Antiobese Effects of CapsaicinâChitosan Microsphere - American

Article pubs.acs.org/JAFC

Antiobese Effects of Capsaicin−Chitosan Microsphere (CCMS) in Obese Rats Induced by High Fat Diet Sirong Tan,‡ Bing Gao,‡ Yi Tao, Jiao Guo,* and Zheng-quan Su* Key Research Center of Liver Regulation for Hyperlipemia SATCM/Class III Laboratory of Metabolism SATCM, Guangdong TCM Key Laboratory for Metabolic Diseases, Guangdong Pharmaceutical University, Guangzhou 510006, China ABSTRACT: Chitosan (CTS) and capsaicin (CAP) are two kinds of effective ingredients for antiobesity, which are extracted from crab shells and Capsicum annuum. However, the strong taste of CAP makes it difficult to consume, and the antiobesity ability of CTS is limited. In this study, we prepared capsaicin−chitosan microspheres (CCMSs) by ion-cross-linking and spray drying and examined the antiobesity ability of CCMSs in obese rats. The effects of CCMSs on body weight, Lee’s index, body fat, and serum lipids were investigated. The mRNA expression of PPARα, PPARγ, leptin, UCP2, GPR120, FTO, and adiponectin in the liver was determined by quantitative real-time PCR, and the protein expression of adiponectin, leptin, PPARα, UCP2, and hepatic lipase in serum was evaluated by enzyme-linked immunosorbent assay. CCMSs were prepared with 85.17% entrapment efficiency and 8.87% mean drug loading. Compared with chitosan microspheres, CAP, and Orlistat, the CCMSs showed better ability to control body weight, body mass index, organ index, body fat, proportion of fat to body weight, and serum lipids. The CCMSs upregulated the expressions of PPARα, PPARγ, UCP2, and adiponectin and downregulated the expression of leptin. CCMSs may thus be considered novel, safe, effective, and natural weight loss substances, and there is an additive effect between CTMS and capsaicin. KEYWORDS: adipokines, antiobesity, high-fat diet, drug treatment, lipids

■

show that it is effective for weight loss.14,15 CAP can promote secretion of the neurotransmitters acetylcholine and norepinephrine,16 but its strong taste and smell are unacceptable. CTMSs and CAP combination may be an effective solution to overcome the strong taste and smell of CAP and while enhancing CAP absorption for better effects. This study combines CTMS and CAP and investigates the activity and mechanism of antiobesity of the resultant product. We prepared capsaicin−chitosan microspheres (CCMS) with a narrow particle size and investigated the antiobesity effects of CCMSs using obese rats induced by a high-fat diet. The antiobesity mechanism of CCMS was investigated by Q-PCR and enzyme-linked immunosorbent assay (ELISA). The pharmacodynamic experimental results showed that the antiobesity activity of CCMS is better than those of CTMS and CAP. This result indicates that an additive effect may exist between CTMSs and CAP. CCMSs may be considered an effective weight loss substance.

INTRODUCTION Obesity affects the quality of human life and is an important cause of cardiovascular, cerebrovascular, and metabolic diseases.1,2 As such, obesity treatment has become a major focus in medicine and pharmacology. The FDA had previously approved several types of diet pills for weight loss, including fenfluramine, R-fenfluramine, Temin, sibutramine, Orlistat, Qsymia, and Belviq, but four of these drugs have been delisted since then because of their adverse side effects.3 Lorcaserin and Belviq were approved in 2012, and only Orlistat is used as an OTC weight loss aid. However, the FDA issued a warning against Orlistat in 2010 because it can cause serious liver damage and even liver failure, which may lead to death risks associated with the drug. Given such adverse reactions, the development of a safe, natural, and active weight loss substance remains an urgent necessity. Chitosan (CTS) is a polysaccharide with a positive charge that can be extracted from crab shells. A large number of human trials and animal experiments have demonstrated that CTS lowers blood lipids and contributes to weight loss.4 Research has found that CTS can reduce the absorption of dietary fat and effectively improve hypercholesterolemia.5 However, CTS applications are limited because of side effects associate with the material, included excessive nausea, vomiting, constipation, and other side effects caused by large CTS doses.6 Our laboratory conducted a preliminary study using modern pharmaceutical techniques to prepare chitosan microspheres (CTMSs), and we have studied CTS and CTS-related products for many years. We found that the hypolipidemic effects of CTMSs are excellent in vivo and in vitro and that these effects are better than those of CTSs.6−13 Capsaicin (CAP) is a natural extract of Capsicum. Animal experiments and human studies © 2014 American Chemical Society

■

MATERIALS AND METHODS

Materials. CTS (viscosity, >200 mP/s; degree of deacetylation, 96.2%) was purchased from Shandong Aokang Biotech Ltd., Shandong, China. Orlistat capsules were obtained from Chongqing Fortune Pharmaceutical Co. Ltd., Chongqing, China. Total cholesterol (TC), triacylglycerol (TG), high-density lipoprotein cholesterol (HDL-C), and low-density lipoprotein cholesterol (LDL-C) kits were obtained from BioSino Biotechnology and Science Inc., Beijing, China. ELISA kits were obtained from R&D Systems China Co. Ltd., Received: Revised: Accepted: Published: 1866

September 29, 2013 January 30, 2014 January 31, 2014 January 31, 2014 dx.doi.org/10.1021/jf4040628 | J. Agric. Food Chem. 2014, 62, 1866−1874

