Antitumoral Activity of a Trichloromethyl Pyrimidine Analogue

Article pubs.acs.org/crt

Antitumoral Activity of a Trichloromethyl Pyrimidine Analogue: Molecular Cross-Talk between Intrinsic and Extrinsic Apoptosis Evelyn Winter,† Carine Dal Pizzol,† Fabíola B. Filippin-Monteiro,† Patrícia Brondani,‡ Andreia M. P. W. Silva,‡ Adny H. Silva,† Helio G. Bonacorso, Marcos A. P. Martins,‡ Nilo Zanatta,‡ and Tânia B. Creczynski-Pasa*,† †

Departamento de Ciências Farmacêuticas, Programa de Pós-graduaçaõ em Farmácia, Universidade Federal de Santa Catarina, 88040-900 Florianópolis SC, Brazil ‡ Departamento de Química, Universidade Federal de Santa Maria, Santa Maria RS 97105-900, Brazil S Supporting Information *

ABSTRACT: Acute lymphoblastic leukemia (ALL) is a malignant disorder caused by the proliferation of lymphoid progenitor cells and is the most common cancer in children. Cytotoxic nucleoside analogues are important chemotherapeutic agents, which are used in many cancers, including leukemias. In this study, we investigated the effects of the synthetic nucleoside analogue 1-(5,5,5-trichloro-2methoxy-4-oxopenten-2-yl)-4-trichloromethyl-pyrimidin-2(1H)-one, named compound 3 or C3, on leukemia cell lines. The compound stimulated cell death by apoptosis, evidenced by DNA fragmentation, phosphatidylserine externalization, and caspase-3 activation. Compound 3 seemed to trigger several cell death pathways. The mitochondrial pathway was evidenced through a disturbance of mitochondrial membrane potential, strong cytochrome c liberation, decrease of antiapoptotic Bcl-2 protein expression, and caspase-9 activation. The C3 also induced caspase-8 and -12 activation, an increase in the intracellular calcium level, and an overproduction of reactive oxygen species. Increased caspase 8 activity suggests that the extrinsic pathway was activated and that the ROS production and enzyme activity alteration (glutathione S-transferase, glutathione peroxidase, catalase, and glutathione reductase) might be related to oxidative stress. Finally, the increase in calcium release, CHOP expression, and caspase-12 activity might characterize endoplasmic reticulum stress. Compound 3 was likewise cytotoxic to leukemic and melanoma human cell lines. Taken together, the results contribute to further understanding the new pyrimidine analogue as a potential chemotherapeutic drug or lead molecule.

■

INTRODUCTION

unacceptably low, mainly due to acquired or primary resistance.4 Several strategies have been proposed to increase the activity of these nucleoside analogues and to circumvent the nucleoside-based relapse regimens. Among them, the development of new molecules that would better eradicate leukemia as well as solid tumors has been noticed. Pyrimidine N-alkylation is a way of functionalizing the pyrimidine ring to enhance biological activity and to increase the selectivity of the analogues.5 Moreover, the introduction of lipophilic substituents as a trichloromethyl group into bioactive molecules often increases their therapeutic efficiency due to an increase in lipophilicity.6 In conjunction with the efforts being made to develop new drugs, several studies have been conducted to evaluate new therapeutic targets for leukemia, which stimulate tumor cell death more efficiently but with minimal side effects.7−9 In

Cytotoxic nucleoside analogues are predominantly used in the treatment of hematological malignancies such as leukemia and multiple myeloma, as well as some solid tumors.1 These compounds enter cells through specific integral membrane proteins, known as nucleoside transporters, and they are metabolized intracellularly into active di- and triphosphorylated derivatives by specific kinases.2 These agents act as antimetabolites, compete with physiological nucleosides, and interact with a large number of intracellular targets leading to a cytotoxic scenario. This scenario is achieved after the binding of the compound to nucleic acids and through enzyme inhibition (mainly ribonucleotide reductase).3 Among these compounds, the pyrimidine analogue cytarabine is frequently used in the treatment of acute leukemia, and gemcitabine has shown activity against many solid tumors and hematological malignant diseases.1 Despite the widespread use of cytarabine on patients with leukemia, especially acute myeloid leukemia, the overall cure rate of these patients is © 2014 American Chemical Society

Received: March 17, 2014 Published: May 21, 2014 1040

dx.doi.org/10.1021/tx500094x | Chem. Res. Toxicol. 2014, 27, 1040−1049

Chemical Research in Toxicology

Article

Cell Culture. L1210 (murine lymphoblastic leukemia), CEM (human lymphoblastic leukemia), Jurkat (human lymphoblastic leukemia), and J774 (murine macrophage) were obtained from Banco de Células do Rio de Janeiro (BCRJ, Brazil). SK-Mel-28 (human amelanotic melanoma) and SK-Mel-147 (human melanoma) were kindly provided by professor Ana Campa (University of São Paulo, Brazil). Leukemia cell lines were cultured in RPMI 1640 medium supplemented with 10% heat-inactivated fetal bovine serum, 100 U/mL penicillin, 100 μg/mL streptomycin, and 10 mM HEPES. Melanoma cell lines and J774 were cultured as previously described, except for the medium, which was DMEM. The cells were maintained at 37 °C in a 5% CO2 humidified atmosphere. Every 2 days, the cells were passaged, and the medium was replaced. In all experiments, viable cells were checked at the beginning of the experiment by Trypan Blue exclusion. Cytotoxicity. The cytotoxicity of C3 was evaluated by the MTT [3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide] assay.20 To evaluate the influence of concentration and time on cytotoxicity, 1 × 105 cells/well were exposed to C3 (solubilized in DMSO) for different periods of time, at different concentrations (1− 100 μM). The final DMSO concentration in each well was less than 0.5%. The CC50 (cytotoxic concentration, which means concentration required to reduce the cell number by 50%) was determined by nonlinear regression analysis of the logarithm of concentration as a function of the normalized response (percentage of cell viability, at incubation time of 24 h) using the software Prism 5.0 (GraphPad Software). Moreover, the therapeutic ratio (TR) was calculated from the equation: TR = CC50 (nontumoral cell line)/CC50 (tumoral cell line). Apoptosis: Cellular Morphological Observation. To observe changes in cellular morphology, the acridine orange/ethidium bromide (AO/EB) double staining method was performed. Cells (5 × 105 cell/ well) were incubated for 12 h with C3 at concentrations of CC50. After incubation, cells were carefully washed and resuspended in PBS, and the dye mixture (0.3 μg/mL acridine orange and 1 μg/mL ethidium bromide) was added. The suspension was immediately examined by fluorescence microscopy (Nikon Eclispe TS100) at 400× magnification. Apoptotic cells show green nuclei with condensed or fragmented chromatin, and necrotic cells have uniformly orange to red nuclei with organized structure.21 Apoptosis: Annexin V/PI Staining. Cell apoptosis was assessed by measuring membrane redistribution of phosphatidylserine using ApopNexin FITC Apoptosis Detection Kit (Millipore, Billerica, MA) according to the manufacturer’s protocol. In brief, cells (1 × 106/well) were plated and treated with C3 or DMSO as the control for 12 h with concentrations corresponding to CC50 and half of the CC50. Both incubation period and concentration were chosen in order to evaluate the apoptosis process at the earlier steps. After incubation, cells were washed twice with chilled PBS, resuspended in 250 μL of binding buffer, and stained with solution containing Annexin V-FITC and propidium iodide (PI). After incubation in the dark for 15 min, the cells were analyzed by flow cytometry, and the results were analyzed using WinMDI 2.9 software. Determination of Caspase Activities. To determine the activity of caspases, 1 × 107 cells were incubated with the CC50 of C3 for 4 h at 37 °C. The time of 4 h was chosen since caspase activation occurs in the early first steps of apoptosis. The same protocol for sample preparation was chosen for the following tests: ROS determination, cytochrome c release, calcium concentration, mitochondrial membrane potential, and apoptosis-related proteins measurements. For each caspase, the reaction medium was supplemented with 100 μM AcLEHD-AFC, a fluorogenic substrate for caspase-9, with 50 μM AcDEVD-AMC, a fluorogenic substrate for caspase-3, with 25 μM AcIETD-AMC, a fluorogenic substrate for caspase-8, or with 25 μM of Ac-ATAD-AFC, a fluorogenic substrate for caspase-12. After incubation at 37 °C for 2 h, caspase activity was monitored using a spectrofluorimeter (PerkinElmer LS55), by the production of fluorescent 7-amino-4-methylcoumarin (AMC) or 7-amino-4-trifluoromethylcoumarin (AFC). The fluorescence of blanks containing no cellular extracts was subtracted from the fluorescence sample values.

