Antidiabetic and Antihyperlipidemic Properties of a Triterpenoid

Article pubs.acs.org/JAFC

Antidiabetic and Antihyperlipidemic Properties of a Triterpenoid Compound, Dehydroeburicoic Acid, from Antrodia camphorata in Vitro and in Streptozotocin-Induced Mice Yueh-Hsiung Kuo,†,‡ Cheng-Hsiu Lin,§ and Chun-Ching Shih*,# †

Department of Chinese Pharmaceutical Sciences and Chinese Medicine Resources, China Medical University, Taichung City 40402, Taiwan ‡ Department of Biotechnology, Asia University, Taichung City 41354, Taiwan § Department of Internal Medicine, Fengyuan Hospital, Ministry of Health and Welfare, Fengyuan District, Taichung City 42055, Taiwan # Graduate Institute of Pharmaceutical Science and Technology, College of Health Science, Central Taiwan University of Science and Technology, 666 Buzih Road, Beitun District, Taichung City 40601, Taiwan ABSTRACT: The aim of this study was to examine the effects of dehydroeburicoic acid (TT) on type 1 diabetes mellitus and dyslipidemia in streptozotocin (STZ)-induced diabetic mice. STZ-induced diabetic mice were randomly divided into six groups and given orally by gavage TT (at three dosages), metformin (Metf), fenfibrate (Feno), or vehicle for 4 weeks. STZ-induced diabetic mice showed elevations in blood glucose levels (P < 0.001). TT treatment markedly decreased blood glucose levels by 42.6−46.5%. Moreover, STZ-induced diabetic mice displayed an increase in circulating triglyceride (TG) and total cholesterol (TC) levels (P < 0.001 and P < 0.01, respectively) but a decrease in blood insulin and adiponectin levels (P < 0.01 and P < 0.05, respectively). These substances are also reversed by TT treatment, indicating TT ameliorated diabetes and dyslipidemia. Membrane skeletal muscular expression levels of glucose transporter 4 (GLUT4) and expression levels of AMPK phosphorylation (phospho-AMPK) in both liver and skeletal muscle were reduced in STZ-induced diabetic mice, which normalized upon TT treatment and correction of hyperglycemia accompanied with a decrease in mRNA levels of phosphoenolpyruvate carboxykinase (PEPCK) and glucose-6-phosphatase (G6 Pase), which was related to the inhibition of hepatic glucose production and attenuating diabetic state. In addition, TT also showed hypolipidemic effect by increasing hepatic expression levels of peroxisome proliferator-activated receptor α (PPARα) and mRNA levels of carnitine palmitoyl transferase Ia (CPT-1a) but decreasing expression levels of fatty acid synthase (FAS), which further contributed to a decrease in circulating TG levels. TT-treated mice displayed decreased SREBP2 mRNA levels and reduced blood TC levels. These findings strongly support that TT prevents diabetic and dyslipidemic states in STZ-induced diabetic mice evidenced by regulation of GLUT4, PPARα, FAS, and phosphorylation of AMPK. KEYWORDS: dehydroeburicoic acid, Antrodia camphorata, diabetes, streptozotocin, AMP-activated protein kinase phosphorylation, glucose transporter 4, peroxisome proliferator-activated receptor α, fatty acid synthase

■

INTRODUCTION Diabetes mellitus type 1 (also known as type 1 DM) is a metabolic disorder characterized by chronic hyperglycemia, and the pathophysiology is a destruction of β-cells in the pancreas. Type 1 diabetes causes an estimated 5−10% of all diabetes cases.1 Type 1 diabetes is associated with many complications, and those are considered the causes of morbidity and mortality in patients with diabetes. Treatment of type 1 diabetes focuses on lowering blood glucose to the near normal range to avoid long-term complications that affect the nervous and cardiovascular systems.2 There are several methods employed to induce type 1 diabetes mellitus in the laboratory. Streptozotocin (STZ), a diabetogenic agent with pancreatic β-cell toxicity ability, is convenient and simple to use for producing chemically induced diabetes models when administered in a single large dose or in repeated low doses for several days.3 STZ is widely used in inducing experimental animal models with type 1 DM.4 The STZ-induced diabetic rodent model is usually characterized by © XXXX American Chemical Society

fasting or nonfasting hyperglycemia and lowered serum insulin levels with hyperlipidemia; however, insulin resistance is often absent in these models.5,6 Due to this limitation, although these models cannot be considered as appropriate models for T2D, they can be used for the screening of antihyperglycemic or insulinotropic drugs and natural medicines.5,6 The body weight, strain, and gender of animals also influenced the development of diabetes in STZ model.4−7 Antrodia camphorata (AC; Polyporaceae, Aphyllophorales) is a parasitic microorganism found on the wall of the inner cavity of Cinnamomum kanehirai Hay. The fruiting body and cultured mycelia contain fatty acids, lignans, phenyl derivatives, sesquiterpenes, steroids, and triterpenoids.8 A recent study has revealed that the fermented culture broth exhibited Received: September 8, 2015 Revised: October 26, 2015 Accepted: October 27, 2015

A

DOI: 10.1021/acs.jafc.5b04400 J. Agric. Food Chem. XXXX, XXX, XXX−XXX

Journal of Agricultural and Food Chemistry

■

cytotoxic,9 anti-inflammation,10 and vasorelation activities.11 The solid culture of fruiting body and the filtrate in submerged culture showed protective activity against CCl4-induced hepatic toxicity and antioxidant property.12,13 Dehydroeburicoic acid (TT) (Figure 1) has been isolated from Poria cocos14 and AC.15

Article

MATERIALS AND METHODS

Chemicals. Antibodies of GLUT4, structural proteins GAPDH, FAS, PPARγ, and β-actin were purchased from Santa Cruz Biotechnology (Santa Cruz, CA, USA); phospho-AMPK and PPARα was obtained from Abcam Inc. (Cambridge, MA, USA); total AMPK was from Cell Signaling Technology, Inc. (Danvers, MA, USA). Secondary antibody anti-rabbit was from Jackson ImmunoResearch Laboratories, Inc. (West Grove, PA, USA). Isolation and Determination of the Active Compound. The mycelium of Antrodia camphorata (=Antrodia cinnamomea) was provided from the Konald Biotech Co. Limited, Chiayi City, Taiwan. A voucher specimen (CMPC286) was deposited at and identified by the Institute of Chinese Pharmaceutical Sciences, China Medical University. Freeze-dried powders of the mycelia of AC (3.0 kg) were extracted three times with methanol (12 L) at room temperature (4 days × 3). The methanol extract was evaporated in vacuo to give a brown residue, which was suspended in H2O (1 L) and then partitioned with ethyl acetate (1 L × 3). The EtOAc fraction (200 g) was chromatographed on silica gel using mixtures of hexane and EtOAc of increasing polarity as eluents and further purified with HPLC. Dehydroeburicoic acid (TT) was isolated by HPLC on a Hibar prepacked column RT 250-10 with chloroform/ethyl acetate (7:1) and a refractive index (RI) (Knauer RI detector 2400). The flow rate was 3 mL/min, and the injection volumes of samples were 100 μL. The yields of TT obtained were about 0.2% (w/w). The purity of TT was >99%.24 TT: 1H NMR (300 MHz, pyridine-d5) δ 1.90 (2H, m, H-2), 3.43 (1H, t, J = 7.5 Hz, H-3), 1.26 (1H, m, H-5), 2.16 (2H, m, H-6), 5.61 (1H, d, J = 5.2 Hz, H-7), 5.36 (1H, d, J = 5.1 Hz, H-11), 2.50 (1H, H12α), 2.33 (1H, br s, H-12β), 1.02 (3H, s, H-18), 1.08 (3H, s, H-19), 2.64 (1H, td, J = 11.0, 3.0 Hz, H-20), 2.29 (1H, m, H-25), 1.03, 1.04 (3H each, d, J = 7.5 Hz, H-26 and H-27), 4.88 (1H, br s, H-28α), 4.92 (1H, br s, H-28β), 1.09 (3H, s, H-29), 1.22 (3H, s, H-30), and 1.14 (3H, s, H-31). Cell Culture. C2C12 skeletal myoblasts (ATCC, CRL-1772) were maintained in growth media consisting of Dulbecco’s modified Eagle’s medium (DMEM) (Gibco BRL) supplemented with 10% fetal bovine serum (FBS) (Hyclone) and 100 U/mL penicillin/100 μg/mL streptomycin (Gibco BRL) and split 1:4 using 0.05% trypsin when 80% confluent. Myoblasts were diluted and placed in a 9 cm dish. Cells were cultured to achieve 80−90% confluency, and growth medium was changed as 2% FBS/DMEM every 24 h for 5−7 days. Determination of GLUT4 and Phospho-Akt (Ser 473)/Total Akt Proteins in Vitro. The following experiment was performed as previously described.25,26 Differentiated C2C12 cells were serumstarved in DMEM/BSA (2 h at 37 °C) prior to incubation either with test compounds (TT at 1, 5, 10, and 25 μg/mL) or with vehicle (DMSO containing saline, final concentration of DMSO = 0.2%) for 30 min or with 100 nM insulin for 25 min. Following treatment, cells were washed three times with ice-cold PBS and separated into two portions. A portion of the cells was subsequently lysed in RIPA buffer (50 mM Tris-HCl, pH 8, 150 mM NaCl, 1% NP-40, 0.5% sodium deoxycholate, 0.1% SDS) supplemented with complete protease inhibitor cocktail (Roche) and phosphatase inhibitors and then centrifuged at 20000g for 200 min. Supernatant protein was collected and stored at −20 °C. Another portion of cells was homogenized with buffer (250 mmol/L sucrose, 50 mmol/L Tris, and 0.2 mmol/L edetic acid, pH 7.4) at 4 °C, as previously described.27 The homogenates were centrifuged at 9000g for 10 min (4 °C). The pellet was suspended with 0.5 mL of homogenization buffer and then centrifuged, repeated three times. The three supernatants were collected, mixed, and centrifuged at 190000g for 60 min (4 °C). The pellet was resuspended with 0.2 mL of homogenization buffer, stored at −20 °C, and performed within membrane. Protein concentration was determined via BCA assay (Pierce). Equal amounts of protein were then diluted four times in SDS sample buffer and subjected to SDS-PAGE and were detected by Western blotting with antibodies specific for Akt, phosph-Akt Ser473, and GLUT4. The