Journal of Agricultural and Food Chemistry

Article

Table 1. The Primer Sequences serial no.

name

NM_001047088.1

GPR120

NM_001039713.1

FTO

NM_013196.1

PPARα

NM_013124.3

PPARγ

NM_019354.2

UCP2

NM_013076.3

Leptin

NM_144744.3

Adiponectin

NM_031144

β-actin

sequences

length (bp)

forward: ACTTCCCTTTCTTCTCGGATGT reverse: AGCAGTGAGACCACAAAGATGA forward: TAAGAGCAGAGCAGCCTACAAC reverse: TGTCCACCAAGTTCTCGTCAT forward: CAGAGGTCCGATTCTTCCACT reverse: AGTAGGCTTCATACACACCGTA forward: CCTCCCTGATGAATAAAGATGG reverse: CACAGCAAACTCAAACTTAGGC forward: AGATGTGGTAAAGGTCCGCTTC reverse: GCAATGGTCTTGTAGGCTTCG forward: GGCTTTGGTCCTATCTGTCCTA reverse: ATACCGACTGCGTGTGTGAAAT forward: TCACCTACGACCAGTATCAGGA reverse: GAGTCCATTGTTGTCCCCTTC forward: CCCATCTATGAGGGTTACGC reverse: TTTAATGTCACGCACGATTTC

97

Shanghai, China. We prepared the CTMSs used in this work in our laboratory via a previously reported procedure.8,15 The microparticles were approximately 600−1000 nm in size. All other reagents and solvents were of analytical grade. CCMS Preparation. CCMSs were prepared as follows. Briefly, CAP was dissolved in distilled water containing Tween-80, and CTS was dissolved in 1% ethylic acid solution. The CAP and CTS solutions were mixed using a magnetic stirrer, and the desired microspheres were spontaneously obtained upon addition of an aqueous basic solution of sodium tripolyphosphate (TPP) to the CAP-CTS solution. After 30 min, a CCMS suspension was obtained. Factors affecting drug entrapment efficiency, including CTS concentration, TPP concentration, CAP concentration, pH, and CTS/TPP composition ratio were investigated. The suspension was dried by spray drying to yield CCMSs as a powder. The effects of input temperature, flow rate, and hot air flow rate on particle size and microsphere yield were investigated. CAP Determination in CCMS. The CAP in the CCMS was extracted by methanol from the CCMS powder and determined by HPLC. A Diamonsil C18 (250 mm × 4.6 mm, 5 μm) column was used for this procedure. The mobile phase was 32% H2O in methanol (V/ V), and the detection wavelength was 281 nm. CCMS Characterization. The particle size and ζ potential of the CCMSs were determined with a laser diffraction size analyzer. The surface morphology of the CCMSs was investigated by SEM (S3700N). HPLC was used to analyze the drug entrapment efficiency and drug loading capacity of the microspheres. The CCMSs were mixed with 25 mL of methanol for ultrasound extraction. CAP in the supernatant was analyzed by HPLC after high-speed centrifugation, and the results obtained were used to calculate the drug entrapment efficiency and drug loading capacity of the products. Antiobesity Activity of CCMS in Male SD Rats. The SD obese rat model was used in animal studies. A total of 90 male SD rats aged 4 weeks were purchased from Guangdong Medical Laboratory Animal Center (Guangzhou, China). All of the animal protocols were approved by the Institutional Animal Care and Use Committee of the Guangdong Pharmaceutical University (Guangzhou, China) (Protocol no. SPF2013100). All of the rats were housed under standard conditions at 23 ± 2 °C, a 12 h light and dark cycle, and relative humidity of 55%. Food and water were provided ad libitum throughout the experiment. Experimental Design. Ten rats were randomly separated as (1) the normal diet (standard rodent chow) group (NF); this group was fed with a standard diet. The remaining 80 rats were fed with a high-fat diet to obtain the obesity model. This high-fat diet comprised 60% basic feed, 10% lard, 10% egg yolk powder, 2.5% cholesterol, 0.5% bile salts, 5% sucrose, 5% peanut, 5% milk powder, and 2% salt. After a 4 week high-fat diet, the obesity model was considered complete when