general, hematological malignancies are sensitive to drugs that stimulate apoptosis, and they have shown responses to treatment with nucleoside analogues.1,10 The main function of apoptosis in mature multicellular organisms is to control the rate of cell division. Apoptosis is characterized by cell shrinkage, chromatin condensation, and nuclear and cell fragmentation. These features result in the formation of apoptotic bodies, which are engulfed by neighboring phagocytic cells.11 Among the various proteases that participate in apoptosis, caspases are the best-known proteins. Caspase-8 is the principal protease activated by the extrinsic apoptosis pathway resulting in caspase-3 activation. Likewise, the intrinsic apoptosis pathway is started by signals detected by mitochondria and results in caspase-9 and caspase-3 activation.12,13 Mitochondrial alterations can induce the liberation of molecules such as cytochrome c, which results in caspase-3 activation and eventually stimulates the apoptotic sequence. These alterations might be a result of the overproduction of reactive oxygen species (ROS) or the decrease in the mitochondrial membrane potential.14 Finally, the endoplasmic reticulum (ER) has been linked to apoptosis through protein activation as CHOP/ GADD153 and caspase-12 activation. The ion Ca2+ plays a vital role in ER function; therefore, an alteration in its homeostasis might result in ER stress, as well as in an unfolded protein response.15−17 Here, we demonstrated the cytotoxic effect of an N-alkylated pyrimidine analogue with two trichloromethyl groups (Figure 1; compound 3) synthesized previously18 on several leukemia cell lines, in order to investigate cell death pathways regarding oxidative stress and apoptosis.

Figure 1. Reagents and conditions: (i) Urea, HCl, MeOH, reflux, 20 h; (ii) 5-bromo-1,1,1-trichloro-4-methoxypent-3-en-2-one, K2CO3, acetone, reflux, 16 h.

■

MATERIALS AND METHODS

Chemicals. The cell culture mediums were purchased from Cultilab (São Paulo, SP). Serum and antibiotics were purchased from GIBCO (Grand Island, NY). ApopNexin FITC Apoptosis Detection Kit was purchased from Millipore (Billerica, MA). JC-1 probe (5,5′-, 6′6-tetrachloro-, and 1′,3,3′-tetraethylbenzymidazolcarbocianyne iodide) and primers were purchased from Life Technologies (Foster City, CA, EUA). Fluorogenic substrate caspase-12 and Fluo3AM were purchased from Biovision (Milpitas, CA), and all other reagents were purchased from Sigma Chemical Co. (St. Louis, MO). Antibodies for the FACS analyses were purchased from BD Pharmingen (San Diego, CA) . Figure 1 outlines the synthesis of 1-(5,5,5-trichloro-2-methoxy-4oxopenten-2-yl)-4-trichloromethyl-pyrimidin-2-(1H)-one (3) from the cyclocondensation of the readily available enone 1 with urea in methanol and hydrochloric acid under reflux for 20 h to give the 4trichloromthylpyrimidi-1H-2-one (2) in 90% yield.19 Pyrimidine 2 reacted with 5-bromo-1,1,1-trichloro-4-methoxypent-3-en-2-one in acetone and potassium carbonate under reflux for 16 h furnishing the desired compound 3 (C3) in 60% yield.18 1041



Article

Table 1. Sequence of Specific Primers for Each Gene Studied Including the Endogenous Control (GAPDH) gene

forward primer (5′-3′)

reverse primer (5′-3′)

product size (bp)