Figure 1. Chemical structure of dehydroeburicoic acid (TT).

However, the antidiabetic and antihyperlipidemic effects of TT from the mycelia of A. camphorata are not well-defined in STZinduced diabetic mice. The major cellular mechanism that diminishes blood glucose when carbohydrates are ingested is insulin-stimulated glucose transport into skeletal muscle.16 The principal glucose transporter protein that mediates this uptake is glucose transporter 4 (GLUT4), which plays a key role in the regulation during blood glucose homeostasis.16 The major cellular mechanism for disposal of exogenous glucose load is insulin-stimulated glucose transport into skeletal muscle. GLUT4 is proposed to be a key determinant of glucose homeostasis.16 Insulin stimulates glucose uptake in skeletal muscle and adipose cells primarily by inducing net translocation of GLUT4 from the intracellular storage sites to the plasma membrane.17 Impairment of GLUT4 expression, GLUT4 translocation, and/or insulin signaling may affect insulin-stimulated glucose uptake and would result in insulin resistance and hyperglycemia.18,19 These highlight a potential role of the improvement of GLUT4 contents and/or translocation to the plasma membrane in the treatment of diabetes mellitus. GLUT4 translocation is mainly regulated by two pathways: the insulin signaling pathway and the AMP-activated protein kinase (AMPK) pathway.16 AMPK is also proposed to regulate GLUT4 translocation.16 However, the antidiabetic activity of TT is not well-defined. AMPK is considered as a therapeutic target for the treatment of diabetes and dyslipidemia.20,21 Activation of the AMPK results in increased lipid and glucose catabolism.22 Phosphorylation of Thr 172 of α subunits is essential for AMPK activity.23 In this study, we determined whether TT directly regulated GLUT4 protein expression in cultured C2C12 myotube cells incubated with either insulin or TT. To assess whether changes in glycemia regulated GLUT4 and phospho-AMPK expression in vivo, we studied skeletal muscle and liver tissue from STZ-induced mice, an animal model of type 1 diabetes. On the basis of one of the possible mechanisms, we also investigated whether TT regulated expression of genes involved in antidiabetes, lipogenesis, and triglyceride lipase in the liver tissue, including phosphoenolpyruvate caboxykinase (PEPCK), glucose 6-phosphoatase (G6 Pase), peroxisome proliferator-activated receptor α (PPAR)α, fatty acid synthase (FAS), and diacyl glycerol acyltransferase 2 (DGAT2). B


Article


Figure 2. Effect of dehydroeburicoic acid (TT) on GLUT4 and phospho-Akt/total-Akt in vitro: (A) representative blots for TT in C2C12 myoblasts cells; (B) quantification of the GLUT4 protein contents and the ratio of phospho-Akt to total Akt. C2C12 skeletal myoblasts cells were treated with TT compounds as described under Materials and Methods, and equal amounts of lysates were resolved by SDS-PAGE and blotted for GLUT4, Akt, and phospho-Akt (Ser473). All values are means ± SE. (∗) P < 0.05, (∗∗) P < 0.01, and (∗∗∗) P < 0.001 compared with the control group. density blotting was analyzed using Alpha Easy FCsoftware (Alpha Innotech Corp., Randburg, South Africa). Animal Treatment. Male C57BL/6J mice, at the age of 4 weeks, were obtained from the National Laboratory Animal Breeding and Research Center, Ministry of Science and Technology. The study protocol was approved by the guidelines of the Institutional Animal Care and Use Committee of Central Taiwan University of Science and Technology. The study protocol was performed as previously described.28 Diabetes was induced by intraperitoneal injection of streptozotocin (Sigma Chemical, St. Louis, MO, USA) for 5 consecutive days. The dosage of STZ was 55 mg/kg (dissolved in 0.05 M cold sodium citrate buffer, pH 4.5). The normal control mice received only citrate buffer of the same volume. After 2 weeks, the mice with severe diabetes exhibiting hyperglycemia (fasting blood glucose range of >250 mg/dL) were considered as diabetic and selected for the experiment. Diabetic mice were randomly divided into five groups and were treated with either vehicle (distilled water), TT (TT1:10, TT2:20, or TT3:40 mg/kg), metformin (300 mg/kg), or fenofibrate (Feno) (250 mg/kg) in a similar volume. The vehicle, TT, Metf, or Feno was administered by oral gavage one time per day for another 28 days. During the experiment, all mice were fasted overnight, and blood was collected from the retro-orbital sinus. After dosing for 4 weeks, food was removed from the mice at night, and on the next day, the mice after 12 h of fasting were sacrificed. All of the individual tissues were collected and weighed, and parts of tissues were instantly frozen at −80 °C for later target gene analysis.29−32 A portion of the acquired blood samples (0.8 mL) was immediately taken for

analysis of blood glucose level and a portion for analysis of TG, TC, insulin, leptin, and adiponectin levels. Fasting Blood Glucose and Biochemical Parameters Assay. A portion of the obtained blood samples from the retro-orbital sinus of fasting mice was employed to assess blood glucose levels as previously described.31,32 Blood TG, total cholesterol (TC), and free fatty acids were measured. Adipocytokine Levels Assay. The levels of blood insulin, leptin, and adiponectin were analyzed using a commercial assay kit (mouse insulin ELISA kit, Mercodia, Uppsala, Sweden; mouse leptin ELISA kit, Morinaga, Yokohama, Japan; Mouse Adiponectin ELISA kit, Crystal Chem International, Downers Grove, IL, USA) as previously described.31,32 Histology. Parts of EWAT and liver tissue specimens were investigated as previously described.31,32 Microscopic images were taken using a microscope (Olympus BX51, BX51, Olympus, Tokyo, Japan). Relative Quantization of mRNA Indicating Gene Expression Assay. The experiment was determined using a procedure described elsewhere,29−32 and the primers are described in Table 1. Western Blotting Assay. Protein extractions and immunoblots for the determination of GLUT4 and phospho-AMPK (Thr172) proteins were performed by skeletal muscle and liver tissue of mice and have been described in detail elsewhere.26,30−32 PPARα, PPARγ, and FAS proteins were performed by the liver and white asipose tissue of mice. Skeletal muscle from mice was subjected to GLUT4 expression level analysis, and the total membrane fractions were collected with buffer and determined using a described proceC