137 150 125 90 123 122 150

the average weight of the rats fed a high-fat diet was greater than 20% that of the rats fed a normal diet. The 80 rats were then randomly divided into eight groups by weight: (2) high-fat feeding group (FF), (3) CTS group (CTS), (4) Orlistat group (Orlistat), (5) CTMS group (CTMS), (6) CAP group (CAP), (7) CCMS high-dose group (HCCMS), (8) CCMS middle-dose group (M-CCMS), and (9) CCMS low-dose group (L-CCMS). The corresponding “drugs” were administered orally by gavage at a dose of 1 mL/100 g per day at the same time for 5 weeks. The “drugs” were suspended in water. The doses of “drugs” for each group were as follows: CTS, 440 mg/kg/d; CTMS, 440 mg/kg/d; Orlistat, 75 mg/kg/d; CAP, 30 mg/kg/d; HCCMS, 3382 mg/kg/d (containing 30 mg CAP); M-CCMS, 1128 mg/kg/d (10 mg CAP); L-CCMS, 367 mg/kg/d (3 mg CAP). All rats were weighed every week, and food intake levels for each group were recorded every day. During the experimental period, no rat died and no untoward effects were observed. At the end of the experiment, the rats were fasted overnight, and blood samples were withdrawn from the orbital vein using a capillary after ether anesthesia. The rats were then subjected to ether anesthesia, sacrificed, and necropsied. The liver, heart, white subcutaneous adipose tissues, and mesenteric adipose tissues were quickly removed and weighed on ice. Tissues were stored at −80 °C until biopsy. Serum Lipid Determination. The serum was prepared, and lipid levels in the blood samples were detected. The levels of TC, TG, HDL-C, and LDL-C were measured with commercial assay kits using an automated biochemistry analyzer BC200 instrument (Beijing Precil Instrument Co. Ltd., Beijing, China). Quantitative RT-PCR. Total RNA was extracted from the rat livers using TRIzol reagent (Invitrogen). First-strand cDNA was generated using a commercial Bestbio RT kit (Bestbio, Shanghai, China). The cDNA product was amplified by real-time RT-PCR using a Takara SYBR Premix EX Taq kit (TaKaRa, Otsu, Shiga, Japan) and Bio-Rad IQ5 real-time PCR instrument and analysis software (Applied Biosystems, Foster City, CA). The primer sequences (Table 1) used in the PCR were designed by Sangon Biotech (Shanghai) Co., Ltd. The relative quantification of gene expression was analyzed by the 2−ΔΔCt method. If the average gene expression of the experimental groups was considered lower than that of the FF group. If 2−ΔΔCt > 1, the average gene expression of the experimental groups was considered higher than that of the FF group. PCR was performed as follows: 94 °C for 30 s, 61 °C for 30 s, and 72 °C for 15 s after a 5 min warm-up. The system was then cooled to 72 °C for 5 min and finally heated from 65 to 95 °C (1 °C/s and 36 cycles). ELISA. The concentrations of obesity factors in the serum were measured using an ELISA kit (R&D Systems China Co. Ltd., Shanghai, China), and the ELISAs were read with a multifunctional microplate reader (Berthold Mithras LB 940; Berthold Technologies GmbH & Co. KG, Germany). 1867

dx.doi.org/10.1021/jf4040628 | J. Agric. Food Chem. 2014, 62, 1866−1874


Article

Statistical Analysis. All of the data are expressed as means ± SE. Differences between groups were determined by one-way ANOVA using SPSS for Windows, version 16.0 (SPSS Inc., Chicago, IL, USA). Student−Newman−Keuls Multiple-Range Test comparisons at P < 0.05 were carried out to determine significant differences among means.

Table 2. Result of Preparation of CCMS: Orthogonal Experiments Factors and Levels (A), Arrangement and Results of Orthogonal Experiments (B), Analysis of Variance (C), and the Effect of the Inlet Temperature (D), Flow Rate (E), and Hot Air Flow (F) on the Particle Size and Microsphere Yield

RESULTS CCMS Preparation. On the basis of the results of singlefactor experiments (the effects of the concentration of CTS, sodium TPP, and CAP, the pH of the reaction system, and the mass ratio of CTS/TPP are not presented here), we selected the factors that had the greatest influence on the encapsulation efficiency for orthogonal experiments (Table 2A). The key factors were encapsulation efficiency and drug loading. Parts B and C of Table 2 clearly indicate that the order of influence is pH > concentration of CTS > ratio of CTS/TPP. The optimum conditions for preparation are as follows: CTS concentration, 1 mg/mL; pH 4.5; CTS/TPP ratio, 4:1. CCMS Optimization. Spray drying is a key technique in preparing samples for the present study. Parts D−F of Table 2 show the effects of inlet temperature, flow rate, and hot air flow on the particle size and microsphere yield. On the basis of the results, we selected 160 °C as the inlet temperature, 600 mL/h as the flow rate, and 32 m3/h as the hot air flow rate for CCMS preparation. Characterization. Parts A and B of Figure 1 show the particle distribution and ζ distribution of the resultant products, respectively; the mean particle size and ζ potential of the CCMSs were 4.5 μm and +3.48 mV, respectively. SEM images of the CCMSs (Figure 1C) showed a spherical morphology with uniform diameters. The mean entrapment efficiency of the CCMSs was 85.17%, and the mean drug loading was 8.87% [entrapment efficiency = (total amount of CAP − free amount of CAP)/total amount of CAP, drug loading = (total amount of CAP − free amount of CAP)/microsphere weight]. Pharmacodynamics Study. Body Weight, Lee’s Index, Food Intake, Organ Index, and Proportion of Body Fat. Body weight was recorded each week. Figure 2 shows the changes in body weight, food intake, Lee’s index (body mass1/3 × 1000/ body length), liver index (liver mass × 100/body mass), and proportion of body fat. Among the treatments studied, high doses of CCMSs best controlled weight gain (Figure 2B), ΔLee’s index (Figure 2C), liver index (Figure 2D), and proportion of body fat (Figure 2F) without affecting food intake (Figure 2A). The ability of the CCMSs to control body weight and ΔLee’s index was better than that of Orlistat. While high doses of CCMSs controlled obesity indices favorably, no differences were observed in terms of ΔLee’s index, organ index, and proportion of body fat between the H-CCMS and M-CCMS groups. Therefore, 3382 mg/kg/d is an efficient CCMS dosage for controlling obesity in rats. The CCMSs exhibited better obesity control than either the CTMSs or CAP alone; this finding indicates that cooperation may occur between the CTMS and the CAP. Serum Lipid Determination. Lipid levels in serum were detected using an automatic biochemical analyzer, and the results are shown in Figure 3. TC, TG, and LDL levels in the CCMS group were similar to those in the normal group, but HDL levels were higher in the former than in the latter. Orlistat, CTS, CTMS, CAP, and CCMS showed good control of TC levels. TG levels were lower and HDL levels were higher in the FF group than in any of the other groups. Compared

(A)

■

factors levers

A CTS concentration (mg/mL)

B pH

C CTS/TPP

1 2 3

1.0 1.5 2.0

4.0 4.5 5.0

3 4 5

(B) factors no.

