Antitumor Therapy Mediated by 5-Fluorocytosine and a Recombinant

Mar 5, 2009 - mice received intratumoral injections of LinkCD on days 11 and 14 after C26 tumor implantation and the drinking water containing 10 mg/m...
0 downloads 0 Views 1MB Size
Download PDF
articles Antitumor Therapy Mediated by 5-Fluorocytosine and a Recombinant Fusion Protein Containing TSG-6 Hyaluronan Binding Domain and Yeast Cytosine Deaminase Joshua I. Park, Limin Cao, Virginia M. Platt, Zhaohua Huang, Robert A. Stull, Edward E. Dy, Jeffrey J. Sperinde, Jennifer S. Yokoyama, and Francis C. Szoka, Jr.* Departments of Pharmaceutical Chemistry and Biopharmaceutical Sciences, School of Pharmacy, UniVersity of California at San Francisco, San Francisco, California 94143-0912 Received January 22, 2008; Revised Manuscript Received February 2, 2009; Accepted March 4, 2009

Abstract: Matrix attachment therapy (MAT) is an enzyme prodrug strategy that targets hyaluronan in the tumor extracellular matrix to deliver a prodrug converting enzyme near the tumor cells. A recombinant fusion protein containing the hyaluronan binding domain of TSG-6 (Link) and yeast cytosine deaminase (CD) with an N-terminal His(×6) tag was constructed to test MAT on the C26 colon adenocarcinoma in Balb/c mice that were given 5-fluorocytosine (5-FC) in the drinking water. LinkCD was expressed in Escherichia coli and purified by metal-chelation affinity chromatography. The purified LinkCD fusion protein exhibits a Km of 0.33 mM and Vmax of 15 µM/min/µg for the conversion of 5-FC to 5-fluorouracil (5-FU). The duration of the enzyme activity for LinkCD was longer than that of CD enzyme at 37 °C: the fusion protein retained 20% of its initial enzyme activity after 24 h, and 12% after 48 h. The LinkCD fusion protein can bind to a hyaluronan oligomer (12mer) at a KD of 55 µM at pH 7.4 and a KD of 5.32 µM at pH 6.0 measured using surface plasmon resonance (SPR). To evaluate the antitumor effect of LinkCD/5-FC combination therapy in vivo, mice received intratumoral injections of LinkCD on days 11 and 14 after C26 tumor implantation and the drinking water containing 10 mg/mL of 5-FC starting on day 11. To examine if the Link domain by itself was able to reduce tumor growth, we included treatment groups that received LinkCD without 5-FC and Link-mtCD (a functional mutant that lacks cytosine deaminase activity) with 5-FC. Animals that received LinkCD/5-FC treatment showed significant tumor size reduction and increased survival compared to the CD/5-FC treatment group. Treatment groups that were unable to produce 5-FU had no effect on the tumor growth despite receiving the fusion protein that contained the Link domain. The results indicate that a treatment regime consisting of a fusion protein containing the Link domain, the active CD enzyme, and the prodrug 5-FC is sufficient to produce an antitumor effect. Thus, the LinkCD fusion protein is an alternative to antibody-directed prodrug enzyme therapy (ADEPT) approaches for cancer treatment. Keywords: Cancer; drug delivery; enzyme prodrug therapy; protein engineering; tumor matrix

Introduction A variety of strategies have been proposed to improve the selectivity of chemotherapeutic drugs. Antibody-directed * To whom correspondence should be addressed. Mailing address: University of California, San Francisco, Departments of Biopharmaceutical Sciences and Pharmaceutical Chemistry, 513 Parnassus Ave., Box 0912, San Francisco, CA 94143-0912. Tel: (415) 4763895. Fax: (415) 476-0688. E-mail: [email protected]. 10.1021/mp800013c CCC: $40.75  2009 American Chemical Society