p53 Fas Bcl2 GAPDH CHOP

GTAAACGCTTCGAGATGTTCC TCTGCGATGAAGAGCATGGTT AGAGACTCACCAGGGTCTGC GTGTCCGTCGTGGATCTGAC GGAAGTGCATCTTCATACACCACC

GACTGGCCCTTCTTGGTCT GCAGCGAACACAGTGTTCACA GCACTACCTGCGTTCTCCTC GGAGACAACCTGGTCCTCAG TGACTGGAATCTGGAGAGCGAGGGC

123 121 113 132 315

Protein content was determined using a spectrofluorimeter at 280 nm for excitation and 340 nm for emission. Caspase activity was presented as a percentage taking into account the values of fluorescent units per μg of protein.22 Reactive Oxygen Species Determination. Intracellular free radical formation was determined using 2′,7′-dichlorofluorescein diacetate (DCFH-DA), which is oxidized to dichlorofluorescein (DCF) in the presence of ROS.23 Cells (5 × 105) were incubated with C3 (CC50) for 4 h at 37 °C. Cells were then incubated with 10 μM DCFH-DA for 30 min at 37 °C, then washed with PBS, and the DCF fluorescence signal measured. The results were normalized by the protein quantity measured spectrofluorimetrically at 280 nm for excitation and 340 nm for emission. Cytotoxicity of C3 with N-Acetyl-L-cysteine. The cytotoxicity of C3 in the presence of N-acetyl-L-cysteine (NAC) was evaluated by MTT assay.20 Then, 1 × 105 cells/well were preincubated with NAC (1 mM) for 1 h and after C3 was added at different concentrations (1−100 μM). The NAC (1 mM) alone did not induce cell death. After incubation for 24 h, the MTT assay was carried out. The CC50 of C3 plus NAC was determined and compared with the CC50 of C3 alone. Enzyme Assays. For enzyme assays, 1 × 107 cells were incubated with the CC50 of C3 for 24 h. The samples were washed twice with PBS, lysed with 20 mM phosphate buffer (pH 7.4), 150 mM NaCl, and 1% Triton X-100, sonicated for 20 s, and then centrifuged at 10.000 × g for 10 min. GPx activity was measured according to Flohé and Gunzler24 by monitoring NADPH oxidation at 340 nm. CAT activity was determined according to Aebi 25 evaluating the consumption of H2O2 by recording the absorbance at 240 nm. GR was assayed according to Carlberg and Mannervick,26 and the NADPH oxidation, which resulted from GSSG reduction by GR, was determined by its decrease in absorbance at 340 nm. GST was assayed according to Keen et al.27 In this assay, GST induces the conjugation of GSH with CDNB. The conjugate was detected spectrophotometrically at 340 nm. The results were normalized by protein concentration and expressed as percentages of enzyme activity. Mitochondrial Membrane Potential Measurement. To explore the effect of the C3 on mitochondrial membrane potential, the lipophilic cationic probe fluorochrome JC-1 was used according to the manufacturer’s procedure. Cells were plated at 1 × 106 cells/well and incubated with CC50 of C3 for 4 h. Following that, JC-1 (10 μg/ mL) was added and incubated for 20 min at 37 °C (5% CO2), then the cells were washed twice with PBS and resuspended in 200 μL of PBS, which was used to measure the fluorescence. The mitochondrial potential was presented as a ratio of 595/560 fluorescence and compared with the control cells that were considered 100% of ΔΨ. Determination of Cytochrome c Release. To determine cytochrome c release, cells (5 × 106) were treated with the CC50 of C3 for 4 h and then washed with PBS. Cells were harvested and permeabilized with 30 μmol/L of digitonin for 30 min at 4 °C in a solution containing 10 mg/mL Tris-HCl (pH 7.0), 3 mg/mL ethylene glycol, tetra-acetic acid (EGTA), and 50 μg/mL sucrose. The cells were centrifuged at 10.000 × g for 30 min. Cytochrome c release was evaluated by the method of Appaix et al.28 The absorbance of supernatants was recorded at 414 nm. Measurement of Intracellular Calcium. The changes in intracellular Ca2+ concentration were determined by the fluorescent dye Fluo-3AM. Cells were incubated with CC50 of C3 or A23187 (1 μM), a calcium ionophore used as the positive control, at 37 °C for 4 h. The cell culture medium was replaced, and cells were incubated at 37 °C for 20 min with a fresh medium containing 3 μM Fluo-3 and

0.02% of pluronic F127. HBSS with 1% of fetal bovine serum was then added and incubated for a further 40 min. The cells were washed, and the fluorescence was measured. Protein content was determined using a spectrofluorimeter at 280 nm for excitation and 340 nm for emission. Concentration on intracellular calcium was expressed as the percentage of fluorescent units per μg of protein. Cell Cycle Analysis. Cells (1 × 106) were treated with C3 for 12 h with concentrations corresponding to CC50 and half of CC50. Cells were washed with cold PBS and resuspended in 200 μL of ice 70% ethanol to fix them. After 30 min, PBS with 2% bovine serum albumin was added. The cell pellets were collected by centrifugation, resuspended in 0.25 mL of hypotonic buffer (0.1% Triton X-100 in PBS and 100 μg/mL RNase A) with PI (20 mg/mL). Fluorescence emitted from the PI−DNA complex was quantitated by flow cytometry, and the results were analyzed using WinMDI 2.9 software. Flow Cytometry Measurement of Apoptosis-Related Proteins. The expression levels of the proteins Bcl-2, p53, and Fas were measured by flow cytometry. In brief, cells were incubated with C3 (CC50) for 4 and 12 h, washed with PBS, and permeabilized in the BD Cytofix/Cytoperm buffer for 30 min at 4 °C. The cells were washed and resuspended in BD Perm/Wash buffer containing the phycoerythrin-conjugated monoclonal antibodies. The analysis of antibodies were performed separately. After 30 min of incubation at 4 °C, cells were washed and analyzed. Background fluorescence was measured using an isotype control as nonreactive immunoglobulin. In Fas protein determination, the first step of permeabilization was not performed since this protein is located in the cytoplasmic membrane. Gene Expression of Apoptosis-Related Factors. The expression of p53, Bcl-2, Fas, and CHOP genes was evaluated by realtime quantitative PCR. Initially, the total RNA was isolated using Trizol reagent (Life Technologies, Foster City, CA, USA) according to the manufacturer’s instructions. Afterward, 2 μg of total RNA was used for cDNA synthesis using High-Capacity cDNA Reverse Transcription Kit (Life Technologies, Foster City, CA, EUA). This cDNA was subsequently used for real-time quantitative PCR to quantify the gene expression levels. Maxima SYBR Green/ROX qPCR Master Mix (Thermo Fisher Scientific, Lithuania) was used to employ real-time quantitative PCR. The sequences of specific primers used for each gene studied, including the endogenous control GAPDH, are shown in Table 1. The PCR was performed using ABI 7900 at 50 °C for 2 min, at 95 °C for 10 min, followed by 40 cycles of 95 °C for 15 s, and 57 °C for 1 min. The gene-specific product was normalized to GAPDH and quantified using the comparative (ΔCt) Ct method as previously described.29 Statistical Analysis. The results were presented as the means ± standard error of the mean (SE) of triplicates from at least threeindependent experiments. Statistical significance was assessed by a t test when the control cells were compared with C3 and by one-way ANOVA followed by Dunnett’s test when more than two groups were compared to each other. p values lower than 0.05 were considered significant.