A

B

C

D

DEE (%)

EPR (%)

score

1 2 3 4 5 6 7 8 9 K1 K2 K3 R

1 1 1 2 2 2 3 3 3 59.88 57.13 56.54 3.33

1 2 3 1 2 3 1 2 3 59.34 59.58 54.64 4.94

1 2 3 2 3 1 3 1 2 57.00 58.32 58.23 1.32

1 2 3 3 1 2 2 3 1 57.22 57.95 58.39 1.17 (C)

53.29 55.67 51.19 55.07 54.28 49.42 55.10 55.01 50.19

5.96 6.50 6.39 4.56 4.32 3.75 3.40 2.95 2.98

59.88 62.17 57.58 59.63 58.60 53.17 58.50 57.96 53.17

factors

SS

f

F

F*

significance

A B C error

18.99 46.49 3.25 2.11

2 2 2 2

9.02 22.07 1.54

9.00 9.00 9.00

P < 0.1 P < 0.1

D inlet temperature (°C)

particle size (μm) 4.4 ± 0.2 4.6 ± 0.4 4.5 ± 0.1 (E)

140 160 180

yield (%) 56.7 ± 1.4 59.6 ± 1.9 59.8 ± 1.2

flow rate (mL/h)

particles size (μm)

yield (%)

400 600 800

4.2 ± 0.3 4.8 ± 0.5 7.2 ± 0.2 (F)

60.1 ± 1.8 59.8 ± 1.3 44.5 ± 1.7

hot air flow (m3/h)

particle size (μm)

yield (%)

28 32 36

4.2 ± 0.2 4.1 ± 0.2 4.6 ± 0.3

41.3 ± 1.1 58.9 ± 1.6 59.2 ± 1.4

with the TG and HDL levels of the normal group, the Orlistat, CTS, CTMS, and CCMS groups shows varying degrees of reduction in TG levels and increases in HDL levels. The CCMS groups showed higher HDL levels than the CTMS or CAP groups. These results indicate that CCMSs exhibit potential as an antihyperlipidemic for decreasing TC. Antiobesity Mechanism Study. Quantitative RT-PCR. To identify the mechanism by which CCMSs exert their antiobesity effects, adiponectin, leptin, PPARα, PPARγ, FTO, 1868



Article

Figure 1. Characterization of CCMS. Particle distribution (A), ζ potential (B), and SEM (C) of CCMS. The particle distribution and ζ potential of the CCMS were determined with a laser diffraction size analyzer, and the surface morphology of the CCMS was studied by SEM (S3700N).

possibly be one of the reasons of CCMS for controlling obesity. RT-PCR and ELISA study results indicate that CTMSs and CCMSs affect the protein expression of AD, UCP2, and LE by exerting effects on obesity-associated genes. Slices of Different Tissues. Tissue sections were stained with hematoxylin and eosin (H&E), and H&E images of different tissues are shown in Figure 5. The heart slices (Figure 5A) showed no myocardial hypertrophy in the NF, M-CCMS, and L-CCMS groups. The myofibers were in order, the stripes and muscle space were clear, and the nucleus was not enlarged. Figure 5B clearly shows that the liver cells of the fat group underwent vacuolation. The cells contained a pale, watery cytoplasm. Several differently shaped lipids and a large number of both small and large cytoplasmic lipid droplets were present. Large fat droplets were fairly noticeable. Spotty and focal necrosis occurred in the liver cells of the fat group, and an inflammatory cell infiltrate was observed in the normal group. Compared with the CTS, CAP, CTMS, and CCMS groups, the fatty liver-like Fat group was much better than the Fat group. In Figure 5C, the adipocytes of the Fat group were larger than those of other groups, except for the M-CCMS and L-CCMS

GPR120, and UCP2 were selected for RT-PCR detection (Figure 4A). The mRNA expression of adiponectin, PPARα, PPARγ, FTO, GPR120, and UCP2 increased among the groups to varying degrees, and the mRNA expression of LE decreased. The CCMS and CTMS groups showed significantly increased expression of AD, PPARα, and UCP2 and decreased expression of LE. In the CAP group, the expression of AD, PPARα, and UCP2 was upregulated while the expression of LE was slightly downregulated. The H-CCMS and M-CCMS groups showed better regulation of AD, PPARα, leptin, and UCP2 mRNA expression than the CTMS, CAP, and Orlistat groups. This finding may be attributed to the improved obesity control afforded by CCMSs in rats. ELISA. RT-PCR analysis results indicated that the key obesity factors are AD, LE, PPARα, and UCP2 mRNA. Therefore, we detected the protein expression of these obesity factors in the serum by ELISA; the results are shown in Figure 4B−F. The AD, UCP2, and HL contents in serum from CCMS groups were much higher than those in the HF group. No significant difference in the expression of PPARα was found between the CCMS and HF groups. HL results showed that the HL may 1869



Article

Figure 2. The main antiobese index of CCMS (P < 0.05). Changes in the body weight (A), food intake (B), Lee’s index (C), liver index (D), body fat (E), and ratio of the body fat and weight (F) after 5 weeks treatment. Lee’s index (body mass1/3 × 1000/body length), Liver index (liver mass × 100/body mass), a low value of Lee’s index, or liver index means that it is better at controlling obesity. The data are the means ± SE (n = 10). P < 0.05.

