. L. J. Bone Miner. Metab. 2000, 18, 344−349. (9) Khosla, S. Endocrinology 2001, 142, 5050−5055. (10) Yasuda, H.; Shima, N.; Nakagawa, N.; Mochizuki, S. I.; Yano, K.; Fujise, N.; Sato, Y.; Goto, M.; Yamaguchi, K.; Kuriyama, M.; Kanno, T.; Murakami, A.; Tsuda, E.; Morinaga, T.; Higashio, K. Endocrinology 1998, 139, 1329−1337. (11) Lee, S. S.; Sharma, A. R.; Choi, B. S.; Jung, J. S.; Chang, J. D.; Park, S.; Salvati, E. A.; Purdue, E. P.; Song, D. K.; Nam, J. S. Biomaterials 2012, 33, 4251−4263. 441

DOI: 10.1021/acs.jnatprod.6b00964 J. Nat. Prod. 2017, 80, 434−442

Journal of Natural Products

Article

(44) Sato, M.; Bryant, H. U.; Iversen, P.; Helterbrand, J.; Smietana, F.; Bemis, K.; Higgs, R.; Turner, C. H.; Owan, I.; Takano, Y.; Burr, D. B. J. Pharmacol. Exp. Ther. 1996, 279, 298−305. (45) Cano, A.; Dapía, S.; Noguera, I.; Pineda, B.; Hermenegildo, C.; del Val, R.; Caeiro, J. R.; García-Pérez, M. A. Osteoporosis Int. 2008, 19, 793−800. (46) Bahlous, A.; Kalai, E.; Hadj Salah, M.; Bouzid, K.; Zerelli, L. Tunis Med. 2006, 84, 751−757. (47) Chen, W. F.; Wong, M. S. Br. J. Nutr. 2006, 95, 1039−1047. (48) Bhargavan, B.; Gautam, A. K.; Singh, D.; Kumar, A.; Chaurasia, S.; Tyagi, A. M.; Yadav, D. K.; Mishra, J. S.; Singh, A. B.; Sanyal, S.; Goel, A.; Maurya, R.; Chattopadhyay, N. J. Cell. Biochem. 2009, 108, 388−399. (49) Takahashi, N.; Yamada, H.; Yosiki, S.; Roodman, G. D.; Mundy, G. R.; Jones, S. J.; Boyde, A.; Suda, T. Endocrinology 1998, 122, 1373− 1382. (50) Zhang, Y.; Lai, W. P.; Leung, P. C.; Wu, C. F.; Wong, M. S. Biol. Pharm. Bull. 2007, 30, 898−903.

■

NOTE ADDED AFTER ASAP PUBLICATION This paper was published on the Web on January 20, 2017, with an error in the structure of harpagoside. The corrected version reposted on January 26, 2017, now shows the methyl group.

442

DOI: 10.1021/acs.jnatprod.6b00964 J. Nat. Prod. 2017, 80, 434−442