Article

Journal of Agricultural and Food Chemistry Table 1. Primers Used in This Study gene

accession no.

forward primer and reverse primer Liver F: CTACAACTTCGGCAAATACC R: TCCAGATACCTGTCGATCTC

PCR product (bp)

annealing temperature (°C)

330

51

PEPCK

NM_011044.2

G6 Pase

NM_008061.3

F: GAACAACTAAAGCCTCTGAAAC R: TTGCTCGATACATAAAACACTC

350

50

PPARα

NM_011144

F: ACCTCTGTTCATGTCAGACC R: ATAACCACAGACCAACCAAG

352

49

SREBP1c

NM_011480

F: GGCTGTTGTCTACCATAAGC R: AGGAAGAAACGTGTCAAGAA

219

48

DGAT2

NM_026384.3

F: AGTGGCAATGCTATCATCATCGT R: AAGGAATAAGTGGGAACCAGATCA

149

50

CPT1a

NM_153679

F: GCAGGAAATTTACCTCTGTG R: ACATGAAGGGTGAAGATGAG

288

51

SREBP2

AF289715.2

F: ATATCATTGAAAAGCGCTAC R: ATTTTCAAGTCCACATCACT

256

48

GAPDH

NM_008084.3

F: TGTGTCCGTCGTGGATCTGA R: CCTGCTTCACCACCTTCTTGA

99

55

dure.26,30−32 The protein contents of GLUT4, phospho-AMPK, and total AMPK were detected by Western blotting and determined as described.26,30−32 Statistical Analysis. All results are presented as the mean and standard error (SE). Whenever possible, data were subjected to analysis of variance, followed by Dunnett’s multiple-range tests, using SPSS software (SPSS Inc., Chicago, IL, USA). P < 0.05 was considered to be statistically significant.

group (P < 0.001, P < 0.01, and P < 0.05, respectively). TT3 and Metf treatment showed an increase in the weights of brown adipose tissue (BAT) compared with the STZ group (P < 0.05 and P < 0.05, respectively) (Table 2). Plasma Glucose Levels. At the beginning of the study, all of the mice started with similar blood glucose levels (85.7 ± 3.7 mg/dL). After STZ induction, blood glucose levels of the CON group were 87.1 ± 4.9. STZ-induced diabetic mice with blood glucose levels >240 mg/dL were selected for the experiment, and the glucose levels of the STZ diabetic mice were 259.8 ± 3.8 mg/dL. At the end of the experiment, the glucose levels of the STZ group were significantly greater than those of the CON group (P < 0.001). Treatment with TT1, TT2, TT3, Metf, or Feno showed a significant reduction in plasma glucose as compared with the STZ group (P < 0.001, P < 0.001, P < 0.001, P < 0.001, and P < 0.001, respectively). Treatment with TT2 or TT3 did not differentiate the CON group in blood glucose levels (Table 2). Plasma Lipid. At the end of the experiment, the levels of TG and TC were greater in the STZ group than those in the CON group (P < 0.001 and P < 0.001, respectively) (Table 2). TT1, TT2, TT3, Metf, or Feno treatment reduced free fatty acid levels compared with the STZ group (Table 2). Treatment with TT1, TT2, TT3, Metf, or Feno decreased the concentrations of TG as compared with the STZ group (P < 0.05, P < 0.01, P < 0.001, P < 0.01, and P < 0.01, respectively). TT1, TT2, TT3, Metf, or Feno treatment reduced TC levels compared with the STZ group (P < 0.001, P < 0.001, P < 0.001, P < 0.001, and P < 0.001, respectively). Treatment with TT1, TT2, TT3, Metf, or Feno did not differ from the CON group in both blood TG and TC levels (Table 2). Insulin, Leptin, and Adiponectin Levels. The concentrations of insulin were lower in the STZ group than in the CON group (P < 0.01). TT1-, TT2-, TT3-, Metf-, or Fenotreated groups significantly increased insulin levels as compared

■

RESULTS Expression Levels of Membrane GLUT4 and PhosphoAkt (Ser 473)/Total Akt in Vitro. At the end, the protein expressions of GLUT4 were higher in the insulin- and TTtreated (1, 5, 10, and 25 μg/mL) groups than in the CON group in C2C12 myotube cells (P < 0.001, P < 0.05, P < 0.05, P < 0.001, and P < 0.001, respectively). The levels of phosphoAkt (Ser 473)/total Akt proteins were higher in the insulin- and TT-treated (5 and 25 μg/mL) groups than in the CON group (P < 0.001, P < 0.001, and P < 0.001, respectively) (Figure 2). Body Weight, Body Weight Gain, Food Intake, and Tissue Weight. The body weight of all mice when they entered the animal room was 15.03 ± 0.17 g. After acclimatization, and at the beginning of STZ induction, body weights were 18.55 ± 0.19 g. At the beginning of dosing, the body weight of the CON group was 20.36 ± 0.76 g and that of the STZ mice was 19.59 ± 0.22 g. At the end of the experiment, there was no significant difference in body weight and food intake between the STZ-induced mice and the CON group (Table 2). Following the treatment, the body weight and food intake of TT-, Metf-, and Feno-treated groups did not differ from those of the STZ group. Treatment with TT3 and Feno decreased body weight gain (P < 0.01 and P < 0.05, respectively). TT3 and Feno treatment increased the liver weights compared with the STZ group (P < 0.01 and P < 0.05, respectively). TT3, Metf, and Feno treatment showed an increase in the weights of the liver compared with the CON D


E

0.947 ± 0.104 0.692 ± 0.080 0.099 ± 0.012 1.046 ± 0.102 1.235 ± 0.095# 3.678 ± 0.107 0.207 ± 0.007 0.252 ± 0.037 2.99 ± 0.21 22.11 ± 0.47 3.15 ± 0.04 1.09 ± 0.21 180.1 ± 5.3### 97.94 ± 2.47### 134.13 ± 5.40### 1.935 ± 0.041## 2.538 ± 0.014## 292.534 ± 10.572###

1.140 ± 0.058 0.784 ± 0.100 0.152 ± 0.028 1.292 ± 0.078 0.934 ± 0.066 3.505 ± 0.140 0.222 ± 0.017 0.162 ± 0.022 2.69 ± 0.32 23.05 ± 0.91 3.08 ± 0.06

1.18 ± 0.12 85.1 ± 3.3 85.05 ± 2.83 95.96 ± 2.05 2.373 ± 0.023 3.073 ± 0.017 27.635 ± 6.169

STZ

0.76 ± 0.07*## 103.3 ± 3.2***# 88.71 ± 1.40* 94.42 ± 2.49*** 2.222 ± 0.060* 2.982 ± 0.019* 192.275 ± 17.341*###

0.74 ± 0.12**## 97.3 ± 2.7*** 86.65 ± 1.53** 92.87 ± 1.72*** 2.426 ± 0.078*** 3.020 ± 0.026** 122.114 ± 24.854***#

0.783 ± 0.087## 0.709 ± 0.111 0.161 ± 0.031 0.944 ± 0.115# 1.112 ± 0.096 3.966 ± 0.171 0.193 ± 0.021 0.323 ± 0.026### 2.36 ± 0.27 20.91 ± 0.59 3.12 ± 0.05

20 mg/kg/day

10 mg/kg/day 0.778 ± 0.063## 0.562 ± 0.114 0.122 ± 0.029 0.900 ± 0.082# 1.162 ± 0.097 3.952 ± 0.138 0.213 ± 0.019 0.296 ± 0.012### 2.73 ± 0.38 22.99 ± 0.43 3.06 ± 0.04