Figure 3. The serum lipid levels in rats (P < 0.05). The levels of TC, TG, LDL, and HDL in each group after 5 weeks treatment. The data are the means ± SE (n = 10). P < 0.05.

■

groups. Treatment with Orlistat, CTS, and high doses of

DISCUSSION

Obesity is associated with a number of diseases and metabolic disturbances, including type 2 diabetes, hypertension, dyslipidemia, gallbladder disease, and some cancers.17−19 Developing new types of antiobesity drugs is thus rapidly becoming an urgent necessity. Natural products, such as Cassia mimosoides, CTS, and CAP, and some types of food show promising antiobesity activities.20−22

CCMS clearly inhibited the proliferation of adipocytes. The same phenomena were observed in the mesentery fatty tissue slices (Figure 5D). In summary, the CCMSs are beneficial to the fatty liver and cardiac hypertrophy, which are caused by obesity. 1870



Article

CTS is a polysaccharide material extracted from shell; it is generally considered a good excipient because of its biocompatibility.28−30 CTS-based nanoparticles have been widely studied as drug carrier systems for many years,31−33 and relevant studies show that these nanoparticles could improve the intestinal absorption of a drug in vivo.34−36 Our research showed that CTMSs were significantly lowered blood lipid levels.12 Combining microspheres with CAP may thus present a good solution to compensate for limitations associated with CAP use. In this study, we prepared CCMSs by cross-linking and spray drying. CTS and TPP were combined by chemical bonding, and CAP was encapsulated inside the sphere. Many experiments have demonstrated that CTS has active functions in weight control and may be used as an antiobesity agent.6,37,38 Therefore, CCMSs may be more functionally active than either CTS or CAP alone. The CCMSs may be applied as a future drug for weight loss. The oral LD50 values of CAP were 118.84 and 97.40 mg/kg for male and female rats, respectively.39 Prior to this research, we carried out a brief experiment to determine the highest dosage. No deaths occurred with 10-fold dosage of CCMS (CAP) in mice, which indicates that CCMSs may reduce CAP toxicity. Compared with the CTMS, CAP, and Orlistat groups, the CCMSs grouped showed better inhibition of increases in rat body weight, body mass index, organ index, body fat, and proportion of fat to body weight (Figure 2). CCMSs maintained these parameters at normal or lower levels in rats and exhibited no effect on the appetite of rats. Rats treated with CCMSs showed more controlled body weight gains than rats treated with CAP or CTMS. Additive effects were also observed. Treatment with CCMSs significantly reduced the TC, TG, and LDL of rats to normal levels, and these decreases were lower than those shown by either CTMSs or CAP alone (Figure 3). The CCMSs could potentially lower blood lipids, but they are not as effective as the CTMSs, CTS, or CAP. While many studies have shown that CTS or chitin has potential use as an antiobesity agent and lowering lipid levels, concerns regarding CTS/chitin use remain. Low-molecularweight CTS is easily absorbed,40 and its small size exhibits great effects on body weight.9 CCMSs, which are composed of small particles, may be easily absorbed and exhibit good antiobesity activity. The mechanism of obesity is complex, and various genes have different effects on obesity.41 In this study, we selected seven significant genes associated with obesity or hyperlipidemia for analysis. In the study of the antiobesity mechanism of CCMS, the expression of PPARα, PPARγ, leptin, adiponectin, UCP2, GPR120, and FTO genes was assayed by real-time RT-PCR at the mRNA level (Figure 4A). Genome-wide association studies have shown a strong correlation between a single nucleotide polymorphism in the first intron of the FTO gene with increased body mass index and obesity risk.42 Adiponectin is an adipokine that antagonizes excess lipid storage in the liver and protects against inflammation and fibrosis.43 GPR120 dysfunction has been demonstrated to cause obesity in mice and humans.44 UCP2 is a key regulator of energy balance and mediates proton leaks across the inner membrane via the uncoupling of substrate oxidation from ATP synthesis.45 Obese individuals have high circulating levels of leptin, which is a hormone secreted by adipose tissue and is involved in energy homeostasis.46 PPARs

Figure 4. Gene expression and protein expression comparisons in the different treatment groups. The expression of adiponectin, leptin, PPARα, FTO, GPR120, UCP2, and PPARγ mRNA (A) in different treatment groups after 5 weeks of treatment. The level of mRNA was detected by Q-PCR. The changes of protein expression of adiponectin (B), leptin (C), PPARα (D), UCP2 (E), and hepatic lipase (F) in different treatment groups were detected by ELISA. ΔCt is the average value of 10 samples in the formulation (average gene expression of experiment groups/average gene expression of FF groups) = 2−ΔΔCt = 2(−ΔCtcontrol−ΔCtFF). If 2−ΔΔCt < 1, the average gene expression of the experiment groups is lower than that in the FF group. If this value is higher than 1, the average gene expression of the experiment groups is higher than that in the FF group.