Published on Web 03/05/2009

enzyme prodrug therapy (ADEPT) is a strategy devised to target cancer cells with an antibody-enzyme conjugate.1 The antibody targets the enzyme to the cancer cell, and the enzyme converts a relatively nontoxic prodrug to a cytotoxic drug. In theory, targeting the enzyme to the cancer results (1) Senter, P. D.; Springer, C. J. Selective activation of anticancer prodrugs by monoclonal antibody-enzyme conjugates. AdV. Drug DeliVery ReV. 2001, 53, 247–264. VOL. 6, NO. 3, 801–812 MOLECULAR PHARMACEUTICS 801

articles in local production of the cytotoxic drug; the high drug concentration could eradicate the cancer cells in the vicinity of the enzyme. Gene-directed enzyme prodrug therapy (GDEPT, or VDEPT for viral-directed enzyme prodrug therapy) is a variant of ADEPT where the enzyme is expressed in the tumor cells. ADEPT and GDEPT systems exploit the enhanced permeability and retention (EPR) effect of the leaky tumor vasculature to access the cancer while reducing accumulation of the system in normal tissue.2 ADEPT and GDEPT approaches to treat cancer have been investigated since the late 1980s3-11 without clinical success. A major disadvantage for both ADEPT and GDEPT is the lack of a robust target. Tumor specific antigens, which are usually growth factor receptors, are heterogeneous. Moreover, not all patients overexpress the same cancer cell marker; for instance, only 25% of breast cancer patients overexpress Her2/neu.12 Thus, a single antibody is unable to target all variants. An unresolved challenge to GDEPT is the lack of (2) O’Connor, S. W.; Bale, W. F. Accessibility of circulating immunoglobulin G to the extravascular compartment of solid rat tumors. Cancer Res. 1984, 44, 3719–3723. (3) Bagshawe, K. D. Antibody directed enzymes revive anti-cancer prodrugs concept. Br. J. Cancer 1987, 56, 531–532. (4) Senter, P. D.; Su, P. C.; Katsuragi, T.; Sakai, T.; Cosand, W. L.; Hellstrom, I.; Hellstrom, K. E. Generation of 5-fluorouracil from 5-fluorocytosine by monoclonal antibody-cytosine deaminase conjugates. Bioconjugate Chem. 1991, 2, 447–451. (5) Wallace, P. M.; MacMaster, J. F.; Smith, V. F.; Kerr, D. E.; Senter, P. D.; Cosand, W. L. Intratumoral generation of 5-fluorouracil mediated by an antibody-cytosine deaminase conjugate in combination with 5-fluorocytosine. Cancer Res. 1994, 54, 2719–2723. (6) Kievit, E.; Bershad, E.; Ng, E.; Sethna, P.; Dev, I.; Lawrence, T. S.; Rehemtulla, A. Superiority of yeast over bacterial cytosine deaminase for enzyme/prodrug gene therapy in colon cancer xenografts. Cancer Res. 1999, 59, 1417–1421. (7) Miller, C. R.; Williams, C. R.; Buchsbaum, D. J.; Gillespie, G. Y. Intratumoral 5-fluorouracil produced by cytosine deaminase/5fluorocytosine gene therapy is effective for experimental human glioblastomas. Cancer Res. 2002, 62, 773–780. (8) Kambara, H.; Tamiya, T.; Ono, Y.; Ohtsuka, S.; Terada, K.; Adachi, Y.; Ichikawa, T.; Hamada, H.; Ohmoto, T. Combined radiation and gene therapy for brain tumors with adenovirusmediated transfer of cytosine deaminase and uracil phosphoribosyltransferase genes. Cancer Gene Ther. 2002, 9, 840–845. (9) Deckert, P. M.; Renner, C.; Cohen, L. S.; Jungbluth, A.; Ritter, G.; Bertino, J. R.; Old, L. J.; Welt, S. A33scFv-cytosine deaminase: a recombinant protein construct for antibody-directed enzyme-prodrug therapy. Br. J. Cancer 2003, 88, 937–939. (10) Tai, C. K.; Wang, W. J.; Chen, T. C.; Kasahara, N. Single-shot, multicycle suicide gene therapy by replication-competent retrovirus vectors achieves long-term survival benefit in experimental glioma. Mol. Ther. 2005, 12, 842–851. (11) Alderson, R. F.; Toki, B. E.; Roberge, M.; Geng, W.; Basler, J.; Chin, R.; Liu, A.; Ueda, R.; Hodges, D.; Escandon, E.; Chen, T.; Kanavarioti, T.; Babe, L.; Senter, P. D.; Fox, J. A.; Schellenberger, V. Characterization of a CC49-based single-chain fragment-betalactamase fusion protein for antibody-directed enzyme prodrug therapy (ADEPT). Bioconjugate Chem. 2006, 17, 410–418. (12) Slamon, D. J.; Godolphin, W.; Jones, L. A.; Holt, J. A.; Wong, S. G.; Keith, D. E.; Levin, W. J.; Stuart, S. G.; Udove, J.; Ullrich, A. Studies of the HER-2/neu proto-oncogene in human breast and ovarian cancer. Science 1989, 244, 707–712. 802