STZ + TT2

STZ + TT1

0.69 ± 0.05***### 96.4 ± 3.0*** 78.55 ± 2.80*** 89.74 ± 2.82*** 2.642 ± 0.066***# 3.215 ± 0.032**## 121.787 ± 22.136***#

0.715 ± 0.068###* 0.720 ± 0.114 0.119 ± 0.014 0.834 ± 0.082## 1.128 ± 0.110 4.366 ± 0.153**### 0.215 ± 0.017 0.378 ± 0.020**### 1.66 ± 0.44* 21.00 ± 0.56 3.09 ± 0.07

40 mg/kg/day

STZ + TT3

0.74 ± 0.09**## 104.1 ± 4.3***## 86.34 ± 2.39** 100.39 ± 8.12*** 2.490 ± 0.054*** 3.015 ± 0.031** 185.985 ± 30.697*###

0.956 ± 0.047 0.758 ± 0.064 0.176 ± 0.023 1.132 ± 0.054 1.208 ± 0.149 4.168 ± 0.100## 0.230 ± 0.007 0.369 ± 0.018*### 2.32 ± 0.25 22.02 ± 0.62 3.14 ± 0.04

300 mg/kg/day

STZ + Metf

0.71 ± 0.10***### 102.1 ± 4.2***# 85.37 ± 1.19** 104.40 ± 3.00*** 2.551 ± 0.097*** 3.007 ± 0.038** 139.700 ± 32.596***###

0.743 ± 0.059## 0.795 ± 0.070 0.154 ± 0.016 0.889 ± 0.075# 1.292 ± 0.076# 4.016 ± 0.127*# 0.202 ± 0.017 0.319 ± 0.030### 1.94 ± 0.08* 22.39 ± 0.78 3.07 ± 0.09

250 mg/kg/day

STZ + Feno

TT1, TT2, and TT3, dehydroeburicoic acid (TT1:10, TT2:20, and TT3:40 mg/kg body weight); Metf, metformin (300 mg/kg body weight); Feno, fenofibrate (250 mg/kg body weight); EAWT, epididymal white adipose tissue; RWAT, retroperioneal white adipose tissue; MWAT, mesenteric white adipose tissue; visceral fat represented epididymal WAT plus retroperitoneal WAT; FFA, plasma free fatty acid; BAT, brown adipose tissue; skeletal muscle included quadriceps muscle, which contains four parts, rectus femoris, vastus intermedius, vastus lateralis, and vastus medialis. All values are means ± SE (n = 9). (#) P < 0.05, (##) P < 0.01, and (###) P < 0.001 compared with the control (CON) group. (*) P < 0.05, (**) P < 0.01, and (***) P < 0.001 compared with the high-fat plus vehicle (distilled water) (HF) group.

a

relative tissue wt (%) EWAT (%) MWAT (%) RWAT (%) visceral fat (%) skeletal muscle (%) liver (%) spleen (%) BAT (%) wt gain (g) final body wt (g) food intake (g/day/mouse) blood profiles FFA (mequiv/L) blood glucose (mg/dL) TG (mg/dL) TC (mg/dL) insulin (μg/L) adiponectin (μ/mL) leptin (ng/mL)

CON

Table 2. Effects of Dehydroeburicoic Acid (TT) on Absolute Tissue Weight, Food Intake, and Blood Lipida

Journal of Agricultural and Food Chemistry Article


Article


Figure 3. Histology of (A) epididymal white adipose tissue (WAT) and (B) liver tissue of mice in the control (CON), streptozotocin plus vehicle (distilled water) (STZ), STZ + TT1, STZ + TT2, STZ + TT3, STZ + metformin (Metf), or STZ + fenofibrate (Feno) groups by hematoxylin and eosin staining. Magnification: 10 (ocular) × 20 (object lens). TT1, TT2, and TT3, dehydroeburicoic acid (TT1, TT2, and TT3, 10, 20, and 40 mg/ kg body weight, respectively); Metf, metformin (300 mg/kg body weight); Feno, fenofibrate (250 mg/kg body weight).

with the STZ group (P < 0.05, P < 0.001, P < 0.001, P < 0.001, and P < 0.001, respectively) (Table 2). Treatment with TT3 increased blood insulin levels as compared with the CON group (P < 0.05). The concentrations of leptin were higher in the STZ group than in the CON group (P < 0.001). TT1-, TT2-, TT3-, Metf-, or Feno-treated groups significantly decreased leptin levels as compared with the STZ group (P < 0.05, P < 0.001, P < 0.001, P < 0.05, and P < 0.001, respectively) (Table 2). The concentrations of adiponectin were lower in the STZ group than in the CON group (P < 0.05). TT1-, TT2-, TT3-, Metf-, and Feno-treated groups significantly increased the levels of adiponectin as compared with the STZ group (P < 0.05, P < 0.01, P < 0.01, P < 0.01, and P < 0.01, respectively) (Table 2). Histology. STZ-induced adipocytes did not differ from the CON group in epididymal WAT (the average areas of adipocytes in the STZ group and CON group were 6274.8 ± 188.4 and 7150.1 ± 221.1 μm2, respectively). Treatment with TT3 (4910.5 ± 104.9 μm2) caused atrophy compared with the STZ group (Figure 3A). The average areas of the TT2-, Metf-, or Feno-treated mice were 5379.9 ± 187.2, 5308.9 ± 204.7, and 5373.8 ± 194.6 μm2, respectively. The STZ-induced group

showed slight ballooning of hepatocyte compared with the CON group. Afterward, treatment with TT1, TT2, TT3, Metf, or Feno exerted no ballooning phenomenon. These morphological results strongly suggest TT did not cause hepatic TG accumulation (Figure 3B). Hepatic Targeted Gene Expressions. As shown in Figure 4, the STZ induced higher mRNA levels of PEPCK, G6 Pase, sterol regulatory element binding protein 1c (SREBP1c), and DGAT2, whereas PPARα and carnitine palmitoyl transferase Ia (CPT1a) expressions were lower in the STZ group than in the CON group. Treatment with TT1, TT2, TT3, Metf, or Feno showed decreased mRNA levels of PEPCK, G6 Pase, SREBP1c, and DGAT2 relative to those in the CON group. Treatment with TT1, TT2, TT3, Metf, or Feno increased the mRNA level of PPARα (Figure 4). Targeted Gene Expression Levels in Different Tissues. As shown in Figure 5), at the end, the membrane expressions levels of GLUT4 were lower in the STZ group than in the CON group in skeletal muscle (P < 0.05). The expression levels of GLUT4 were greater in TT1-, TT2-, TT3-, Metf-, and Feno-treated groups than in the STZ group (P < 0.05, P < 0.01, P < 0.001, P < 0.001, and P < 0.001, respectively). At the end of F


Article


Figure 5. Phospho-AMPK (Thr172) protein contents in liver and skeletal muscle and GLUT4 protein contents in skeletal muscle of the mice by oral gavage dehydroeburicoic acid (TT): (A) representative image; (B) quantification of the GLUT4 expression levels and the ratio of phospho-AMPK to total AMPK (mean ± SE, n = 9). Protein was separated by 12% SDS-PAGE detected by Western blot. (#) P < 0.05, (##) P < 0.01, and (###) P < 0.001 compared with the control (CON) group; (∗) P < 0.05, (∗∗) P < 0.01, and (∗∗∗) P < 0.001 compared with the streptozotocin plus vehicle (distilled water) (STZ) group. TT1, TT2, and TT3, dehydroeburicoic acid (TT1, TT2, and TT3, 10, 20, and 40 mg/kg body weight, respectively); Metf, metformin (300 mg/kg body weight); Feno, fenofibrate (250 mg/kg body weight).