■

RESULTS Cytotoxicity of Compound 3 (C3). The effect of C3, whose structure is shown in Figure 1, was evaluated primarily in the leukemic cell line L1210 showing concentration- and timedependent cytotoxicities (Figure S1 Supporting Information), with CC50 values of 8.0 μM, 1.2 μM, and 1.1 μM after 24, 48, and 72 h, respectively. Likewise, the determination of death 1042



Article

(Figure 5). Compound 3 also induced a decrease in p53 gene expression (∼15%) and p53 protein expression (∼30%). This result can be interesting because L1210 cells present a mutation on p53 gene. A nonexpected decrease in Fas expression was observed with C3 (Figure 6B). Characterization of Endoplasmic Reticulum Stress. The effect of C3 on the endoplasmic reticulum was evaluated in this study, and as can be observed in Figure 7, C3 induced an increase of CHOP expression (∼100%), caspase-12 activation (∼40%), and an increase in calcium efflux (∼50%) higher than that of the calcium ionophore A23187 (∼20%). Characterization of Oxidative Stress. Many compounds can induce apoptotic cell death in cancer cells by increasing ROS generation, forming pores in mitochondria leading to apoptotic factors release.31−33 To evaluate if C3 cytotoxicity is associated with increased cellular oxidative stress, the following assays were performed: measurement of free radical generation, activity of the main antioxidant enzymes, and the determination of C3 toxicity in the presence of N-acetyl-L-cysteine (NAC). As shown in Figure 8A, C3 induced an increase in ROS generation. The coincubation of the cells with NAC induced a strong increase in the CC50, from 8 to 47 μM indicating that the NAC evaded the cytotoxic effect of C3 (Figure 8B). This effect was probably due to alterations in the activity of antioxidant enzymes induced by C3. An increase in the CAT and GPx activities was observed (∼61 and ∼47%, respectively) when compared to that of control cells. Additionally, an increase in the glutathione S-transferase (GST) activity (∼28%), an important enzyme in cellular defense, was observed. Finally, a significant decrease in GR activity (∼87%), an enzyme responsible for the recovery of GSH from the oxidized form GSSG (Figure 8A), was observed. Cytotoxicity in Nontumoral, Leukemia, and Melanoma Cell Lines. To better characterize the antitumoral effect of C3, the cytotoxicity was evaluated in two additional leukemic cell lines (CEM and JURKAT), two melanoma cell lines (SKMEL-28 and SKMEL-147), and two nontumoral cell lines (J774 and VERO). C3 induced morphology alterations suggesting DNA fragmentation in CEM and JURKAT leukemic cell lines (Figure S2, Supporting Information). Furthermore, the effect of C3 was compared with cytarabine, a standard nucleoside used in chemotherapy, in all cell lines and in different incubation times. The CC50 values and the therapeutic ratio (TR) obtained after 24, 48, and 72 h of incubation are shown in Tables 2, 3, and 4, respectively. C3 induced higher cytotoxicity than cytarabine in all tumoral cell lines after 24 h of incubation. C3 was also better than cytarabine in leukemic cell lines after 48 h and presented similar activity after 72 h. The main difference between C3 and cytarabine was the effect on nontumoral cell lines. After 72 h of incubation, C3 was more toxic than cytarabine to VERO cells and less toxic to J774 cells.

kinetics (fixed concentration versus time) was important for the further mechanistic assays carried out in this study, when viable cells were required. For the assays requiring cells in the early stages of apoptosis, cells were incubated for 4 h with the CC50, whereas for those requiring a stronger effect of C3, cells were incubated for 12 and 24 h with the CC50. Apoptosis Characterization. Apoptosis was characterized by a qualitative and quantitative method. To evaluate cell morphology, AO/EB double staining was used. Figure 2

Figure 2. Morphologic analysis of cell death induced by C3. L1210 cells were incubated with the CC50 of C3 for 12 h. After incubation, cells were stained with AO/EB. (A) Control cells. (B) Treated cells. Arrows indicate the DNA fragmentation in apoptotic cells.

demonstrates that C3 induced DNA fragmentation characterized by the presence of apoptotic bodies (Figure 2B). To evaluate cell death, flow cytometry analysis with Annexin V/PI staining was used. The results are presented in Figure 3, where viable cells had low FITC fluorescence and low PI fluorescence (Q1); early apoptotic cells showed high FITC fluorescence but low PI fluorescence (Q2); and late apoptotic cells had high FITC fluorescence and high PI fluorescence (Q3). Necrotic cells had low FITC fluorescence but high PI fluorescence (Q4). The percentages of apoptotic cells (Q2 + Q3) induced by C3 at concentrations corresponding to CC50 and half of CC50 was 9 and 79-fold higher than the percentage of necrotic cells (Q4) (Figure 3). Apoptotic cells can also be evidenced by the increase in the percentage of cells in the SubG0 phase of the cell cycle (Figure 4). Caspase Activities. Although the exact details of cell death pathways are not yet completely elucidated, it has been established by biochemical and genetic approaches that caspases play an essential role in various stages of the apoptotic process and that they are involved at the initial stage of the two main cell death signaling pathways.30 Therefore, caspase activities were evaluated in cells after a 4-h incubation with C3. The compound induced an increase in the activities of caspases 8 (∼20%), 9 (∼40%), and 3 (more than 100%) (Figure 5), suggesting that C3 might be involved in both apoptosis pathways, intrinsic and extrinsic ones. Characterization of Apoptosis-Related Factors. In order to investigate if cell death induced by C3 was related with the mitochondrial-induced apoptosis process, mitochondrial membrane potential (ΔΨm), cytochrome c release, and expression of antiapoptotic protein Bcl-2 were evaluated. Compound 3 induced a decrease in Bcl-2 gene expression (∼33%), Bcl-2 protein expression (∼40%), and a slight decrease in the ΔΨm (∼20%). Although the ΔΨm reduction was small, it seemed to be sufficient to strongly increase (almost 300%) cytochrome c release into the cytosol (Figure 6A). These results corroborate the increase of caspase-9 activity

■

DISCUSSION Nucleoside analogues, including C3, are a pharmacologically diverse family, which includes cytotoxic, antiviral and immunosuppressive molecules. The anticancer nucleosides include several analogues of physiological pyrimidine and purine nucleosides. The growing importance of nucleoside analogues as cytotoxic agents has stemmed from the development of newer compounds with broad applicability to common cancers and from an understanding of their mechanisms of action, enabling pharmacological intervention to potentiate the 1043



Article

Figure 3. Cell death induction in L1210 cells by C3. The apoptosis was measured by Annexin-V-FITC/PI staining after 12 h of incubation with the CC50 and half of the CC50 of C3. Dot plot: The horizontal and vertical axes represent labeling with Annexin-V-FITC and PI, respectively. Q1 represents live cells, Q2 represents early apoptotic cells, Q3 represents late apoptotic cells, and Q4 represents necrotic cells. Dot plots shown are representative of one experiment. The graph shows the mean ± SE of three independent experiments. *p < 0.05 and **p < 0.01 compared with the control using ANOVA followed by Dunnet’s test.

antitumor effects of these compounds.1 For example, the pyrimidine analogue cytarabine is an important drug for leukemia; however, it has little effect on patients with solid tumors. Gemcitabine was developed from cytarabine, and presents good activity on a variety of solid tumors.1,34,35 It has been shown in this study that C3, a pyrimidine analogue, induced apoptosis in different leukemia and melanoma cells lines, suggesting that this compound has a good spectrum of action. Compared with cytarabine, C3 presented an equivalent antitumoral activity in in vitro assays. Nucleoside analogues such as cytarabine and gemcitabine are generally hydrophilic molecules presenting log P values of −2.8 and −1.4, respectively. The high hydrophilicity of these molecules limits a passive diffusion across biological membranes, and their passage across the lipid membrane requires specialized nucleoside transporter proteins (NT). However, NT have been linked mechanistically with drug resistance.1,35 Conversely, C3 has two trichloromethyl groups in its structure, which improves its lipophilicity resulting in a log P value of 3.85. The high lipophilicity of C3 could facilitate the entry into cells avoiding the NT. Some studies have demonstrated that the

Figure 4. Effect of C3 on cell cycle distribution in leukemia cells. Cells were treated for 12 h with the CC50 and half of the CC50 of C3 and stained with PI. Data represent the percentage of cell counts in each cell cycle phase. The results are expressed as the mean ± SE of three independent experiments. *p < 0.05 and **p < 0.01 compared with the control using ANOVA followed by Dunnet’s test.