MOLECULAR PHARMACEUTICS VOL. 6, NO. 3

Park et al. a safe and effective vector. Inefficient transfer of genetic materials into cancer cells and the short survival of the genetically modified cells are additional barriers for the GDEPT approach.13 To overcome several of the obstacles of current enzyme prodrug therapies, we devised the matrix attachment therapy (MAT) strategy14 to target hyaluronan in the extracellular matrix of cancer cells to localize a prodrug converting enzyme in the tumor. Hyaluronan is a linear polysaccharide (Mw > 106 Da) consisting of repeating disaccharides of N-glucosamine and D-glucuronate.15 Hyaluronan is implicated in the proliferation, migration, and metastasis of cancer.16,17 Although present in normal tissues, hyaluronan is upregulated in many cancers including breast, ovarian, colon, lung, and prostate.18 In particular, breast and ovarian cancers have high levels of hyaluronan where its upregulation is associated with poor patient survival.19,20 Using the MAT strategy directed toward hyaluronan has several distinct advantages for targeting cancer: (1) There is no known heterogeneity of hyaluronan. (2) Hyaluronan in the tumor matrix can be targeted by the EPR effect. Extravasation into normal tissue is greatly diminished because of their intact endothelial cell barrier. Thus, the hyaluronan content in the tumor does not have to be elevated for MAT to achieve selective tumor targeting. (3) There are many binding sites on hyaluronan. (4) The cytotoxic drug generated in the tumor matrix can also target stromal cancer cell-associated fibroblasts that support tumor metastasis.21 (13) Greco, O.; Dachs, G. U. Gene directed enzyme/prodrug therapy of cancer: historical appraisal and future prospectives. J. Cell. Physiol. 2001, 187, 22–36. (14) Platt, V. M.; Szoka, F. C., Jr. Anticancer therapeutics: targeting molecules and nanocarriers to hyaluronan or CD44, a hyaluronan receptor. Mol. Pharmaceutics 2008, 5, 474–486. (15) Fraser, J. R.; Laurent, T. C.; Laurent, U. B. Hyaluronan: its nature, distribution, functions and turnover. J. Intern. Med. 1997, 242, 27–33. (16) Itano, N.; Sawai, T.; Miyaishi, O.; Kimata, K. Relationship between hyaluronan production and metastatic potential of mouse mammary carcinoma cells. Cancer Res. 1999, 59, 2499–2504. (17) Kosaki, R.; Watanabe, K.; Yamaguchi, Y. Overproduction of hyaluronan by expression of the hyaluronan synthase Has2 enhances anchorage-independent growth and tumorigenicity. Cancer Res. 1999, 59, 1141–1145. (18) Toole, B. P. Hyaluronan: from extracellular glue to pericellular cue. Nat. ReV. Cancer 2004, 4, 528–539. (19) Anttila, M. A.; Tammi, R. H.; Tammi, M. I.; Syrjanen, K. J.; Saarikoski, S. V.; Kosma, V. M. High levels of stromal hyaluronan predict poor disease outcome in epithelial ovarian cancer. Cancer Res. 2000, 60, 150–155. (20) Auvinen, P.; Tammi, R.; Parkkinen, J.; Tammi, M.; Agren, U.; Johansson, R.; Hirvikoski, P.; Eskelinen, M.; Kosma, V. M. Hyaluronan in peritumoral stroma and malignant cells associates with breast cancer spreading and predicts survival. Am. J. Pathol. 2000, 156, 529–536. (21) Olumi, A. F.; Grossfeld, G. D.; Hayward, S. W.; Carroll, P. R.; Tlsty, T. D.; Cunha, G. R. Carcinoma-associated fibroblasts direct tumor progression of initiated human prostatic epithelium. Cancer Res. 1999, 59, 5002–5011.