the experiment, the expression levels of phospho-AMPK/total AMPK were lower in the STZ group than in the CON group in skeletal muscle and liver (P < 0.01 and P < 0.05, respectively). After the treatment, the expression levels of phospho-AMPK/ total AMPK were increased in skeletal muscle in the TT1-, TT2-, TT3-, Metf-, and Feno-treated groups (P < 0.001, P < 0.001, P < 0.001, P < 0.001, and P < 0.001, respectively). Following the treatment, the muscular expression levels of phospho-AMPK/total AMPK were increased in the TT1-, TT2-, TT3-, Metf-, and Feno-treated groups compared with the STZ group (P < 0.05, P < 0.01, P < 0.001, P < 0.01, and P < 0.01, respectively) (Figure 5). As shown in Figure 6, at the end, the expression levels of PPARα were lower in the STZ group than in the CON group in the liver (P < 0.001). After the treatment, the expression levels of PPARα were increased in the liver in the TT1-, TT2-, TT3-, Metf-, and Feno-treated groups (P < 0.001, P < 0.001, P < 0.001, P < 0.001, and P < 0.001, respectively). The expression levels of FAS and PPARγ were higher in the STZ group than in the CON group in the liver (P < 0.01 and P < 0.001, respectively). After the treatment, the

Figure 4. Semiquantative RT-PCR analysis on PEPCK, G6 Pase, PPARα, SREBP1c, DGAT2, CPT1a, and SREBP2 mRNA levels in liver tissue of the mice by oral gavage dehydroeburicoic acid (TT1, TT2, and TT3, 10, 20 and 40 mg/kg body weight, respectively), metformin (Metf; 300 mg/kg body weight), or fenofibrate (Feno; 250 mg/kg body weight): (A) representative image; (B, C) quantification of the ratio of target gene to GAPDH mRNA expression. Total RNA (1 μg) isolated from tissue was reverse transcripted by MMLV-RT; 10 μL of RT products were used as templates for PCR. The expression levels of PEPCK, G6 Pase, PPARα, SREBP1c, DGAT2, CPT1a, and SREBP2 mRNA were measured and quantified by image analysis. Values were normalized to GAPDH mRNA expression. All values are means ± SE (n = 9). (#) P < 0.05, (##) P < 0.01, and (###) P < 0.001 compared with the control (CON) group. (∗) P < 0.05, (∗∗) P < 0.01, and (∗∗∗) P < 0.001 compared with the streptozotocin plus vehicle (distilled water) (STZ) group. G


Article


expression levels of FAS and PPARγ were decreased in the liver in the TT1-, TT2-, TT3-, Metf-, and Feno-treated groups. The expression levels of PPARγ and FAS were higher in the STZ group than in the CON group in adipose tissue (P < 0.001 and P < 0.001, respectively). After the treatment, the expression levels of PPARγ and FAS were decreased in adipose tissue in the TT1-, TT2-, TT3-, Metf-, and Feno-treated groups (Figure 6).

■

DISCUSSION The present study found TT elevated GLUT protein levels in vitro for the first time, as evidenced by enhanced levels of GLUT4 in C2C12 myotube cells. Because GLUT4 is a key determinant of glucose homeostasis,16 the present study was designed to investigate whether TT could display reduced blood glucose in STZ-induced diabetic mice and compared with the antidiabetic drug, metformin. STZ-induced diabetic model was employed as type 1 diabetic models.4 Although STZ is known to damage pancreatic β-cells, the final outcome depends on the doses, how many treatments, etc. In the present animal study, despite the STZ injection induced hyperglycemia, which was consistent with a previous report,33 it did not change the body weight. Thus, this animal model is not a typical type 1 diabetes model. Nevertheless, this animal model could be used for the screening of antihyperglycemic or insulinotropic drugs and natural medicines.5,6 Collectively, it was found that TT treatment exhibited both antidiabetic and antihyperlipidemic effects in STZ-induced mice. In the present study, metformin reduced blood glucose levels, which is consistent with earlier observations.34 We observed TT treatment strikingly decreased blood glucose levels by 42.6−46.5% (under much lower dosage); the antihyperglycemic activity of TT at 10 mg/kg/ day dosage was comparable to that antidiabetic agents such as metformin, and the glucose-lowering effect of TT at 20 and 40 mg/kg/day is more effective than that of either Metf or Feno. Feno has been shown to display good glycemic control.35 Our findings imply that TT displayed excellent antidiabetic effects. The antidiabetic effect of TT is partly associated with the increased insulin levels. The insulin levels of TT at 20 mg/kg/ day dosage were comparable to that of metformin, and the enhanced insulin effect of TT at 40 mg/kg/day is more effective than that of Metf or Feno. Moreover, we also observed TT at 40 mg/kg/day dosage displayed significant blood glucose lowering effects owing to the molecular mechanism of dramatically enhanced membrane expression level of GLUT4 and increased phospho-AMPK/total-AMPK in both skeletal muscle and liver tissue; these molecular effects are more effective than those in the Metf-treated group. On the other hand, in the present study, STZ-induced diabetic mice displayed increases in blood triglyceride and total cholesterol levels, which are consistent with prior reports.36,37 Both circulating triglyceride and total cholesterol levels were reduced following treatment with TT. In the present study, the triglyceride-lowering effect of TT is comparable to that of Feno, which is a PPARα agonist with triglyceride-lowering effect.35,38 Moreover, TT displayed a total cholesterol-lowering effect (29.6−33.09%) that was more effective than that in the Fenotreated group (22.16%). These results reflect that TT, Metf, and Feno decreased plasma triglycerides, hepatic steatosis, and total cholesterol levels through inhibition of FAS but increased expression levels of PPARα in the liver. TT had therapeutic potential in treating type 1 diabetes associated with hypertriglyceridemia and hypercholesterolemia.

Figure 6. Expression levels of PPARα, FAS, and PPARγ in the liver and of FAS and PPARγ in adipose tissue of mice by oral gavage dehydroeburicoic acid (TT): (A) representative image; (B, C) quantification of the expression levels of PPARα, FAS, and PPARγ in the liver and expression levels of FAS and PPARγ in adipose tissue. Protein was separated by 12% SDS-PAGE detected by Western blot. All values are means ± SE (n = 9). (#) P < 0.05, (##) P < 0.01, and (###) P < 0.001 compared with the control (CON) group. (∗) P < 0.05, (∗∗) P < 0.01, and (∗∗∗) P < 0.001 compared with the streptozotocin plus vehicle (distilled water) (STZ) group. TT1, TT2, and TT3, dehydroeburicoic acid (TT1, TT2, and TT3, 10, 20, and 40 mg/kg body weight, respectively); Metf, metformin (300 mg/kg body weight); Feno, fenofibrate (250 mg/kg body weight). H