1044



Article

Figure 5. Activation of caspase-3, -8, and -9 by C3. Leukemia cells were incubated with the CC50 of C3 for 4 h. Caspase activities were measured by monitoring the cleavage of fluorogenic substrates specific for each caspase. The activity was expressed as the percentage of control cells. The results are expressed as the mean ± SE of five independent experiments, and the statistical analysis was done comparing each caspase with the control. *p < 0.05 and **p < 0.01 compared with the control using the t test.

Figure 7. Effect of C3 on the endoplasmic reticulum. Cells were incubated for 4 h with C3 at CC50 and with A23187 used as the positive control for calcium determination. The calcium concentration was evaluated by a fluorescent dye (Fluo-3). Caspase-12 activities were measured by monitoring the cleavage of the fluorogenic substrate, and CHOP expression was evaluated by real time PCR. Control cells, without C3, were considered 100%. The results were expressed in percentage as the mean ± SE. *p < 0.05 and **p < 0.01 compared with the control using t test.

trifluoromethyl substituents bound to a series of molecules often increase their efficiency to cross lipophilic barriers, due to the increase in their lipophilicity.36,37 In addition, Abdou et al.38 showed antileukemic activity of several trifluoromethylsubstituted nucleosides, however, with higher CC50 than that of C3. On the basis of these results, new nucleoside analogues with lipophilic groups are in development for further structure−activity relationship (SAR) studies. C3 presents a structure similar to the anticancer drug 5fluorouracil (5-FU). 5-FU is a uracil analogue, which is converted in the nucleotide dUMP in the cells. Normally, dUMP is converted in the nucleotide dTMP by thymidylate synthase, and the dTMP is incorporated to DNA for elongation. 5-FU is converted in a modified nucleotide

(FdUMP), which blocks the action of thymidilate synthase and consequently the dTMP formation. Another hypothesis is that the 5-FU intercalates directly in DNA through the intermediate FdUTP as well as cytarabine and blocks DNA polymerase and chain elongation. Finally, 5-FU can also be metabolized to a FUTP-intermediate, which can intercalate in RNA molecules.39,40 If C3 would act as 5-FU, it could block the thymidylate synthase or intercalate in the DNA chain, as cytarabine and 5FU, breaking DNA. In both situations, the result would be DNA fragmentation and apoptosis of the cells as evidenced in

Figure 6. Effect of C3 on mitochondrial apoptosis-related factors, p53 and Fas. Cells were incubated with C3 at the CC50 for 4 h. The ΔΨm was investigated using the JC-1, the cytochrome c release was measured spectrophotometrically, the protein expression was evaluated using specific antibodies by flow cytometry, and the gene expression was evaluated by real time PCR. Control cells, without C3, were considered 100%. The results were expressed in percentage as the mean ± SE. *p < 0.05 and **p < 0.01 compared with the control using the t test. 1045



Article

Figure 8. Effect of C3 related to oxidative stress. (A) Leukemia cells were incubated with the CC50 of C3. ROS production was followed using DCFH-DA after 4 h of incubation, and the results represent the percentage of ROS generation. CAT, GPx, GR, and GST were evaluated spectrophotometrically after 24 h of incubation, and the results represent the percentage of enzymatic activity. (B) A concentration−response curve was done with C3 alone and associated with NAC (1 mM). Cells were preincubated for 1 h with NAC, C3 was added, and the cells were incubated for 24 h. NAC alone did not induce cell death. The results represent the mean ± SE of three independent experiments. *p < 0.05, **p < 0.01, and ***p < 0.001 compared with the control using the t test.

Table 2. Effect of C3 and Cytarabine on Distinct Cell Lines after 24 h of Incubation

a

CC50 (μM) 24 h

L1210

JURKAT

CEM

SKMEL-28

SKMEL-147

VERO

J774

C3 TRa (VERO) TR (J774) cytarabine TR (VERO) TR (J774)

8 3.1 0.4 >200 >1 >1

3.8 5.8 0.8 >200 >1 >1

1.9 11.7 1.6 >200 >1 >1

6.2 3.6 0.5 >200 >1 >1

3.1 7.2 1 >200 >1 >1

22.2

3.1

>200

>200

TR = therapeutic ratio.


a

CC50 (μM) 48 h

L1210

JURKAT

CEM

SKMEL-28

SKMEL-147


1.2 3.4 2 1.7 >59 2.3

1.8 2.3 1.4 >100 >1 36 1.4

2.2 1.9 1.1 1.1 >91 3.5

2.3 1.8 1 1.9 >53 2

VERO

J774

4.1

2.5

>100

3.9

VERO

J774

3.0

1.2

>100

0.3



a

CC50 (μM) 72 h

L1210

JURKAT

CEM

SKMEL-28

SKMEL-147


1.1 2.7 1.1 0.9 >111 0.3

1.1 2.7 1.1 0.1 >1000 3

1.2 2.5 1 2.2 >45 0.1

2.1 1.4 0.6 0.5 >200 0.6

1.4 2.1 0.8 0.7 >143 0.4


this study. The apoptosis triggered by C3 was evidenced by cell death characteristics, such as chromatin condensation and DNA fragmentation, and by the flow cytometry profile. The DNA damage induced by nucleotide analogues can induce several alterations in cellular metabolism as ROS generation and apoptosis induction. DNA molecules damaged sensors inside the cell as DNA-PK, ATM, and ATR recognize

strand breaks and thus become activated regulating the activity of a number of proteins involved in cellular stress and apoptosis.41 The cytotoxicity of cytarabine and 5-FU has been related to ROS generation by mechanisms not totally elucidated,42−44 although in many cases the p53 activation is involved.45,46 In this study, we did not find an increase in p53 expression. The 1046