articles

Antitumor Therapy Mediated by 5-Fluorocytosine (5) Disrupting cell-to-hyaluronan association inhibits tumor progression in some experimental models.22-25 CD44, TSG-6 (tumor necrosis factor alpha-stimulated gene-6), and RHAMM (receptor for hyaluronan-mediated mobility) are major hyaluronan binding proteins found in human and other mammals.26 The function and structure of hyaluronan binding domains of CD44 and TSG-6 (also known as the Link domain) are well characterized.27,28 The TSG-6 Link domain binds to hyaluronan tighter than does the CD44 Link domain,29 so we used the Link domain from TSG-6 as the hyaluronan binding portion of the fusion protein. We selected cytosine deaminase (CD) from yeast to create a chimeric fusion protein, LinkCD, for a proof of concept of the MAT strategy. Cytosine deaminase is only found in bacteria and fungi, and has been extensively employed for ADEPT and GDEPT to generate cytotoxic 5-fluorouracil (5-FU) from the prodrug 5-fluorocytosine (5FC). 5-FC is a widely used orally available antimicrobial prodrug with high bioavailability.30 In this manuscript, we describe the creation and functional characterization of a LinkCD fusion protein. We then demonstrate an antitumor effect of the LinkCD fusion protein in combination with 5-FC delivered in the drinking water, in Balb/c mice bearing C26 murine colon adenocarcinoma flank tumors.

(22) Ahrens, T.; Sleeman, J. P.; Schempp, C. M.; Howells, N.; Hofmann, M.; Ponta, H.; Herrlich, P.; Simon, J. C. Soluble CD44 inhibits melanoma tumor growth by blocking cell surface CD44 binding to hyaluronic acid. Oncogene 2001, 20, 3399–3408. (23) Peterson, R. M.; Yu, Q.; Stamenkovic, I.; Toole, B. P. Perturbation of hyaluronan interactions by soluble CD44 inhibits growth of murine mammary carcinoma cells in ascites. Am. J. Pathol. 2000, 156, 2159–2167. (24) Mummert, M. E.; Mummert, D. I.; Ellinger, L.; Takashima, A. Functional roles of hyaluronan in B16-F10 melanoma growth and experimental metastasis in mice. Mol. Cancer. Ther. 2003, 2, 295– 300. (25) Xu, X. M.; Chen, Y.; Chen, J.; Yang, S.; Gao, F.; Underhill, C. B.; Creswell, K.; Zhang, L. A peptide with three hyaluronan binding motifs inhibits tumor growth and induces apoptosis. Cancer Res. 2003, 63, 5685–5690. (26) Day, A. J.; Prestwich, G. D. Hyaluronan-binding proteins: tying up the giant. J. Biol. Chem. 2002, 277, 4585–4588. (27) Blundell, C. D.; Almond, A.; Mahoney, D. J.; DeAngelis, P. L.; Campbell, I. D.; Day, A. J. Towards a structure for a TSG-6 hyaluronan complex by modeling and NMR spectroscopy: insights into other members of the link module superfamily. J. Biol. Chem. 2005, 280, 18189–18201. (28) Banerji, S.; Wright, A. J.; Noble, M.; Mahoney, D. J.; Campbell, I. D.; Day, A. J.; Jackson, D. G. Structures of the Cd44-hyaluronan complex provide insight into a fundamental carbohydrate-protein interaction. Nat. Struct. Mol. Biol. 2007, 14, 234–239. (29) Lesley, J.; English, N. M.; Gal, I.; Mikecz, K.; Day, A. J.; Hyman, R. Hyaluronan binding properties of a CD44 chimera containing the link module of TSG-6. J. Biol. Chem. 2002, 277, 26600– 26608. (30) Cutler, R. E.; Blair, A. D.; Kelly, M. R. Flucytosine kinetics in subjects with normal and impaired renal function. Clin. Pharmacol. Ther. 1978, 24, 333–342.