Article

Journal of Agricultural and Food Chemistry STZ is a pancreatic β-cell toxin that induces irreversible necrosis of β-cells.39 In this study, insulin levels were decreased in the STZ-induced diabetic mice, which was consistent with the previous report.33 TT treatment caused a significant increase in blood insulin and a decrease in blood glucose, implicating the reducing ability of TT in blood glucose of the STZ-induced diabetic mice is due to its potential of secreting insulin from the existing islet β-cells. To examine the antidiabetic mechanisms of TT, we targeted membrane GLUT4 expression levels and measured the movement of the insulin-responsive glucose transporter GLUT4 to the cell surface in skeletal muscle. In skeletal muscle, the GLUT4 expression level is reduced in STZ-induced diabetic mice and is consistent with a previous study regarding the soleus muscle of STZ-induced diabetic rats.40 Following the TT treatment, membrane expression levels of GLUT4 in skeletal muscle are markedly increased. Of interest, TT exhibits a strong effect to increase membrane expression levels of GLUT4 by 1.70−2.57-fold. On the basis of increased expression levels of GLUT4, the hypoglycemic effect of TT was partly due to enhancing the insulin-dependent glucose uptake in skeletal muscle. On the other hand, Akt (PKB) is proposed to stimulate glucose uptake by influencing GLUT4.41 The C2C12 myotube has been proposed to be a useful model for analyzing GLUT4 translocation in skeletal muscle.42 In the present vitro study, TT significantly increased membrane expression levels of GLUT4 at 1, 5, 10, and 25 μg/mL and enhanced expression levels of phospho-Akt at 1 and 5 μg/mL. Nevertheless, TT at 10 and 25 μg/mL increased expression levels of GLUT4 but did not increase expression levels of phospho-Akt, indicating that TT could stimulate glucose transport activity via a mechanism that is partly independent of the insulin signaling pathway in myotube cells, presumably because uptake is partly mediated by AMPK activation pathway. To ascertain whether TT regulates AMPK activation, we monitored phosphorylation of AMPK in both skeletal muscle and liver tissue in STZ-induced diabetic mice. In this study, TT treatment enhanced the expression levels of phospho-AMPK/ total AMPK in both skeletal muscle and liver tissue. Metformin is proposed to enhance AMPK activity in skeletal muscle.43 AMPK has been shown to cause GLUT4 deployment to the plasma membrane, resulting in insulin-independent glucose uptake.43 Nevertheless, the phosphorylation of AMPK pathway is another major regulator of GLUT4 translocation during exercise or in response to some antidiabetic agents such as metformin.22 It was observed that TT could enhance the expression levels of phospho-AMPK/total-AMPK in skeletal muscle more effectively than metformin. These results further demonstrated that TT could stimulate glucose transport activity via a mechanism that is partly in an independent insulin manner in skeletal muscle of STZ-diabetic mice. However, whether the expression levels of phospho-AMPK/total-AMPK contribute to the enhancement of GLUT4 translocation by the TT is now being investigated. There are a variety of rate-limiting enzymes involved in gluconeogenesis.44 PEPCK and glucose-6-phosphatase (G6 Pase) play important roles in gluconeogenesis. The activity of G6 Pase was enhanced in the liver of diabetic rats.45 Renovation of enhanced PEPCK expression can be considered a good therapeutic target for the treatment of diabetes.46,47 Metformin is proposed to activate AMPK, which in turn inhibits the hepatic gluconeogenic genes PEPCK and G6 Pase.48 TT

treatment reversed higher PEPCK and G6 Pase mRNA levels observed in STZ-induced diabetic mice and enhanced hepatic expression levels of phospho-AMPK/total AMPK. Metformin improves glycemic control primarily via suppression of hepatic glucose production and increases in peripheral glucose uptake.22 Taken together, this study indicated that TT displayed a mechanism resembling metformin and caused glucose-lowering not only by activating AMPK in both skeletal muscle and liver tissue, in addition to enhancing glucose uptake in skeletal muscle, but also by down-regulating PEPCK and G6 Pase, which were possibly associated with inhibition of hepatic glucose production. We next determined whether TT influences lipid metabolism. PPARα or target gene levels including FAS were investigated. FAS is the key enzyme in fatty acid synthesis.49 PPARα is abundantly expressed in the liver and restrains βoxidation.38 PPARα ligands are employed extensively to decrease blood triglyceride concentrations in dyslipidemia.35,38 SREBP1c may up-regulate a variety of lipogenic genes.50 PPARα-deficient mice showed dysregulated SREBP-mediated lipogenic genes.38 Metformin is proposed to down-regulate the SREBP-1c expression, thereby reducing the FAS expression level through AMPK activation.51 Thus, it is possible that TT inactivated these enzymes and/or down-regulated gene expression through AMPK activation. Carnitine palmitoyl transferase I (CPT-1) is the rate-limiting enzyme for mitochondrial fatty acids oxidation, permitting their entry into the mitochondria for fatty acid oxidation.52 TT treatment significantly enhanced the CPT-1a mRNA level, indicating the increased β-oxidation suppressed triacylglyerol accumulation in the liver. DGAT2 catalyzes the terminal step in the synthesis of triglycerides53 and plays an important role in intracellular lipid accumulation. TT treatment decreased the mRNA levels of DGAT2 to reduce hepatic lipid accumulation and in turn to decrease blood TG levels. The study indicated that the lipidlowering effects of TT are primarily exerted via FAS and PPARα involved in hepatic lipid synthesis and fatty acids oxidation. In addition, TT-treated mice displayed reduced blood TC levels and decreased SREBP2 mRNA levels. SREBP2 plays a vital role in the regulation of cholesterol synthesis,54 implying that the potential mechanism of TT is associated with SREPB2 on the inhibitory action of cholesterol synthesis. Collectively, TT, Metf, and Feno decreased plasma triglycerides, hepatic steatosis, and total cholesterol levels through inhibition of genes including FAS and PPARγ but increased fatty acid oxidation gene expression levels including PPARα in the liver. PPARγ stimulated adipogenesis and lipogenesis in adipose tissue.55 PPARγ is abundantly expressed in adipocytes, and its expression is markedly induced during adipocyte differentiation.56 TT, Feno, or Metf treatment decreased PPARγ and FAS expressions in white adipose tissue of STZ-induced diabetic mice. Due to decreased adipogenic genes including PPARγ and FAS, TT, Feno, or Metf inhibited adipose differentiation and reduced lipid accumulation. Moreover, adiponectin has been shown to increase fatty acids oxidation by AMPK activation in both skeletal muscle and the liver.57 Leptin activated AMPK58 and shifted the balance toward fatty acid oxidation. Therefore, the increased adiponectin levels and decreased leptin levels by TT, Feno, and Metf should be involved in AMPK activation. Histology analysis found that TT treatment reduced the ballooning degeneration of the liver in STZ-induced diabetic I


Article


element binding protein; TC, total cholesterol; TG, triglyceride; WAT, white adipose tissue

mice. Because lipids that accumulated in adipose tissue are mostly derived from blood TG and the liver is a vital organ for lipid and lipoprotein metabolism, we presume that TT could not only remove fat from adipose tissue to peripheral tissues by enhancing lipid catabolism including inhibition of fatty acid synthesis (FAS) and enhancement of fatty acid oxidation (PPARα) in the liver but also inhibit adipocyte differentiation and reduce lipid accumulation (PPARγ) in both the liver and adipose tissue, thus leading to reduced TG levels in the blood and liver. The reduced lipid accumulation in the liver and adipose tissue finally made hepatic lipid drops almost invisible. In conclusion, TT not only significantly lowered blood glucose and insulin levels but also reduced the levels of blood triglyceride and total cholesterol. TT markedly increased membrane GLUT4 protein levels in membrane of skeletal muscle to elevate glucose uptake. Moreover, TT increased the expression levels of phospho-AMPK/total AMPK in both skeletal muscle and liver tissue. TT decreased mRNA levels of PEPCK and G6 Pase, which was related to the inhibition of hepatic glucose production. The combination of enhanced membrane GLUT4 in skeletal muscle and decreased glucose production in the liver leads to lower blood glucose levels. TT decreased plasma triglycerides, hepatic steatosis, and total cholesterol levels through inhibition of hepatic FAS and PPARγ accompanied by reduced SREBP1c and DGAT2 mRNA levels, whereas increased expression levels of PPARα accompanied by enhanced CPT1a mRNA levels increase fatty acids oxidation in the liver. TT treatment decreased lipogenic genes including PPARγ and FAS in adipose tissue, which may contribute to decreasing adipose cell differentiation and lipid storage. Furthermore, TT decreased SREBP2 mRNA levels, thus leading to a decrease in blood TC. Our findings imply that TT has an excellent therapeutic potential in the treatment of type 1 diabetes associated with hyperlipidemia.