CAP is a natural active substance extracted from red pepper.23 The substance has been shown to be effective for weight loss and exhibited antihyperlipidemic activity in both animal and human studies.15,24−27 However, CAP has limited use because of its pungency. This current study provides a solution that may partially eliminate this problem. During CCMS administration, the rats showed better tolerance toward the CCMSs than toward CAP (the compliance of the CCMS groups was better than that of the CAP group). The antiobesity activity of the CCMSs was also better than that of the CAP and CTMS groups, which may be attributed to the fact that CAP absorption is promoted by the CTMSs and additive effects exist between CAP and the CTMSs. 1871



Article

Figure 5. The tissue slices from different organs (200×). Heart slices (A), liver slices (B), subcutaneous fatty tissue slices (C), and mesentery fatty tissue slices (D). Tissue sections were stained with hematoxylin and eosin (H&E).

*For Z.S.: phone/fax, +86 20 39352067; E-mail, suzhq@scnu. edu.cn.

are important in the control of lipid metabolism.47 The CCMSs were found to upregulate the expression of PPARα, UCP2, and adiponectin genes and downregulate the expression of the leptin gene. These results were confirmed by the serum protein contents determined using ELISA. The results of genes and protein (Figure 4 B−F) showed that PPARα, UCP2, leptin, and HL and were the key reasons of CCMS for controlling obesity. Tissue slices showed that the rats fed with CCMSs had thinner myocardial and liver cells than the model group (Figure 5). Moreover, fewer inflammatory cell infiltrates and fatty degeneration of hepatocytes were observed in the heart and liver cells, respectively, of the CCMS-treated rats. The CCMStreated groups also showed smaller subcutaneous and mesentery fat cells. Hsu demonstrated that CAP efficiently induces apoptosis and inhibits adipogenesis in 3T3-L1 preadipocytes and adipocytes.48 Overall, the CCMSs possessed good efficacy in reducing weight and have potential therapeutic effects on fatty liver and myocardial hypertrophy caused by obesity. The CCMSs also inhibited the growth of fat cells to a certain extent. On the basis of the results of the present study, CCMSs could be used as “natural products” with good ability to control obesity and hyperlipidemia. CCMSs may achieve weight loss effects by increasing the mRNA and protein expression of PPARα, UCP2, and adiponectin genes and downregulating the expression of leptin. The antiobesity activity of CCMSs was better than those of either CTMS or CAP. This result indicates that an additive effect exists between CTMSs and CAP.

■

Author Contributions ‡

S.T. and B.G. equally contributed to this work.

Funding

This project was financially supported by The National Natural Science Foundation of China (no. 81173107), the Science and Technology Planning Project of Guangzhou, China (no. 2011J4300064), and the Science and Technology Planning Project of Zhongshan, China (no. 2009H017). Notes

The authors declare no competing financial interest.

■

ACKNOWLEDGMENTS We are grateful to all our colleagues at the Guangdong TCM Key Laboratory for Metabolic Diseases. Acknowledgements are also made to Prof. Jiao Guo for providing the platform for this research.

■

ABBREVIATIONS USED CTS, chitosan; CAP, capsaicin; CTMS, chitosan microsphere; CCMS, capsaicin−chitosan microspheres; ELISA, enzyme linked immunosorbent assay; PPAR, peroxisome proliferatoractivated receptor; UCP, uncoupling protein; TC, total cholesterol; TG, triacylglyceride; LDL-C, low-density lipoprotein; HDL-C, high-density lipoprotein; TPP, sodium tripolyphosphate; HPLC, high performance liquid chromatography; SEM, scanning electron microscope; NF, normal diet group; FF, high-fat feeding group; AD, adiponectin; LE, leptin; HL, hepaticlipase; FTO, fat mass and obesity associated gene;