Experimental Section All restriction enzymes and T4 ligase used for cloning were purchased from New England Biolabs (Beverly, MA). Primers used for cloning and performing mutagenesis were synthesized by IDT (Coralville, IA) and Invitrogen (Carlsbad, CA). The bacterial expression vectors pET41a and pET15b were purchased from Novagen (San Diego, CA). All chemicals used in our experiments were purchased from Sigma-Aldrich (St. Louis, MO). Construction of Bacterial Expression Vector Containing the ORF of LinkCD. To create a bacterial expression construct for producing the LinkCD fusion protein in Escherichia coli, the cloning was performed in two steps. First, we created GST-tag fusion in pET41a vector. Using cDNA of yeast CD (Invivogen; San Diego, CA), the ORF was amplified by the following primers: 5′-primer containing SacII restriction site (GCTCGTCCGCGGGTCTGGTGCCACGCGGTAGTGTCACAGGAGGCATGGC) and 3′primer with XhoI restriction site (GCTCGTCTCGAGTTACTCCCCAATGTCCTCAAAC). The ORF was ligated into SacII and XhoI restriction sites of pET41a vector. Then the ORF of the Link domain of TSG-6 (Link) was amplified from cDNA of TSG-6 (American Type Culture Collection; Manassas, VA) using a 5′-primer containing SacII followed by a thrombin cleavage site (GCTCGT CCGCGGGTCTGGTGCCACGCGGTAGTGGTGTGTACCACAGAGAAGCAC) and a 3′-primer containing a SacII site (GCTCGTCCGCGGCTTTGCGTGTGGGTTGTAG). The Link ORF was inserted into the SacII site of pET41-CD to create pET41-LinkCD. We then created a LinkCD with an N-terminal His(×6) tag and a flexible linker between the Link and CD domains. Using pET41-LinkCD as a template, the CD gene was amplified using 5′-primer containing the sequence for a (Gly4Ser)3 flexible linker. The primer sequences are 5′-primer GCTCGTCATATGGGTGGTGGTGGTAGCGGTGGTGGTGGTAGCGGTGGTGGTGGTAGCATGGTCACAGGAGGCAT, and 3′-primer GCTCGTGGATCCTTACTCCCCAATGTCCTCAAACCAGT, and the amplicon was inserted into pET15b vector between NdeI and BamHI restriction sites to produce pET-CD plasmid. The ORF of the Link domain was amplified using 5′-primer containing NdeI restriction site (GCTCGTCATATGGGTGTGTACCACAGAGAAGCA) and 3′-primer with AseI restriction site (GCTCGTATTAATCTTTGCGTGTGGGTTGTAGC), and it was inserted into the NdeI site of pETCD to produce pET-LinkCD (compatible-end ligation was used between ORFs of Link and (Gly4Ser)3-CD). The final ligation product was transformed into DH-5R E. coli cells (Invitrogen; San Diego, CA) for screening, and the nucleotide sequence of the fusion protein expression construct was verified by DNA sequencing reactions (SeqWrite DNA Technology Services; Houston, TX). A functional mutant of LinkCD that lacks the CD activity was created by a single point mutation, resulting in a Glu to Ala change at the residue 64 in CD using the QuikChange II Site-Directed Mutagenesis Kit (Stratagene; La Jolla, CA) VOL. 6, NO. 3 MOLECULAR PHARMACEUTICS 803

articles and designed primers for the point mutation (forward primer, CCCTGCATGGGGCGATCAGCACCCTG; and reverse primer, CAGGGTGCTGATCGCCCCATGCAGGG). Using pET-LinkCD as a template, the mutagenesis was done with 12 cycles of denaturing (95 °C), annealing (55 °C), and extension (68 °C). After DpnI treatment on the reaction mixture to digest methylated template plasmid, 2 µL of PCR reaction mixture was transformed into DH-5R E. coli cells for screening to confirm the mutation sequence. Protein Expression and Purification in E. coli. For protein expression, pET-LinkCD (the N-terminal His(×6)tag version in pET15b vector) was transformed into BL21Codon Plus (DE3)-RIPL E. coli cells (Stratagene; La Jolla, CA), which contain tRNAs for rare codons to express mammalian proteins. E. coli cells containing pET-LinkCD plasmid were grown in 1 L of LB containing 50 µg/mL of carbenicillin at 35 °C until OD600nm reached between 0.6 and 0.9. The protein expression was induced by adding isopropyl β-D-1-thiogalactopyranoside (IPTG, 0.5 mM final concentration), and the expression was done at 23 °C overnight with constant shaking at 200 rpm. Bacterial cells containing the expressed protein were collected by centrifugation at 6000g for 30 min at 4 °C, and resuspended in 20 mL of lysis buffer containing 300 mM NaCl, 20 mM Tris-Cl, 40 mM imidazole, 0.2% Triton X-100, and 0.5 mM PMSF. After one cycle of freeze-thawing, the cells were lysed by combination of lysozyme and sonication treatments in an ice-water bath. The cell lysate was treated with DNase I and RNase A to digest nucleic acid, and centrifuged at 10000g for 45 min at 4 °C. The supernatant containing soluble proteins was collected, and 10 mM β-mercaptoethanol was added to the supernatant fraction and filtered through a 0.4 µm membrane. The filtered supernatant fraction was applied on to a HisTrap FF affinity column (Amersham Biosciences; Piscataway, NJ) that was pre-equilibrated with binding buffer containing 300 mM NaCl, 20 mM Tris-Cl, and 40 mM imidazole, pH 8. After the entire soluble fraction was passed through the column, the column was washed with 20 column volumes of the binding buffer, followed by 10 column volumes of 2 M NaCl, 20 mM Tris-Cl, and 40 mM imidazole, pH 8. The bound protein was eluted using elution buffer containing 300 mM NaCl, 20 mM Tris-Cl, and 500 mM imidazole, pH 8. The eluates were pooled and applied onto an Econo-Pac 10DG desalting column (Bio-Rad; Hercules, CA) to remove imidazole and to exchange buffer to PBS. The purified protein was concentrated using Amicon Ultra Centrifugal Filter Unit (Millipore; Billerica, MA). The Link-mtCD fusion protein was expressed and purified using the same procedure described above. The N-terminal His(×6)-tagged CD enzyme was purified as described by Huang et al.40 All proteins used for animal studies were chromatographed on Detoxi Gel polymixin B column (Pierce; Rockford, IL) to remove endotoxin prior to injections. The removal of endotoxin was (31) Kirchhoff, W. H. Exam: A Two-State Thermodynamic Analysis Program; NIST Tech. Note 1401; U.S. Government Printing Office: Washington, DC 1993; pp 1-103. 804