Article

effect of C3 might be related to other factors. Other studies showed that 5-FU can trigger the apoptosis by Fas activation and caspase-8 induction.41,47 Caspase-8 can induce mitochondrial damage by Bid proteins, which connect the extrinsic and intrinsic apoptosis pathways. The intrinsic pathway involves caspase-9 activation, decrease in MMP (mitochondrial membrane permeabilization), release of cytochrome c, and decrease in antiapoptotic Bcl-2 protein, and increase in caspase3 activity being the outcome of the activation of caspase-2initiators. In this work, we observed that C3 induced an increase of caspase-8, -9, and -3 activities, which can be related to a direct effect of C3 resulting from a decrease in MMP, and in Bcl-2 expression, as well as an increase in cytochrome c liberation. The mitochondrial damage induced by C3 could finally induce ROS increase in the cell. To minimize the damage of ROS, aerobic organisms were endowed with enzymatic and nonenzymatic antioxidant defenses. The principal enzymatic defenses against hydrogen peroxide (H2O2) are catalase and glutathione peroxidase.48 An increase in catalase and glutathione peroxidase activities was observed after cell incubation with C3. These results suggest that the H2O2 might be the main reactive species produced. GSH is the most important nonenzymatic antioxidant, and normally, the majority of the molecules of GSH remains reduced by GR. However, in an oxidative stress condition a decrease in GSH content and an increase in GSSG content are eventually observed. C3 triggered a strong decrease in GR activity. This effect might result in low GSH levels and even higher ROS levels. GST does not act directly against ROS; however, it is an important defense as part of the phase II detoxification responsible for the protection of cellular macromolecules from the attack of reactive electrophiles, via GSH conjugation. Exposure to anticancer agents may trigger the expression of gene products that protect the cell as GST.49 The increase in GST activity induced by C3 could be a result of the attempted tumor cell detoxification. Many organelles are involved in the apoptosis process, and the endoplasmic reticulum (ER), as well as mitochondria, can be responsible for triggering cell death. The ER is the main storage site of calcium and is highly sensitive to disturbances in its environment. Thus, calcium ionophores, inhibitors of glycosylation, chemical toxicants, oxidative stress, and/or accumulation of misfolded proteins in the ER can result in whatever has been referred to as ER stress. Like mitochondria, ER is a repository for proapoptotic factors such as caspase-12 as well as for antiapoptotic factors.50 One of the main components related to ER stress is C/EBP homologous protein (CHOP) also known as GADD153. Elevated levels of CHOP leads to the inhibition of antiapoptotic Bcl-2, stimulation of death receptor 5 (DR5), increase of pro-apoptotic protein Bim, caspase activation, and mitochondrial events.51,52 C3 induced an increase in CHOP expression and caspase-12 and calcium concentration, giving us strong evidence that ER stress is involved in its mechanism of action. Yadunandam et al.53 showed that 5-FU induced ER stress involving calcium generation and an increase in caspase-12 activity, calpain expression, and other apoptotic factors, but the exact connection between DNA fragmentation and ER stress was not elucidated. ER stress induced by C3 could be a result of mitochondrial damage, or C3 as well as 5-FU could induce a misprocessing of RNA precursors and disruption of mRNA as proposed in other works.54,55

Although, we found a reasonable relationship among the results showed in this work, one point remains to be understood: the decrease in p53 gene expression as well as p53 protein expression. In an attempt to gain insight into this matter, some aspects are discussed. Cancer cells have evolved numerous strategies to resist cell death induction by both extrinsic and intrinsic pathways.56 For example, surface expression of death receptors may vary between different cell types and can be down regulated or mutated in resistant forms of tumors including leukemias.57,58 Additionally, the transcription factor p53 is directly mutated in over 50% of tumors, and its mutation is related to a poor clinical outcome in childhood ALL.59,60 Du et al.61 achieved a higher antileukemic effect using a combination of chemotherapies that together induce the intrinsic, extrinsic, and ER stress apoptosis pathways. As the L1210 cell line is p53 mutated,62,63 we hypothesize that C3 as a drug could decrease p53-mutated expression and induce several apoptosis pathways circumventing the resistance phenomenon. In conclusion, this study showed a new pyrimidine analogue with cytotoxic activity and apoptosis-inducing effect on leukemia cells. Our findings demonstrated that C3 had the advantage to act through the multitarget, inducing both the extrinsic and intrinsic pathways of apoptosis, and this phenomenon can be related to an increase in oxidative and endoplasmic reticulum stress. Other nucleoside analogues are being developed based on these results, which could be useful in drug design to improve cancer chemotherapy and to circumvent drug resistance.

■

ASSOCIATED CONTENT

S Supporting Information *

Concentration and time-response of C3 in L1210 cells and effect of C3 on the morphology of leukemia cells CEM and Jurkat. This material is available free of charge via the Internet at http://pubs.acs.org.

■

AUTHOR INFORMATION

Corresponding Author

*Tel: + 55 48 37212212. Fax: + 55 48 37219542. E-mail: tania. [email protected]. Funding

The study developed by our group was supported by grants from CNPq (Conselho Nacional de Desenvolvimento ́ Cientifico e Tecnológico), CAPES (Coordenaçaõ de Aperfeí çoamento de Pessoal de Nivel Superior), and FAPESC (Fundaçaõ de Amparo à Pesquisa de Santa Catarina). Notes

The authors declare no competing financial interest.

■

ABBREVIATIONS ROS, reactive oxygen species; GST, glutathione S-transferase; GSH, glutathione reduced; GSSG, glutathione oxidized; GR, glutathione reductase; GPx, glutathione peroxidase; CAT, catalase; NAC, N-acetyl-L-cysteine; ER, endoplasmic reticulum; TR, therapeutic ratio; PI, propidium iodide; MMP, mitochondrial membrane permeabilization AO/EB acridine orange/ etidium bromide 1047