AUTHOR INFORMATION

Corresponding Authors

*For J.G.: E-mail, [email protected]. 1872



Article

(21) Vermaak, I.; Viljoen, A. M.; Hamman, J. H. Natural products in anti-obesity therapy. Nat. Prod. Rep. 2011, 28, 1493−1533. (22) Yun, J. W. Possible anti-obesity therapeutics from nature. Phytochemistry 2010, 71, 1625−1645. (23) Heber, D. Herbal preparations for obesity: are they useful? Primary Care 1999, 30, 441−463. (24) Wachtel, R. E. Capsaicin. Reg. Anesth. Pain Med. 1999, 24, 361− 363. (25) Kobayashi, A.; Osaka, T.; Namba, Y.; Inoue, S.; Lee, T. H.; Kimura, S. Capsaicin activates heat loss and heat production simultaneously and independently in rats. Am. J. Physiol.: Regul. Integr. Comp. Physiol. 1998, 275, 92−98. (26) Shin, K. O.; Moritani, T. Alterations of autonomic nervous activity and energy metabolism by capsaicin ingestion during aerobic exercise in healthy men. J. Nutr. Sci. Vitaminol. 2007, 53, 124−132. (27) Watanabe, T.; Kawada, T.; Yamamoto, M.; Iwai, K. Capsaicin, a pungent principle of hot red pepper, evokes catecholamine secretion from the adrenal medulla of anesthetized rats. Biochem. Biophys. Res. Commun. 1987, 142, 259−264. (28) Mahmmoud, Y. A. Capsaicin stimulates uncoupled ATP hydrolysis by the sarcoplasmic reticulum calcium pump. J. Biol. Chem. 2008, 283, 21418−21426. (29) Kean, T.; Thanou, M. Biodegradation, biodistribution and toxicity of chitosan. Adv. Drug. Delivery Rev. 2010, 62, 3−11. (30) De Souza, R.; Zahedi, P.; Allen, C. J. Biocompatibility of injectable chitosan−phospholipid implant systems. Biomaterials 2009, 30, 3818−3824. (31) Wang, X. H.; Yu, X.; Yan, Y. N.; Zhang, R. J. Liver tissue responses to gelatin and gelatin chitosan gels. J. Biomed. Mater. Res. A. 2008, 87, 62−68. (32) Hejazi, R.; Amiji, M. Chitosan-based gastrointestinal delivery systems. J. Controlled Release 2003, 89, 151−165. (33) Hsu, S. H.; Chang, Y. B.; Tsai, C. L.; Fu, K. Y.; Wang, S. H.; Tseng, H. J. Characterization and biocompatibility of chitosan nanocomposites. Colloids Surf., B: Biointerfaces 2011, 85, 198−206. (34) Lee, D.; Mohapatra, S. S. Chitosan nanoparticle-mediated gene transfer. Methods Mol. Biol. 2008, 433, 127−140. (35) Pan, Y.; Li, Y. J.; Zhao, H. Y.; Zheng, J. M.; Xu, H.; Wei, G.; Hao, J. S.; Cui, F. D. Bioadhesive polysaccharide in protein delivery system: chitosan nanoparticles improve the intestinal absorption of insulin in vivo. Int. J. Pharm. 2002, 249, 139−147. (36) Lin, Y. H.; Mi, F. L.; Chen, C. T. Preparation and characterization of nanoparticles shelled with chitosan for oral insulin delivery. Biomacromolecules 2007, 8, 146−152. (37) Wu, S. H.; Tao, Y.; Zhang, H. L.; Su, Z. Q. Preparation and characterization of water-soluble chitosan microparticles loaded with insulin using the polyelectrolyte complexation method. J. Nanomater. 2011, 2011, ArticleID 404523 DOI: 10.1155/2011/404523. (38) Jull, A. B.; Ni Mhurchu, C.; Bennett, D. A. Chitosan for overweight or obesity. Cochrane Database Syst. Rev. 2008, 3, CD003892. (39) Wydro, P.; Krajewska, B.; Hac-Wydro, K. Chitosan as a lipid binder: a Langmuir monolayer study of chitosan−lipid interactions. Biomacromolecules 2007, 8, 2611−2617. (40) Chae, S. Y.; Jang, M. K.; Nah, J. W. Influence of molecular weight on oral absorption of water soluble chitosan. J. Controlled Release 2005, 102, 383−394. (41) Saito, A.; Yamanoto, M. Acute oral toxicity of capsaicin in mice and rats. J. Toxicol. Sci. 1996, 21, 195−200. (42) Dina, C.; Meyre, D.; Gallina, S.; Durand, E.; Korner, A.; Jacobson, P.; Carlsson, L.; Kiess, W.; Vatin, V.; Lecoeur, C.; Delplanque, J.; Vaillant, E.; Pattou, F.; Ruiz, J.; Weill, J.; LevyMarchal, C.; Horber, F.; Potoczna, N.; Hercberg, S.; Stunff, C. L.; Bougneres, P.; Kovacs, P.; Marre, M.; Balkau, B.; Cauchi, S.; Chevre, J.; Froguel, P. Variation in FTO contributes to childhood obesity and severe adult obesity. Nature Genet. 2007, 39, 724−726. (43) Buechler, C.; Wanninger, J.; Neumeier, M. Adiponectin, a key adipokine in obesity related liver diseases. World J. Gastroenterol. 2011, 23, 2801−2811.