MOLECULAR PHARMACEUTICS VOL. 6, NO. 3

Park et al. confirmed by measurement of endotoxin level using Limulus Amebocyte Lysate Kit (Cambrex Bio Science; Walkersville, MD). All proteins chromatographed on the polymixin B column contained less than 1 endotoxin unit per mg of protein. Size Exclusion Column. To determine the native molecular weights of LinkCD and CD, a Sephacryl S-100HR (Amersham Biosciences; Piscataway, NJ) size exclusion column was used. The column was calibrated using a Low Molecular Weight Gel Filtration Calibration Kit (Amersham Biosciences; Piscataway, NJ) containing blue dextran 2000 (for the void volume measurement), albumin (67 kDa), ovalbumin (43 kDa), chymotrypsinogen A (25 kDa), and ribonuclease A (13.7 kDa). The column was operated on Dionex HPLC, with a constant flow rate of 0.5 mL/min using PBS. The chromatograms containing the retention time of the protein standards, LinkCD, and CD were recorded by the UV absorbance at 280 nm. The gel-phase distribution coefficients (Kav) for protein standards, LinkCD, and CD were calculated and a calibration standard curve plotted. The standard curve of Kav versus MW was used to estimate the molecular weights of LinkCD and CD. Enzyme Assay and Kinetics Measurements. Enzyme assays for measuring cytosine deaminase activity were performed at 37 °C in PBS. A 1 mL reaction mixture containing 5 mM 5-FC and 5 µg of LinkCD fusion protein was incubated in a 37 °C water bath, and 20 µL of aliquots were taken out at various time points (10-30 min) and quenched in 980 µL of PBS containing 0.1 N HCl. The concentrations of 5-FU in quenched solutions were calculated by measuring absorbance at 255 and 290 nm, as described by Senter and co-workers:4 mM 5-FU ) 0.185 Abs255nm - 0.049 Abs290nm mM 5-FC ) 0.119 Abs290nm - 0.025Abs255nm For enzyme kinetics measurement, 5 µg of LinkCD was added to a prewarmed 1 mL reaction volume with various concentrations of 5-FC. A 20 µL of aliquot was removed from the reaction mixture every 90 s for 12 min and quenched in 980 µL PBS containing 0.1 N HCl. The Km and Vmax parameters were calculated from double-reciprocal plots. To determine the stability of the enzyme activity at 37 °C, 50 µg of LinkCD or CD was stored in 1 mL volume of PBS at 37 °C. After various periods of incubation at 37 °C (1-48 h), the enzyme activity was measured using the method described above, and activity was normalized as the percent of enzyme activity at time zero. Circular Dichroism. A Jasco J-715 spectropolarimeter with a Peltier temperature controller was used to measure the circular dichroism spectra on CD and LinkCD. All protein samples were prepared in PBS for circular dichroism studies. Circular dichroism spectrum measurements were done using wavelength scans from 270 to 200 nm using a 0.1 cm path length cuvette at 25 °C. To determine thermal denaturation of LinkCD, circular dichroism at a fixed wavelength (222

