Anal. Chem. 2006, 78, 2918-2924
Aptamer-Conjugated Nanoparticles for Selective Collection and Detection of Cancer Cells Joshua K. Herr, Joshua E. Smith, Colin D. Medley, Dihua Shangguan, and Weihong Tan*
Center for Research at the Bio/Nano Interface, Department of Chemistry and Shands Cancer Center, UF Genetics Institute and McKnight Brain Institute, University of Florida, Gainesville, Florida 32611
We have developed a method for the rapid collection and detection of leukemia cells using a novel two-nanoparticle assay with aptamers as the molecular recognition element. An aptamer sequence was selected using a cell-based SELEX strategy in our laboratory for CCRF-CEM acute leukemia cells that, when applied in this method, allows for specific recognition of the cells from complex mixtures including whole blood samples. Aptamer-modified magnetic nanoparticles were used for target cell extraction, while aptamer-modified fluorescent nanoparticles were simultaneously added for sensitive cell detection. Combining two types of nanoparticles allows for rapid, selective, and sensitive detection not possible by using either particle alone. Fluorescent nanoparticles amplify the signal intensity corresponding to a single aptamer binding event, resulting in improved sensitivity over methods using individual dye-labeled probes. In addition, aptamermodified magnetic nanoparticles allow for rapid extraction of target cells not possible with other separation methods. Fluorescent imaging and flow cytometry were used for cellular detection to demonstrate the potential application of this method for medical diagnostics.
Accurate, sensitive methods for leukemia diagnosis facilitate the selection of effective therapeutic pathways by clinicians. Assays for sensitive minimal residual disease detection are also essential for monitoring disease development and distinguishing those who are more susceptible to relapse. Current methods for leukemia diagnosis apply combinations of bone marrow and peripheral blood cytochemical analyses including karyotyping,1 immunophenotyping by flow cytometry2 or microarray,3 and amplification of malignant cell mutations by PCR.4 Immunophenotypic analyses of leukemia cells use antibody probes to exploit the variation of specific surface antigens in order to differentiate malignant cells from normal cell lines. The limitation to this method is that antigens used for cell recognition are normally not exclusively expressed on any single cell type, * To whom correspondence should be addressed. E-mail:
[email protected]. Phone: 352-846-2410. Fax: 352-846-2410. (1) Faderl, S.; Kantarjian, H. M.; Talpaz, M.; Estrov, Z. Blood 1998, 91, 39954019. (2) Paredes-Aguilera, R.; et al. Am. J. Hematol. 2001, 68, 69-74. (3) Belov, L.; de la Vega, O.; dos Remedios, C. G.; Mulligan, S. P.; Christopherson, R. I. Cancer Res. 2001, 61, 4483-4489. (4) Ghossein, R. A.; Bhattacharya, S. Eur. J. Cancer 2000, 36. 1681-1694.
2918 Analytical Chemistry, Vol. 78, No. 9, May 1, 2006
dramatically influencing sensitivity, and resulting in false positive signals. Because of this, immunophenotypic analyses often require multiple antibody probes for accurate cell detection, increasing both the complexity and the cost of the method. PCR-based methods have proven to be highly sensitive diagnostic techniques for cellular recognition,4-6 but they are indirectly detecting cells by monitoring RNA expression and require prolonged RNA isolation steps before analysis. In addition, the variable sensitivity of PCR can limit its effectiveness as a diagnostic technique and can lead to false-negative results, particularly with occult tumor cells where low-level signals are expected.4 Immunophenotypic analyses are also time-consuming and costly, and therefore, there is still a need to develop new technologies for rapid, economical cell recognition. Here an assay using aptamer-conjugated nanoparticles is described for the rapid detection of acute leukemia cells using high-affinity DNA aptamers for signal recognition. An 88-base oligonucleotide sequence with specific binding properties (Kd ) 5 nM) for CCRF-CEM acute leukemia cells was attached to magnetic and fluorescent nanoparticles in order to develop a specific platform for collecting and imaging intact target leukemia cells from mixed cell and whole blood samples. Highly specific DNA aptamers are selected by SELEX7,8 to bind with specific molecular or cellular targets. Of