■

■

(1) Daneman, D. Type 1 diabetes. Lancet 2006, 367 (9513), 847− 858. (2) American Diabetes Association Clinical Guidelines, 2010. (3) Tian, H. L.; Wei, L. S.; Xu, Z. X. Correlations between blood glucose level and diabetes signs in streptozotocin-induced diabetic mice. Global J. Pharmacol. 2010, 4 (3), 111−116. (4) Hayashi, K.; Kojima, R.; Ito, M. Strain differences in the diabetogenic activity of streptozotocin in mice. Biol. Pharm. Bull. 2006, 29 (6), 1110−1119. (5) Islam, M. S.; Loots, D. T. Experimental rodent models of type 2 diabetes: a review. Methods Find. Exp. Clin. Pharmacol. 2009, 31 (4), 249. (6) Islam, M. S.; Wilson, R. D. Experimentally induced rodent models of type 2 diabetes. Methods Mol. Biol. 2012, 33, 161−174. (7) Rossini, A. A.; Williams, R. M.; Appel, M. C.; Like, A. A. Sex differences in the multiple-dose streptozotocin model of diabetes. Endocrinology 1978, 103 (4), 1518−1520. (8) Geethangili, M.; Tzeng, Y. M. Review of pharmacological effects of Antrodia camphorata and its bioactive compounds. Evidence-Based Complement. Altern. Med. 2011, 2011, No. 212641, 110.1093/ecam/ nep108 (9) Yeh, C. T.; Rao, Y. K.; Yao, C. J.; Yeh, C. F.; Li, C. H.; Chuang, S. E.; Luong, J. H.; Lai, G. M.; Tzeng, Y. M. Cytotoxic triterpenes from Antrodia camphorata and their mode of action in HT-29 human colon cancer cells. Cancer Lett. 2009, 285, 73−79. (10) Huang, G. J.; Huang, S. S.; Lin, S. S.; Shao, Y. Y.; Chen, C. C.; Hou, W. C.; et al. Analgesic effects and the mechanisms of antiinflammation of ergostatrien-3β-ol from Antrodia camphorata submerged whole broth in mice. J. Agric. Food Chem. 2010, 58, 7445− 7452. (11) Wang, G. J.; Tseng, H. W.; Chou, C. J.; Tsai, T. H.; Chen, C. T.; Lu, M. K. The vasorelation of Antrodia camphorata mycelia: involvement of endothelial Ca2+-NO-cAMP pathway. Life Sci. 2003, 73, 2769−2783. (12) Huang, G. J.; Deng, J. S.; Huang, S. S.; Lee, C. Y.; Hou, W. C.; Hou, W. C.; Wang, S. Y.; Sung, P. J.; Kuo, Y. H. Hepatoprotective effects of eburicoic acid and dehydroeburicoic acid from Antrodia camphorata in a mouse model of acute hepatic injury. Food Chem. 2013, 141, 3020−3027. (13) Song, T. Y.; Yen, G. C. Protective effects of fermented filtrate from Antrodia camphorata in submerged culture against CCl4-induced hepatic toxicity in rats. J. Agric. Food Chem. 2003, 51, 1571−1577. (14) Lee, J. H.; Lee, Y. J.; Shin, J. K.; Nam, J. W.; Nah, S. Y.; Kim, S. H.; et al. Effects of triterpenoids from Poria cocos Wolf on the serotonin type 3A receptor-mediated ion current in Xenopus oocytes. Eur. J. Pharmacol. 2009, 615 (1−3), 27−32. (15) Majid, E.; Male, K. B.; Tzeng, Y. M.; Omamogho, J. O.; Glennon, J. D.; Luong, J. H. Cyclodextrin-modified capillary electrophoresis for achiral and chiral separation of ergostane and lanostane compounds extracted from the fruiting body of Antrodia camphorata. Electrophoresis 2009, 30 (11), 1967−1975. (16) Huang, S.; Czech, M. P. The GLUT4 glucose transporter. Cell Metab. 2007, 5 (4), 237−252. (17) Lee, W.; Ryu, J.; Souto, R. P.; Pilch, P. E.; Jung, C. Y. Separation and partial characterization of three distinct intracellular GLUT4 compartments in rat adipocytes. Subcellular fractionation without homogenization. J. Biol. Chem. 1999, 274 (53), 37755−37762. (18) Watson, R. T.; Pessin, J. E. Intracellular organization of insulin signaling and GLUT4 translocation. Recent Prog. Horm. Res. 2001, 56, 175−193. (19) Sujatha, S.; Anand, S.; Sangeetha, K. N.; Shilpa, K.; Lakshmi, J.; Balakrishnan, A.; Lakshmi, B. S. Biological evaluation of (3b)-stigmast5-en-3-ol as potent anti-diabetic agent in regulating glucose transport using in vitro model. Int. J. Diabetes Mellitus 2010, 2, 101−109.

AUTHOR INFORMATION

Corresponding Author

*(C.-C.S.) Fax: +886-4-22394256. E-mail: [email protected]. tw. Funding

Partial financial support for this study was provided by the Chinese Medical University under the Aim for Top University Plan of the Ministry of Education, Taiwan, and the Ministry of Health and Welfare Clinical Trial and Research Center of Excellence (MOHW104-TDU-B-212-113002). Notes

The authors declare no competing financial interest.

■

REFERENCES

ABBREVIATIONS USED

AMPK, AMP-activated protein kinase; BAT, brown adipose tissue; CON, control; CPT1a, carnitine palmitoyl transferase Ia; DGAT, acyl-coenzyme A:diacylglycerol acyltransferase; EWAT, epididymal white adipose tissue; FAS, fatty acid synthase; Feno, fenofibrate; FFA, free fatty acid; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; G6 Pase, glucose6-phosphatase; GLUT4, glucose transporter 4; Metf, metformin; MWAT, mesenteric white adipose tissue; PEPCK, phosphoenolpyruvate carboxykinase; PPAR, peroxisome proliferator-activated receptor; RT-PCR, reverse transcription− polymerase chain reaction; RWAT, retroperitoneal white adipose tissue; STZ, streptozotocin; SREBP, sterol regulatory J