articles

Antitumor Therapy Mediated by 5-Fluorocytosine or 223 nm) was monitored in a 1 cm path length cuvette as a function of increasing temperature starting at 20 °C. EXAM software31 was used to fit the melting temperature curves and calculate Tm for each protein sample. Hyaluronan Binding Affinity Measurement. Biacore T100 surface plasmon resonance (SPR) machine was used to measure the binding affinity of hyaluronan oligomer toward LinkCD. The surface of CM5 chip was modified with trinitrilotriacetic acid (tri-NTA) by the following protocol: (1) Activate the CM5 chip by flowing the mixture of EDC (0.4 M)/NHS (0.1 M) at 10 µL/min for 7 min. (2) Flow the solution of amino tri-NTA (10 mM) in 50 mM pH 8.5 borate buffer at 10 µL/min in 2 min pulses for 15 cycles. (3) Block the remaining activated dextran with 1 M pH 8 ethanolamine (two 4 min cycles). (4) Wash the chip with 0.25% SDS and 0.35 M EDTA alternatively until a stable baseline is reached. The tri-NTA chip was then loaded with 5 mM NiCl2, and LinkCD was immobilized on the surface through His-tag. The kinetics data were measured by flowing the hyaluronan oligomers (12-mer or 8-mer) through the LinkCD loaded chip at pH 7.4 and pH 6.0 respectively. Data were processed and analyzed with the Biacore T100 Evaluation software. Hyaluronan oligomers were digested from crude hyaluronan and purified by the published method.32 The molecular weights of the hyaluronan oligomers used are short enough so that they cannot bind to more than one binding site. In ViWo Antitumor Experiment Using C26 Tumor Model. The C26 murine adenocarcinoma model in female Balb/c mice was used for antitumor studies. 6-8 week old female Balb/c mice were purchased from Charles River Laboratories (Wilmington, MA). All animals were housed in UCSF Animal Facility under strict protocols recommended by the National Institute of Health Guide for the Care and Use of Laboratory Animals, and approved by the UCSF Institutional Animal Care and Use Committee. C26 cells were obtained from UCSF Cell Culture Facility, and were cultured in RPMI-1640 medium containing 10% FBS. To implant tumors in mice, 3 × 105 cells in 50 µL volume were injected subcutaneously on shaved right flank of each mouse. On day 11 after tumor implantation, each mouse received 0.2 unit of either purified LinkCD or CD via intratumoral injection (1 unit is defined as the amount of protein that can generate 1 µmol of 5-FU per min using 5 mM 5-FC). On the same day, drinking water was replaced with water containing 10 mg/mL 5-FC until day 40. 5-FC water was replaced every two days to reduce microbial contaminations in the bottles. Also, the amount of 5-FC intake was monitored by weighing the water bottles every two days. Three days (32) Ruhela, D.; Riviere, K.; Szoka, F. C., Jr. Efficient synthesis of an aldehyde functionalized hyaluronic acid and its application in the preparation of hyaluronan-lipid conjugates. Bioconjugate Chem. 2006, 17, 1360–1363. (33) Asai, T.; Trinh, R.; Ng, P. P.; Penichet, M. L.; Wims, L. A.; Morrison, S. L. A human biotin acceptor domain allows sitespecific conjugation of an enzyme to an antibody-avidin fusion protein for targeted drug delivery. Biomol. Eng. 2005, 21, 145– 155.

Figure 1. Construction of pET-LinkCD for protein expression in E. coli. As described in the Experimental Section, the ORF for LinkCD was inserted into pET15 vector containing the nucleotide sequence for an N-terminal His(×6) residue tag followed by a thrombin cleavage site (LVPRGS) for the expression of the LinkCD fusion protein in E. coli. The length of the fusion gene ORF is 885 bp.