late, aptamers have been recognized as reliable affinity ligands, which rival antibodies in their diagnostic potential.9 While antibodies are still extracted and purified from animals, aptamers can be easily synthesized for the analysis of molecules unlimited by toxicity and without animal destruction.10 Aptamers11-15 are able to fold into unique (5) Iinuma, H.; Okimaga, K.; Adachi, M.; Suda, K.; Sekine, T.; Sakagawa, K.; Baba, Y.; Tamura, J.; Kumagai, H.; Ida, A. Int. J. Cancer 2000, 89, 337344. (6) Liu Yin, J. A.; Grimwade, D. Lancet 2002, 360, 160-162. (7) Ellington, A. D.; Szostak, J. W. Nature 1990, 346, 816-820. (8) Tuerk, C.; Gold, L. Science 1990, 249, 505-510. (9) Brody, E. N.; Gold, L. Rev. Mol. Biotechnol. 2000, 74, 5-13. (10) Tombelli, S.; Minunni, M.; Mascini, M. Biosens. Bioelectron. 2005, 20, 2424-2434. German, I.; Buchanan, D. D.; Kennedy R. T. Anal. Chem. 1998, 70, 4540-4545. (11) Kirby, R.; Cho, E. J.; Gehrke, B.; Bayer, T.; Park, Y. S.; Neikirk, D. P.; McDevitt, J. T.; Ellington, A. D. Anal. Chem. 2004, 76, 4066-4075. Tan, W.; Wang, K.; Drake, T. Curr. Opin. Chem. Biol. 2004, 8 (5), 547-553. (12) Yang, C. J.; Jockusch, S.; Vicens, M.; Turro, T.; Tan, W. Proc. Natl. Acad. Sci. U.S.A. 2005, 102, 17278-17283. Li, J.; Fang, X.; Tan, W. Biochem. Biophys. Res. Commun. 2002, 292 (1), 31-40. (13) Osborne, S. E.; Matsumura, I.; Ellington, A. D. Curr. Opin. Chem. Biol. 1997, 1, 5-9. (14) Farokhzad, O. C.; Jon, S.; Khademhosseini, A.; Tran, T. T.; LaVan, D. A.; Langer, R. Cancer Res. 2004, 64, 7668-7672. 10.1021/ac052015r CCC: $33.50
© 2006 American Chemical Society Published on Web 03/24/2006
three-dimensional conformations with distinct biomolecular binding properties and have successfully been used for protein detection by sensor array and affinity capillary electrophoresis, and for targeted therapeutic applications, including a biodegradable nanoparticle-aptamer-based method for targeted drug delivery to specific prostate cancer cells and many other interesting applications. Tumor cell SELEXsan in vitro process identifying DNA sequences with strong affinities toward intact tumor cellsswas used to select an aptamer with high specificity toward our target leukemia cell line. Aptamers selected by cell SELEX have the ability to differentiate between numerous types of cells. These natural discriminatory properties are revealed during the selection process. Following the published protocols, we have selected an aptamer for acute leukemia cells with a sequence of TTTAAAATACCAGCTTATTCAATTAGTCACACTTAGAGTTCTAGCTGCTGCGCCGCCGGGAAAATACTGTACGGATAGATAGTAAGTGCAATCT-3′. We hypothesized that combining the selective characteristics of aptamers with magnetic nanoparticle-based separation could produce a universal, selective, and sensitive method for the collection and subsequent detection of various target molecules. Our aptamer was attached to fluorescent nanoparticles to provide enhanced signal and a means of detection. Beneficial aspects of stable luminescent probessspecifically high sensitivity and ease of detectionsfacilitate biological and nanoscale imaging analyses. Dye-doped silica nanoparticles have previously been used to replace fluorescent dyes because of their signal amplification and compatibility for the immobilization of biomolecules.16-18 Exploiting the availability of hydroxyl groups on the particle surface has proven useful for DNA and mRNA detection,17,19 as well as protein and antigen detection.19-24 Here we have utilized fluorescent nanoparticles to enhance the signal intensity corresponding to each aptamer binding event. For each fluorescent nanoparticle bound to a target cell via aptamer, a silica nanoparticle containing thousands of dye molecules is immobilized on the cell surface. Upon excitation, those dye molecules simultaneously release a fluorescent signal that is significantly brighter than an individual dye probe. As an alternative to centrifugation, magnetic nanoparticleaptamer-based cell sorting was employed here for selective malignant cell collection. Previously, magnetic activated cell sorting (MACS) was used extensively for selective extraction and (15) Daniels, D. A.; Chen, H.; Hicke, B. J.; Swiderek, K. M.; Gold, L. Proc. Natl. Acad. Sci. U.S.A. 2003, 26, 15416-15421. Fang, X.; Sen, A.; Vicens, M.; Tan, W. ChemBioChem 2003, 4, 829-834. (16) X. Zhao, L.; Hilliard, S.; Mechery, Y.; Wang, R.; Bagwe, S.; Jin, W.; Tan, W. Proc. Natl. Acad. Sci. U.S.A. 2004, 101, 15027-32. (17) Zhao, X.; Tapec-Dytioco, R.; Tan, W. J. Am. Chem. Soc. 2003, 125, 1147411475. (18) Zhao, X.; Bagwe, R.; Tan, W. Adv. Mater. 