GPR120, G-protein-coupled receptor 120; LD50, median lethal dose

■

REFERENCES

(1) The World Health Report 1997Conquering Suffering, Enriching Humanity; World Health Organization: Geneva, 1998. (2) Hill, J. O.; Peters, J. C. Environment contributions to the obesity epidemic. Science 1998, 280, 1371−1374. (3) Obesity: Preventing and Managing the Global Epidemic; World Health Organization: Geneva, 2000. (4) Hsu, Y. W.; Chu, D. C.; Ku, P. W.; Liou, T. H.; Chou, P. Pharmacotherapy for obesity: past, present and future. J. Exp. Clin. Med. 2010, 2, 118−123. (5) Zhang, J.; Liu, J.; Li, L.; Xia, W. Dietary chitosan improves hypercholesterolemia in rats fed high-fat diets. Nutr. Res. (N. Y.) 2008, 6, 383−390. (6) Jull, A. B.; Ni Mhurchu, C.; Bennett, D. A.; Dunshea-Mooij, C. A.; Rodgers, A. Chitosan for overweight or obesity. Cochrane Database Syst. Rev. 2008, 3, CD003892. (7) Ni Mhurchu, C.; Poppitt, S. D.; McGill, A. T.; Leahy, F. E.; Benett, D. A.; Lin, R. B.; Ormrod, D.; Ward, L.; Strik, C.; Rodgers, A. The effect of the dietary supplement, chitosan, on body weight: a randomized controlled trial in 250 overweight and obese adults. Int. J. Obes. 2004, 28, 1149−1156. (8) Zhang, H. L.; Tao, Y.; Guo, J.; Hu, Y. M.; Su, Z. Q. Hypolipidemic effects of chitosan nanoparticles in hyperlipidemia rats induced by high fat diet. Int. Immunopharmacol. 2011, 11, 457− 461. (9) Tao, Y.; Zhang, H. L.; Gao, B.; Guo, J.; Hu, Y. M.; Su, Z. Q. Water-Soluble Chitosan Nanoparticles Inhibit Hypercholesterolemia Induced by Feeding a High-Fat Diet in Male Sprague−Dawley Rats. J. Nanomater. 2011, 2011, 6. (10) Zhang, H. L.; Wu, S. H.; Tao, Y.; Zang, L. Q.; Su, Z. Q. Preparation and Characterization of Water-Soluble Chitosan Nanoparticles as Protein Delivery System. J. Nanomater. 2010, 2010, 1. (11) Gao, B.; Wu, S. H.; Zhang, H. L.; Tao, Y.; Su, Z. Q. Study on the lipid-lowering effect of water-soluble chitosan nanoparticles and microspheres in vitro. Adv. Mater. Res. 2011, 217, 306−310. (12) Tan, S. R.; Wu, S. H.; Gao, B.; Xiao, J. R.; Guo, Z. Y.; Long, S. Y.; Bai, Y.; Su, Z. Q. Experimental investigation on the lipid-lowering activity of three novel antilipidemic materials in vitro. Adv. Mater. Res. 2012, 399, 1568−1572. (13) Tao, Y.; Wu, S. H.; Zhang, H. L.; Zhang, W. Y.; Chen, H. C.; Su, Z. Q. Study on the effects of chitosan nanoparticles and microspheres on binding capacities of lipids and bile salts in vitro. Food Sci. Technol. 2010, 35, 271−274,279. (14) Zhang, H. L.; Zhong, X. B.; Tao, Y.; Wu, S. H.; Su, Z. Q. Effect of chitosan and water-soluble chitosan micro- and nanoparticles in obese rats fed a high-fat diet. Int. J. Nanomedicine 2012, 7, 4069−4076. (15) Diepvens, K.; Westerterp, K. R.; Westerterp-Plantenga, M. S. Obesity and thermogenesis related to the consumption of caffeine, ephedrine, capsaicin, and green tea. Am. J. Physiol.: Regul. Integr. Comp. Physiol. 2007, 9, 77−85. (16) Smeets, A. J.; Westerterp-Plantenga, M. S. The acute effects of a lunch containing capsaicin on energy and substrate utilization, hormones, and satiety. Eur. J. Nutr. 2009, 48, 229−234. (17) Snitker, S.; Fujishima, Y.; Shen, H.; Ott, S.; Pi-Sunyer, X.; Furuhata, Y.; Sato, H.; Takahashi, M. Effects of novel capsinoid treatment on fatness and energy metabolism in humans: possible pharmacogenetic implications. Am. J. Clin. Nutr. 2009, 89, 45−50. (18) Hsu, Y. W.; Chu, D. C.; Ku, P. W.; Liou, T. H.; Chou, P. Pharmacotherapy for obesity: past, present and future. J. Exp. Clin. Med. 2010, 2, 118−123. (19) Khandekar, M. J.; Cohen, P.; Spiegelman, B. M. Molecular mechanisms of cancer development in obesity. Nature Rev. Cancer 2011, 11, 886−895. (20) Mcbride, D. New research provides insight into the link between obesity and cancer. ONS Connect. 2012, 27, 21. 1873



Article

(44) McLarnon, A. Obesity: GPR120 dysfunction can cause obesity in mice and humans. Nature Rev. Gastroenterol. Hepatol. 2012, 4, 187. (45) Zhang, C. Y.; Baffy, G.; Perret, P.; Krauss, S.; Peroni, O.; Grujic, D.; Hagen, T.; Vidal-Puig, A.; Boss, O.; Kim, Y.; Zheng, X. X.; Wheeler, M.; Shulman, G.; Chan, C.; Lowell, B. Uncoupling protein-2 negatively regulates insulin secretion and is a major link between obesity, beta cell dysfunction, and type 2 diabetes. Cell. 2011, 105, 745−755. (46) Leshan, R. L.; Greenwald-Yarnell, M.; Patterson, C. M.; Gonzalez, I. E.; Myers, M. G. Leptin action throuph hypothalamic nitric oxide synthase-1-expressing neurons controls energy balance. Nature Med. 2012, 18, 2. (47) Djouadi, F.; Brandt, J. M.; Weinheimer, C. J. The role of the peroxisome proliferators-activated receptor alpha(PPAR alpha) in the control of cardiac lipid metabolism. Prostaqlandins, Leukotrienes Essent. Fatty Acids 1999, 5, 339−343. (48) Hsu, C. L.; Yen, G. C. Effects of capsaicin on induction of apotosis and inhibition of adipogenesis in 3T3-L1 cells. J. Agric. Food Chem. 2007, 55, 1730−1736.

1874


Antiobese Effects of CapsaicinâChitosan Microsphere - American

Recommend Documents

Antiobese Effects of CapsaicinâChitosan Microsphere - American