after the first dose, the animals were given a second dose of the protein, 0.6 unit per mouse (day 14). The tumor sizes and body weights were measured every 2-3 days. Tumor volume (cm3) was calculated by 0.5 × height (cm) × width (cm) × length (cm). Statistics. Statistical analysis was performed using MedCalc Software version 9.1.0.1 (Belgium). To find statistically significant tumor size reduction, one-way ANOVA and Student-Newman-Keuls pairwise comparisons were performed using tumor volume data from all treatment groups. Survival data was analyzed by the log rank test, and a p value 100 days) in GDEPT studies where the CD enzyme/5-FC combination was employed for therapy. One GDEPT study, where the U-87 glioma was transduced by replicationcompetent retrovirus vector in athymic mice 7 days after tumor implantation, resulted in 90% long-term survivors up to 110 days.10 A combined therapy using the 5-FC, CDuracil phosphoribosyltransferase genes delivered in an adenoviral vector at 4 days post tumor implantation and radiation treatment in 9L brain tumor in rats produced 80% long-term survivors at 90 days.8 In both of these studies, the viral vector was inoculated into the tumor site soon after tumor implantation; the tumor volume at the time of treatment (7 or 4 days after tumor implantation) is expected to be smaller than the tumor volume in the studies reported here. It will be of interest to learn if a local delivery of LinkCD into the brain via convection enhanced delivery (CED)53-56 can provide a similar therapeutic effect to that observed in these GDEPT studies.8,10 The MAT strategy is not limited to the use of recombinant proteins: matrix targeting ligands and prodrug converting enzymes can be conjugated to other widely used drug delivery vehicles, such as liposomes and biocompatible polymers. There is an additional advantage for the combined formulation of recombinant proteins and vehicles for drug delivery: the properties of the delivery vehicles can be modified to optimize the blood circulation time for systemic delivery or CED for local administrations for brain tumor VOL. 6, NO. 3 MOLECULAR PHARMACEUTICS 811

articles therapy.56,57 In this regard CD has been PEGylated to increase the circulation time.36 Although CD enzyme activity seemed to be relatively stable with 2 PEG chains, attachment of 3 or more PEG chains on CD reduced the thermal stability of the enzyme at 37 °C with a half-life to less than 2 h.36 In spite of the reduced stability, this general approach of PEGylating CD enzymes seems promising, and could be applied to LinkCD developed here. (53) Bobo, R. H.; Laske, D. W.; Akbasak, A.; Morrison, P. F.; Dedrick, R. L.; Oldfield, E. H. Convection-enhanced delivery of macromolecules in the brain. Proc. Natl. Acad. Sci. U.S.A. 1994, 91, 2076–2080. (54) Voges, J.; Reszka, R.; Gossmann, A.; Dittmar, C.; Richter, R.; Garlip, G.; Kracht, L.; Coenen, H. H.; Sturm, V.; Wienhard, K.; Heiss, W. D.; Jacobs, A. H. Imaging-guided convection-enhanced delivery and gene therapy of glioblastoma. Ann. Neurol. 2003, 54, 479–487. (55) Voges, J.; Weber, F.; Reszka, R.; Sturm, V.; Jacobs, A.; Heiss, W. D.; Wiestler, O.; Kapp, J. F. Clinical protocol. Liposomal gene therapy with the herpes simplex thymidine kinase gene/ganciclovir system for the treatment of glioblastoma multiforme. Hum. Gene Ther. 2002, 13, 675–685. (56) MacKay, J. A.; Deen, D. F.; Szoka, F. C., Jr. Brain Res. 2005, 1035, 139–153, Distribution in brain of liposomes after convection enhanced delivery; modulation by particle charge, particle diameter, and presence of steric coating. (57) Gillies, E. R.; Dy, E.; Frechet, J. M.; Szoka, F. C. Biological evaluation of polyester dendrimer: poly(ethylene oxide) “bowtie” hybrids with tunable molecular weight and architecture. Mol. Pharmaceutics 2005, 2, 129–138.

812

MOLECULAR PHARMACEUTICS VOL. 6, NO. 3

Park et al. The antitumor activity of the LinkCD fusion protein supports the MAT approach to cancer therapy. Using a recombinant fusion protein containing the hyaluronan binding domain of TSG-6 and the CD enzyme from yeast, we show that the minimal elements for successful MAT against C26 tumor are (1) a matrix binding domain, (2) a prodrugconverting enzyme, and (3) the prodrug. However, due to our inability to yet produce a mutated LinkCD fusion protein that lacks hyaluronan binding capability to compare to the LinkCD in the tumor model, we cannot know if binding to hyaluronan is essential for the therapeutic effect. It is important to undertake such experiments to learn if MAT is a versatile prodrug activation strategy that complements ADEPT and GDEPT, and if it has the potential to target neoplastic and inflammatory diseases where components of the matrix such as hyaluronan are an accessible target. Acknowledgment. We thank Allen Graves, Neema Salimi, and Peter Hwang for their technical assistance with circular dichroism and Biacore instruments, and Nichole Macaraeg for careful animal experimentation. Supported by NIH R01-CA107268. Supporting Information Available: Additional figures and a table summarizing SPR binding kinetics data. This material is available free of charge via the Internet at http://pubs.acs.org. MP800013C