■

Article

(23) Cathcart, R., Schwiers, E., and Ames, B. N. (1983) Detection of picomole levels of hydroperoxides using a fluorescent dichlorofluorescein assay. Anal. Biochem. 134, 111−116. (24) Flohe, L., and Gunzler, W. A. (1984) Assays of glutathione peroxidase. Methods Enzymol. 105, 114−121. (25) Aebi, H. (1984) Catalase in vitro. Methods Enzymol. 105, 121− 126. (26) Carlberg, I., and Mannervik, B. (1975) Purification and characterization of the flavoenzyme glutathione reductase from rat liver. J. Biol. Chem. 250, 5475−5480. (27) Keen, J. H., Habig, W. H., and Jakoby, W. B. (1976) Mechanism for the several activities of the glutathione S-transferases. J. Biol. Chem. 251, 6183−6188. (28) Appaix, F., Minatchy, M., Riva-Lavieille, C., Olivares, J., Antonsson, B., and Saks, V. A. (2000) Rapid spectrophotometric method for quantitation of cytochrome c release from isolated mitochondria or permeabilized cells revisited. Biochim. Biophys. Acta 1457, 175−181. (29) Livak, K. J., and Schmittgen, T. D. (2001) Analysis of relative gene expression data using real-time quantitative PCR and the 2(T)(Delta Delta C) method. Methods 25, 402−408. (30) Grutter, M. G. (2000) Caspases: key players in programmed cell death. Curr. Opin. Struct. Biol. 10, 649−655. (31) Sayers, T. J. (2011) Targeting the extrinsic apoptosis signaling pathway for cancer therapy. Cancer Immunol. Immunother. 60, 1173− 1180. (32) Moon, D. O., Kim, M. O., Lee, J. D., Choi, Y. H., and Kim, G. Y. (2010) Rosmarinic acid sensitizes cell death through suppression of TNF-alpha-induced NF-kappaB activation and ROS generation in human leukemia U937 cells. Cancer Lett. 288, 183−191. (33) Lee, M. G., Lee, K. T., Chi, S. G., and Park, J. H. (2001) Costunolide induces apoptosis by ROS-mediated mitochondrial permeability transition and cytochrome C release. Biol. Pharm. Bull. 24, 303−306. (34) Guchelaar, H. J., Richel, D. J., and van Knapen, A. (1996) Clinical, toxicological and pharmacological aspects of gemcitabine. Cancer Treat. Rev. 22, 15−31. (35) Zhang, J., Visser, F., King, K. M., Baldwin, S. A., Young, J. D., and Cass, C. E. (2007) The role of nucleoside transporters in cancer chemotherapy with nucleoside drugs. Cancer Metastasis Rev. 26, 85− 110. (36) Zanatta, N., Brondani, P. B., Amaral, S. S., Oliveira, T. D., Bonacorso, H. G., and Martins, M. A. P. (2009) N-Alkylation of 4trichloromethylpyrimidinones: synthesis of some new and interesting modified nucleoside analogues. Org. Chem. Insights 2, 7−14. (37) Welch, J. T. (1987) Advances in the preparation of biologically active organofluorine compounds. Tetrahedron 43, 3123−3197. (38) Abdou, I. M., Saleh, A. M., and Zohdi, H. F. (2004) Synthesis and antitumor activity of 5-trifluoromethyl-2,4- dihydropyrazol-3-one nucleosides. Molecules 9, 109−116. (39) Longley, D. B., Harkin, D. P., and Johnston, P. G. (2003) 5fluorouracil: mechanisms of action and clinical strategies. Nat. Rev. Cancer 3, 330−338. (40) de Vries, J. F., Falkenburg, J. H., Willemze, R., and Barge, R. M. (2006) The mechanisms of Ara-C-induced apoptosis of resting Bchronic lymphocytic leukemia cells. Haematologica 91, 912−919. (41) Sampath, D., Rao, V. A., and Plunkett, W. (2003) Mechanisms of apoptosis induction by nucleoside analogs. Oncogene 22, 9063− 9074. (42) Iacobini, M., Menichelli, A., Palumbo, G., Multari, G., Werner, B., and Del Principe, D. (2001) Involvement of oxygen radicals in cytarabine-induced apoptosis in human polymorphonuclear cells. Biochem. Pharmacol. 61, 1033−1040. (43) Lamberti, M., Porto, S., Marra, M., Zappavigna, S., Grimaldi, A., Feola, D., Pesce, D., Naviglio, S., Spina, A., Sannolo, N., and Caraglia, M. (2012) 5-Fluorouracil induces apoptosis in rat cardiocytes through intracellular oxidative stress. J. Exp. Clin. Cancer Res. 31, 60. (44) Hwang, I. T., Chung, Y. M., Kim, J. J., Chung, J. S., Kim, B. S., Kim, H. J., Kim, J. S., and Yoo, Y. D. (2007) Drug resistance to 5-FU

REFERENCES

(1) Galmarini, C. M., Mackey, J. R., and Dumontet, C. (2002) Nucleoside analogues and nucleobases in cancer treatment. Lancet Oncol. 3, 415−424. (2) Galmarini, C. M., Mackey, J. R., and Dumontet, C. (2001) Nucleoside analogues: mechanisms of drug resistance and reversal strategies. Leukemia 15, 875−890. (3) Galmarini, C. M., Popowycz, F., and Joseph, B. (2008) Cytotoxic nucleoside analogues: different strategies to improve their clinical efficacy. Curr. Med. Chem. 15, 1072−1082. (4) Giles, F., Verstovsek, S., Garcia-Manero, G., Thomas, D., Ravandi, F., Wierda, W., Ferrajoli, A., Kornblau, S., Jabbour, E., Shan, J., O’brien, S., Albitar, M., and Kantarjian, H. (2006) Validation of the European Prognostic Index for younger adult patients with acute myeloid leukaemia in first relapse. Br. J. Hamaetol. 134, 58−60. (5) Hattori, H., Nozawa, E., Iino, T., Yoshimura, Y., Shuto, S., Shimamoto, Y., Nomura, M., Fukushima, M., Tanaka, M., Sasaki, T., and Matsuda, A. (1998) Nucleosides and nucleotides. 175. Structural requirements of the sugar moiety for the antitumor activities of new nucleoside antimetabolites, 1-(3-C-ethynyl-beta-D-ribopentofuranosyl)cytosine and -uracil. J. Med. Chem. 41, 2892−2902. (6) Lin, P., and Jiang, J. L. (2000) Synthesis of monotrifluoromethylsubstituted saturated cycles. Tetrahedron 56, 3635−3671. (7) Debatin, K. M. (2004) Apoptosis pathways in cancer and cancer therapy. Cancer Immunol. Immunother. 53, 153−159. (8) Zhang, G., Wu, H., Zhu, B., Shimoishi, Y., Nakamura, Y., and Murata, Y. (2008) Effect of dimethyl sulfides on the induction of apoptosis in human leukemia Jurkat cells and HL-60 cells. Biosci. Biotechnol. Biochem. 72, 2966−2972. (9) Nicholson, D. W. (2000) From bench to clinic with apoptosisbased therapeutic agents. Nature 407, 810−816. (10) Gudkov, A. V., and Komarova, E. A. (2003) The role of p53 in determining sensitivity to radiotherapy. Nat. Rev. Cancer 3, 117−129. (11) Cotter, T. G. (2009) Apoptosis and cancer: the genesis of a research field. Nat. Rev. Cancer 9, 501−507. (12) Riedl, S. J., and Shi, Y. G. (2004) Molecular mechanisms of caspase regulation during apoptosis. Nat. Rev. Mol. Cell Biol. 5, 897− 907. (13) Kiechle, F. L., and Zhang, X. B. (2002) Apoptosis: biochemical aspects and clinical implications. Clin. Chim. Acta 326, 27−45. (14) Jeong, S. Y., and Seol, D. W. (2008) The role of mitochondria in apoptosis. BMB Rep. 41, 11−22. (15) Groenendyk, J., and Michalak, M. (2005) Endoplasmic reticulum quality control and apoptosis. Acta Biochim. Polym. 52, 381−395. (16) Sitia, R., and Braakman, I. (2003) Quality control in the endoplasmic reticulum protein factory. Nature 426, 891−894. (17) Berridge, M. J. (2002) The endoplasmic reticulum: a multifunctional signaling organelle. Cell Calcium 32, 235−249. (18) Zanatta, N., Flores, D. C., Amaral, S. S., Bonacorso, H. G., Martins, M. A. P., and Flores, A. F. C. (2005) Design and synthesis of novel trichloromethylated N-azolylmethyl-1H-pyrimidin-2-ones and related N-methylenaminones. Synlett 20, 3079−3082. (19) Pacholski, I., Blanco, I., Zanatta, N., and Martins, M. (1991) 4Alkoxy-1,1,1-trihalo-3-alken-2-ones as building blocks for trihalomethylated heterocycles. J. Braz. Chem. Soc. 2, 118−120. (20) Mosmann, T. (1983) Rapid colorimetric assay for cellular growth and survival: application to proliferation and cytotoxicity assays. J. Immunol. Methods 65, 55−63. (21) Baskic, D., Popovic, S., Ristic, P., and Arsenijevic, N. N. (2006) Analysis of cycloheximide-induced apoptosis in human leukocytes: fluorescence microscopy using annexin V/propidium iodide versus acridin orange/ethidium bromide. Cell Biol. Int. 30, 924−932. (22) Zuse, A., Prinz, H., Muller, K., Schmidt, P., Gunther, E. G., Schweizer, F., Prehn, J. H., and Los, M. (2007) 9-Benzylidenenaphtho[2,3-b]thiophen-4-ones and benzylidene-9(10H)-anthracenones as novel tubulin interacting agents with high apoptosis-inducing activity. Eur. J. Pharmacol. 575, 34−45. 1048