2004, 16, 173. (19) Lian, W.; Litherland, S.; Badrane, H.; Tan, W.; Wu, D.; Baker, H.; Gulig, P.; Lim, D.; Jin, S. Anal. Biochem: 2004, 334, 135-144. (20) Yang, W.; Zhang, C. G.; Qu, H. Y.; Yang, H. H.; Xu, J. G. Anal. Chim. Acta 2004, 503, 163-169. (21) Santra, S.; Wang, K.; Tapec-Dytioco, R.; Tan, W. J. Biomed. Opt. 2001, 6. (22) Santra, S.; Zhang, P.; Wang, K.; Tapec, R.; Tan, W. Anal. Chem. 2001, 73, 4988-4993. Wang, L.; Wang. K. M.; Santra, S.; Zhao, X. J.; Hilliard, L. R.; Smith, J. E.; Wu, J. R.; Tan, W. H. Anal. Chem. 2006, 78, 6469654. (23) Yang, H.; Qu, H.; Lin, P.; Li, S.; Ding, M.; Xu, J. Analyst 2003, 128, 462466. (24) Ye, Z.; Tan, M,; Wang, G.; Yuan, J. Anal. Chem. 2004, 76, 513-518.
enrichment of epithelial cells,25 endothelial cells,26 bacteria,27 and circulating tumor cells.5,28-30 While these methods normally use micrometer-sized magnetic polymer beads, we have chosen to utilize 65-nm silica-coated magnetic nanoparticles. Magnetic nanoparticles have previously been used for gene collection31 and peptide isolation for MS analysis.32 The small size and increased relative surface area of nanoparticles provide enhanced extraction capabilities compared with larger particles.31 We employed a MACS technique using aptamer-modified iron oxide-doped nanoparticles for selective leukemia cell extraction. In addition to enabling selective target extraction, magnetic nanoparticle-based sorting removes the need to centrifuge cell samples and the need for presample cleanup. As a result, the collection of unwanted nanoparticle aggregates and unbound materials from target cell extractions is eliminated, and a reduced background is observed. Fluorescence imaging and flow cytometry were used to confirm the selectivity and enhanced sensitivity of the assay. The simultaneous use of two aptamer-modified nanoparticles for targeted cell collection and detection allows for rapid, accurate analysis of target cells not possible by either particle alone. This method also demonstrates the capacity to reproducibly extract target cells from complex mixtures and whole blood samples, establishing a foundation for the relevance of this method for clinical applications. METHODS AND MATERIALS Materials. All materials were purchased from Sigma-Aldrich (St. Louis, MO) unless other noted. Whole blood samples were obtained from Research Blood Components, LLC (Brighton, MA). Fluo-4 was purchased from Molecular Probes (Eugene, OR), and carboxylethylsilanetriol sodium salt was purchased from Gelect, Inc. (Morrisville, PA). N-Hydroxysulfosuccinimide (Sulfo-NHS) and 1-ethyl-3-(3-dimethylaminopropyl) carbodiimide hydrochloride (EDC) were purchased from Pierce Biotechnology, Inc. (Rockford, IL). Hydrochloric acid and ammonium hydroxide were obtained from Fisher Scientific. Fluorescent Nanoparticle Synthesis. Dye-doped nanoparticles were synthesized by the reverse microemulsion method.21 First, 1.77 mL of Triton X-100, 7.5 mL of cyclohexane, and 1.6 mL of 1-hexanol were added to a 20-mL glass vial with constant magnetic stirring. Then, 400 µL of H2O and 80 µL of 0.1 M tris(2,2′ -bipyridyl)dichlororuthenium(II) hexahydrate (Rubpy) dye (MW ) 748.63) were added, followed by the addition of 100 µL of tetraethyl orthosilicate (TEOS). After 30 min of stirring, 60 µL of NH4OH was added to initiate silica polymerization. After 18 h, the carboxyl-modified silica postcoating was initiated by adding 50 µL of TEOS, 40 µL of carboxylethylsilanetriol sodium salt, and (25) Griwatz, C.; Brandt, B.; Assmann, G.; Za¨nker, K. S. J. Immun. Methods 1995, 183, 251-265. (26) Marelli-Berg, F. M.; Peek, E.; Lidington, E. A.; Stauss, H. J.; Lechler, R. I. J. Immun. Methods 2000, 244, 205-215. (27) Porter, J.; Robinson, J.; Pickup, R.; Edwards, C. J. Appl. Microbiol. 1998, 84, 722-732. (28) Stanciu, L. A.; Shute, J.; Holgate, S. T.; Djukanovic, R. J. Immun. Methods 1996, 189, 107-115. (29) Hu, X. C.; Wang, Y.; Shi, D. R.; Loo, T. Y.; Chow, L. W. C. Oncology 2003, 64, 160-165. (30) Benez, A.; Geiselhart, A.; Handgretinger, R.; Schiebel, U.; Fierlbeck, G. J. Clin. Lab. Anal. 1999, 13, 229-233. (31) Zhao, X.; Tapec-Dytioco, R.; Wang, K.; Tan, W. Anal. Chem. 2003, 75, 3476-3483. (32) Turney, K.; Drake, T. J.; Smith, J. E.; Tan, W.; Harrison, W. W. Rapid Comm. Mass Spectrom. 2004, 18, 1-8.