Article

Journal of Agricultural and Food Chemistry (20) Foretz, M.; Taleux, N.; Guigas, B.; Horman, S.; Beauloye, C.; Andreelli, F.; et al. Regulation of energy metabolism by AMPK: a novel therapeutic approach for the treatment of metabolic and cardiovascular diseases. Med. Sci. (Paris) 2006, 22 (4), 381−383. (21) Viollet, B.; Lantier, L.; Devin-Leclerc, J.; Hébrard, S.; Amouyal, C.; Mounier, R.; Foretz, M.; Andreelli, F. Targeting the AMPK pathway for the treatment of type 2 diabetes. Front. Biosci., Landmark Ed. 2009, 14, 3380−3400. (22) Zhou, G.; Myers, R.; Li, Y.; Chen, Y.; Shen, X.; Fenyk-Melody, J.; Wu, M.; Ventre, J.; Doebber, T.; Fujii, N.; Musi, N.; Hirshman, M. F.; Goodyear, L. J.; Moller, D. E. Role of AMP-activated protein kinase in mechanism of metformin action. J. Clin. Invest. 2001, 108 (8), 1167−1174. (23) Stein, S. C.; Woods, A.; Jones, N. A.; Davison, M. D.; Carling, D. The regulation of AMP-activated protein kinase by phosphorylation. Biochem. J. 2000, 345 (3), 437−443. (24) Tai, T.; Akahori, A.; Shingu, T. Triterpenes of Poria cocos. Phytochemistry 1993, 32, 1239−1244. (25) Klip, A.; Ramlal, T.; Young, D. A.; Holloszy, J. O. Insulininduced translocation of glucose transporters in rat hindlimb muscles. FEBS Letters 1987, 224, 224−230. (26) Shih, C. C.; Lin, C. H.; Lin, W. L.; Wu, J. B. Momordica charantia extract on insulin resistance and the skeletal muscle GLUT4 protein in fructose-fed rats. J. Ethnopharmacol. 2009, 123, 82−90. (27) Tan, M. J.; Ye, J. M.; Turner, N.; Hohnen-Berhrens, C.; Ke, C. Q.; Tang, C. P.; et al. Antidiabetic activities of triterpenoids isolated from bitter melon associated with activation of the AMPK pathway. Chem. Biol. 2008, 15, 263−273. (28) Shih, C. C.; Chen, M. H.; Lin, C. H. Validation of the antidiabetic and hypolipidemic effects of Clitocybe nuda by assessment of glucose transporter 4 and gluconeogenesis and AMPK phosphorylation in streptozotocin-induced mice. Evidence-Based Complement. Altern. Med. 2014, 2014, No. 705636, 110.1155/2014/705636 (29) Shih, C. C.; Lin, C. H.; Lin, W. L. Effects of Momordica charantia on insulin resistance and visceral obesity in mice on high-fat diet. Diabetes Res. Clin. Pract. 2008, 81, 134−143. (30) Shih, C. C.; Ciou, J. L.; Lin, C. H.; Wu, J. B.; Ho, H. Y. Cell suspension culture of Eriobotrya japonica regulates the diabetic and hyperlipidemic signs of high-fat-fed mice. Molecules 2013, 18, 2726− 2753. (31) Wu, J. B.; Kuo, Y. H.; Lin, C. H.; Ho, Y. H.; Shih, C. C. Tormentic acid, a major component of suspension cells of Eriobotrya japonica, suppresses high-fat diet-induced diabetes and hyperlipidemia by glucose transporter 4 and AMP-activated protein kinase phosphorylation. J. Agric. Food Chem. 2014, 62, 10717−10726. (32) Kuo, Y. H.; Lin, C. H.; Shih, C. C. Ergostatrien-3β-ol from Antrodia camphorata inhibits diabetes and hyperlipidemia in high-fatdiet treated mice via regulation of hepatic related genes, glucose transporter 4, and AMP-Activated protein kinase phosphorylation. J. Agric. Food Chem. 2015, 63 (9), 2479−2489. (33) Changrani, N. R.; Chonkar, A.; Adeghate, E.; Singh, J. Effects of streptozotocin-induced type 1 diabetes mellitus on total protein concentrations and cation contents in the isolated pancreas, parotid, submandibular, and lacrimal glands of rats. Ann. N. Y. Acad. Sci. 2006, 1084, 503−519. (34) Wiernsperger, N. F. Chapter 12. Preclinical pharmacology of biguanides. In Oral Antidiabetics; Kuhlmann, J., Pulus, W., Eds.; Springer: Berlin, Germany, 1996. (35) Damci, T.; Tatliagac, S.; Osar, Z.; Ilkova, H. Fenofibrate treatment is associated with better glycemic control and lower serum leptin and insulin levels in type 2 diabetic patients with hypertriglyceridemia. Eur. J. Intern. Med. 2003, 14, 357−360. (36) Choi, J. S.; Yokozawa, T.; Oura, H. Improvement of hyperglycemia and hyperlipidemia in streptozotocin-diabetic rats by a methanolic extract of Prunus davidiana stems and its main component, pruning. Planta Med. 1991, 57 (3), 208−211. (37) Nabi, A. N.; Rahman, M.; Nislam, L. Plasma cholesterol modulate functions of neutrophils in streptozotocin-induced type 1 diabetic rats. Bioj. Sci. Technol. 2014, 1, Article ID: m140000.

(38) Staels, B.; Fruchart, J. C. Therapeutic roles of peroxisome proliferator-activated receptor agonists. Diabetes 2005, 54 (80), 2460− 2470. (39) Szkudelski, T. The mechanism of alloxan and streptozotocin action in B cells of the rat pancreas. Physiol. Res. 2001, 50 (6), 537− 546. (40) Liu, S. H.; Chang, Y. H.; Chiang, M. T. Chitosan reduces gluconeogenesis and increases glucose uptake in skeletal muscle in streptozotocin-induced diabetic rats. J. Agric. Food Chem. 2010, 58 (9), 5795−5800. (41) Welsh, G. I.; Hers, I.; Berwick, D. C.; Dell, G.; Wherlock, M.; Birkin, R.; Leney, S.; Tavaré, J. M. Role of protein kinase B in insulinregulated glucose uptake. Biochem. Soc. Trans. 2005, 33 (2), 346−349. (42) Nedachi, T.; Kanzaki, M. Regulation of glucose transporters by insulin transporter by insulin and extracellular glucose in C2C12 myotubes. Am. J. Physiol. Endocrinol. Metab. 2006, 291 (4), E817− E828. (43) Guo, S. Insulin signaling, resistance, and metabolic syndrome: insights from mouse models into disease mechanisms. J. Endocrinol. 2014, 220 (2), T1−T23. (44) Barthel, A.; Schmoll, D. Novel concepts in insulin regulation of hepatic gluconeogenesis. Am. J. Physiol. Endocrinol. Metab. 2003, 285 (4), E685−E692. (45) Berg, J. M.; Tymoczko, J. L.; Stryer, L. Glycolysis and glyconeogenesis. In Stryer Biochemistry; Berg, J. M., Tymoczko, J. L., Eds.; Freeman: New York, 2001; pp 425−464. (46) O’Brien, R. M.; Printz, R. L.; Halmi, N.; Tiesinga, J. J.; Granner, D. K. Structural and functional analysis of the human phosphoenolpyruvate carboxykinase gene promoter. Biochim. Biophys. Acta, Gene Struct. Expression 1995, 1264 (3), 284−288. (47) Sutherland, C.; O’Brien, R. M.; Granner, D. K. New connections in the regulation of PEPCK gene expression by insulin. Philos. Trans. R. Soc., B 1996, 351 (1336), 191−199. (48) Kim, Y. D.; Park, K. G.; Lee, Y. S.; Park, Y. Y.; Kim, D. K.; Nedumaran, B.; Jang, W. G.; Cho, W. J.; Ha, J.; Lee, I. K.; Lee, C. H.; Choi, H. S. Metformin inhibits hepatic gluconeogenesis through AMPactivated protein kinase-dependent regulation of the orphan nuclear receptor SHP. Diabetes 2008, 57 (2), 306−314. (49) Wakil, S. Fatty acid synthase, a proficient multifunctional enzyme. Biochemistry 1989, 28, 4523−4530. (50) Patel, D. D.; Knight, B. L.; Wiggins, D.; Humphreys, S. M.; Gibbons, G. F. Disturbances in the normal regulation of SREBPsensitive genes in PPAR α-deficient mice. J. Lipid Res. 2001, 42 (3), 328−337. (51) Zhou, G.; Myers, R.; Li, Y.; Chen, T.; Shen, X.; Fenyk-Melody, J.; et al. Role of AMP-activated protein kinase in mechanism of metformin action. J. Clin. Invest. 2001, 108, 1167−1174. (52) McGarry, J. D.; Brown, N. F. The mitochondrial carnitine palmitoyl-transferase system from concept to molecular analysis. Eur. J. Biochem. 1997, 244, 1−14. (53) Cases, S.; Stone, S. J.; Zhou, P.; Yen, E.; Tow, B.; Lardizabal, K. D.; Voelker, T.; Farese, R. V., Jr. Cloning of DGAT2, a second mammalian diacylglycerol acyltransferase, and related family members. J. Biol. Chem. 2001, 276 (42), 38870−38876. (54) Shimano, H.; Shimomura, I.; Hammer, R. E.; Herz, J.; Goldstein, J. L.; Brown, M. S.; Horton, J. D. Elevated levels of SREBP-2 and cholesterol synthesis in livers of mice homozygous for a targeted disruption of the SREBP-1 gene. J. Clin. Invest. 1997, 100 (8), 2115−2124. (55) Kersten, S. Peroxisome proliferator activated receptors and obesity. Eur. J. Pharmacol. 2002, 440, 223−234. (56) Saladin, R.; et al. Differential regulation of peroxisome proliferator activated receptor gamma1 (PPARgamma1) and PPARgamma2 messenger RNA expression in the early stages of adipogenesis. Cell Growth Differ. 1999, 10, 43−48. (57) Gil-Campos, M.; Canete, R.; Gil, A. Adiponectin, the missing link insulin resistance and obesity. Clin. Nutr. 2004, 23, 963−974. K


Article

Journal of Agricultural and Food Chemistry (58) Minokoshi, Y.; Kim, Y. B.; Kahn, B. B. Leptin stimulates fattyacid oxidation by activating AMP-activated protein. Diabetes 2003, 51 (Suppl. 2), 1375.

L


Antidiabetic and Antihyperlipidemic Properties of a Triterpenoid

Recommend Documents