Article

linked to reactive oxygen species modulator 1. Biochem. Biophys. Res. Commun. 359, 304−310. (45) Hwang, P. M., Bunz, F., Yu, J., Rago, C., Chan, T. A., Murphy, M. P., Kelso, G. F., Smith, R. A., Kinzler, K. W., and Vogelstein, B. (2001) Ferredoxin reductase affects p53-dependent, 5-fluorouracilinduced apoptosis in colorectal cancer cells. Nat. Med. 7, 1111−1117. (46) Kanno, S., Higurashi, A., Watanabe, Y., Shouji, A., Asou, K., and Ishikawa, M. (2004) Susceptibility to cytosine arabinoside (Ara-C)induced cytotoxicity in human leukemia cell lines. Toxicol. Lett. 152, 149−158. (47) Zhang, W., Ramdas, L., Shen, W., Song, S. W., Hu, L., and Hamilton, S. R. (2003) Apoptotic response to 5-fluorouracil treatment is mediated by reduced polyamines, non-autocrine Fas ligand and induced tumor necrosis factor receptor 2. Cancer Biol. Ther. 2, 572− 578. (48) Nordberg, J., and Arner, E. S. (2001) Reactive oxygen species, antioxidants, and the mammalian thioredoxin system. Free Radical Biol. Med. 31, 1287−1312. (49) Townsend, D. M., and Tew, K. D. (2003) The role of glutathione-S-transferase in anti-cancer drug resistance. Oncogene 22, 7369−7375. (50) Rao, R. V., Ellerby, H. M., and Bredesen, D. E. (2004) Coupling endoplasmic reticulum stress to the cell death program. Cell Death Differ. 11, 372−380. (51) Oyadomari, S., and Mori, M. (2004) Roles of CHOP/ GADD153 in endoplasmic reticulum stress. Cell Death Differ. 11, 381−389. (52) Schonthal, A. H. (2013) Pharmacological targeting of endoplasmic reticulum stress signaling in cancer. Biochem. Pharmacol. 85, 653−666. (53) Yadunandam, A. K., Yoon, J. S., Seong, Y. A., Oh, C. W., and Kim, G. D. (2012) Prospective impact of 5-FU in the induction of endoplasmic reticulum stress, modulation of GRP78 expression and autophagy in Sk-Hep1 cells. Int. J. Oncol. 41, 1036−1042. (54) Greenhalgh, D. A., and Parish, J. H. (1989) Effects of 5fluorouracil on cytotoxicity and RNA metabolism in human colonic carcinoma cells. Cancer Chemother. Pharmacol. 25, 37−44. (55) Burger, K., Muhl, B., Harasim, T., Rohrmoser, M., Malamoussi, A., Orban, M., Kellner, M., Gruber-Eber, A., Kremmer, E., Holzel, M., and Eick, D. (2010) Chemotherapeutic drugs inhibit ribosome biogenesis at various levels. J. Biol. Chem. 285, 12416−12425. (56) Fulda, S., and Debatin, K. M. (2006) Extrinsic versus intrinsic apoptosis pathways in anticancer chemotherapy. Oncogene 25, 4798− 4811. (57) Friesen, C., Fulda, S., and Debatin, K. M. (1997) Deficient activation of the CD95 (APO-1/Fas) system in drug-resistant cells. Leukemia 11, 1833−1841. (58) Debatin, K. M., Stahnke, K., and Fulda, S. (2003) Apoptosis in hematological disorders. Semin. Cancer Biol. 13, 149−158. (59) Cheok, C. F., Verma, C. S., Baselga, J., and Lane, D. P. (2011) Translating p53 into the clinic. Nat. Rev. Clin. Oncol. 8, 25−37. (60) Kawamura, M., Ohnishi, H., Guo, S. X., Sheng, X. M., Minegishi, M., Hanada, R., Horibe, K., Hongo, T., Kaneko, Y., Bessho, F., Yanagisawa, M., Sekiya, T., and Hayashi, Y. (1999) Alterations of the p53, p21, p16, p15 and RAS genes in childhood T-cell acute lymphoblastic leukemia. Leuk. Res. 23, 115−126. (61) Du, Y., Wang, K., Fang, H., Li, J., Xiao, D., Zheng, P., Chen, Y., Fan, H., Pan, X., Zhao, C., Zhang, Q., Imbeaud, S., Graudens, E., Eveno, E., Auffray, C., Chen, S., Chen, Z., and Zhang, J. (2006) Coordination of intrinsic, extrinsic, and endoplasmic reticulummediated apoptosis by imatinib mesylate combined with arsenic trioxide in chronic myeloid leukemia. Blood 107, 1582−1590. (62) Cory, A. H., Chen, J., and Cory, J. G. (2006) Effects of PRIMA1 on wild-type L1210 cells expressing mutant p53 and drug-resistant L1210 cells lacking expression of p53: necrosis vs. apoptosis. Anticancer Res. 26, 1289−1295. (63) He, A. W., and Cory, J. G. (1998) Effect of ionizing radiation on wild-type and mutant mouse leukemia L1210 cells. Oncol. Res. 10, 455−464. 1049


Antitumoral Activity of a Trichloromethyl Pyrimidine Analogue

Recommend Documents