Analytical Chemistry, Vol. 78, No. 9, May 1, 2006
2919
10 µL of 3-(trihydroxyl)propyl methyl phosphonate. Polymerization proceeded for 18 h, and particles were centrifuged, sonicated, and vortexed four times with 95% ethanol, followed by one wash with H2O. Carboxyl-functionalized Rubpy nanoparticles were modified with DNA by adding 1.2 mg of EDC, 3.5 mg of Sulfo-NHS, and 0.5 nmol of DNA with 2 mg of particles dispersed in 1.5 mL of 10 mM MES buffer (pH 5.5). The solution was then mixed for 3 h. Particles were washed by centrifugation at 14 000 rpm three times with 0.1 M phosphate-buffered saline (PBS) (pH 7.2). Rubpy nanoparticles were stored at room temperature and were dispersed in cell media buffer at a final concentration of ∼10 mg/ mL. Magnetic Nanoparticle Synthesis. The iron oxide core magnetic nanoparticles32 were prepared by means of precipitating iron oxide by mixing ammonia hydroxide (2.5%) and iron chloride at 350 rpm using a mechanical stirrer (10 min). The iron chloride solution contains ferric chloride hexahydrate (0.5 M), ferrous chloride tetrahydrate (0.25 M), and HCl (0.33 M). After three washes with water and once with ethanol, an ethanol solution containing ∼1.2% ammonium hydroxide was added to the iron oxide nanoparticles, yielding a final concentration of ∼7.5 mg/ mL. To create the silica coating for the magnetite core particles, tetraethoxyorthosilicate (200 µL) was added, and the mixture was sonicated for 90 min to complete the hydrolysis process. For postcoating, an additional aliquot of TEOS (10 µL) was added and additional sonication was performed for 90 min. The resulting nanoparticles were washed three times with ethanol to remove excess reactants. For avidin coating, a 0.1 mg/mL Fe3O4-SiO2 (silica-coated magnetic nanoparticles) solution and a 5 mg/mL avidin solution were mixed and then sonicated for 5-10 min. The mixture was incubated at 4° C for 12-14 h. The particles were then washed three times with 10 mM PBS, pH 7.4, and dispersed at 1.2 mg/ mL in 100 mM PBS, and the avidin coating was stabilized by crosslinking the coated nanoparticles with 1% glutaraldehyde (1 h at 25° C). After another separation, the particles were washed three times with 1 M Tris-HCl buffer. Then, the particles were dispersed and incubated in the 1 M Tris-HCl buffer (3 h at 4 °C), followed by three washes in 20 mM Tris-HCl/5 mM MgCl2, pH 8.0. DNA was attached to the particles by dispersing the particles at 0.2 mg/mL in 20 mM Tris-HCl, 5 mM MgCl2, pH 8.0. Biotinlabeled DNA was added to the solution at a concentration of 31 µM. The reaction was incubated at 4 °C for 12 h, and three final washes of the particles were performed using 20 mM Tris-HCl, 5 mM MgCl2, at pH 8.0. Magnetic nanoparticles were used at a final concentration of ∼0.2 mg/mL and stored at 4 °C before use. Magnetic Extraction. For each magnetic extraction, the specified amount of magnetic nanoparticles was added to the sample. The aptamer-conjugated magnetic nanoparticles were then incubated with the target cells for 5 min unless specified otherwise. After the incubation period a magnetic field was applied to the side of the sample container. After 1 min, the nonmagnetic materials were removed with a Pasteur pipet, fresh buffer was added, and the magnetic field was removed. The materials were mixed in the buffer, and previous steps were repeated for a total of three times to remove anything nonspecifically bound to the magnetic nanoparticles. 2920
Analytical Chemistry, Vol. 78, No. 9, May 1, 2006
Cells. CCRF-CEM cells (CCL-119 T-cell, human acute lymphoblastic leukemia) and Ramos cells (CRL-1596, B-cell, human Burkitt’s lymphoma) were obtained from the American Type Culture Association and cultured in RPMI 1640 medium supplemented with 10% fetal bovine serum and 100 IU/mL penicillinstreptomycin. Before nanoparticle incubation, cells were dispersed in 500 µL of cell media buffer and centrifuged at 920 rpm for 5 min three times and were then redispersed in 200 µL of media buffer. Fluorescent and magnetic nanoparticle solutions were then simultaneously added to the cell solutions at a 20:1 ratio, respectively. After nanoparticle incubation, cells were washed by magnetic extraction with 500 µL of media buffer three times and redispersed in 20 µL of buffer for imaging and 200 µL of buffer for flow cytometric and collection efficiency analyses. All pure sample experiments started with 1.0 × 105-5.0 × 105 cells before nanoparticle incubation. Sample Assays. To determine the extraction and detection capabilities in an artificial complex sample, equal amounts of CEM and Ramos cells were mixed and tested using the assay. Approximately 105 cells of each type were mixed, followed by magnetic and fluorescent nanoparticle incubation for 5 min. Magnetic extraction procedures were performed three times to remove unbound cells. A 2-µL aliquot of the redispersed extracted sample was then imaged by confocal microscopy. To show applicability in real biological samples, whole blood was spiked with 105 CEM cells. Fluorescent and magnetic nanoparticles were then incubated for 5 min with spiked and unspiked blood samples, followed by three magnetic extractions. Confocal imaging was then used to characterize cell extractions. Collection efficiency was measured from pure cell samples and spiked blood samples. For efficiency studies, cell samples subjected to nanoparticle incubation and magnetic extractions were compared to samples not subjected to any separations by magnetic extraction. For pure cell analyses, 5-30 µg of magnetic nanoparticles were individually incubated in 5-µg increments with ∼105 cells initially and subjected to magnetic extractions after 5-min incubation. The efficiency of cell extraction from the spiked blood sample was determined by incubating magnetic nanoparticles (30 µg) with 500 µL of whole blood spiked with 105 CEM cells. Cells were counted by flow cytometry for pure samples and by imaging for blood samples. Various magnetic nanoparticle concentrations were used to determine maximum collection efficiency and optimal separation efficiency. Cell Imaging. Fluorescence imaging was conducted with a confocal microscope setup consisting of an Olympus IX-81 inverted microscope with an Olympus Fluoview 500 confocal scanning system and three lasers, a tunable argon ion laser (458, 488, 514 nm), a green HeNe laser (543 nm), and a red HeNe laser (633 nm) with three separate photomultiplier tubes for detection. The cellular images were taken with a 20 × 0.70 NA objective. The fluorescent nanoparticles were excited with the 488-nm line of the argon ion laser, and emission was detected using a 610-nm longpass filter. Fluo-4 was excited with the 488-nm laser line and was detected with a 505-525-nm band-pass filter. Flow Cytometry. Fluorescence measurements were also made using a FACScan cytometer (Becton Dickinson Immunocytometry Systems, San Jose, CA). To support imaging data, Rubpy fluorescence of pure samples initially containing 105 cells were measured
Figure 1. Flow cytometric determination of magnetic nanoparticle collection and separation efficiencies between target and control cells.
by counting 30 000 events. Cell experiments were performed exactly as stated for imaging experiments, except all solutions were diluted to a final volume of 200 µL. Cell sorting allowed for accurate quantitative analysis of cell samples, as well as a platform for collection efficiency determination. RESULTS AND DISCUSSION Collection Efficiency. Values for the collection efficiency were obtained by incubating increasing amounts of magnetic nanoparticles with the target CEM cells and Ramos control cells. The number of cells collected was determined by flow cytometry by the counting of signal events. In addition, the cell counting was performed on a control sample of both cell types that did not undergo the magnetic extraction and was taken as the total amount of the cells. The collection efficiency was calculated by dividing the number of events for each sample by the total cell number. As seen in Figure 1, the collection efficiency of target cells from ranges from 30 to 80%; however, the collection efficiency seems to plateau at ∼80%. In addition, the Ramos control cells had collection efficiencies ranging from 0.5 to 5% for the same
magnetic nanoparticle concentrations. This indicates that the target cells can be preferentially extracted from a sample, while few of the Ramos cells are extracted using the same method. Since the use of 10 µL of magnetic nanoparticles had a high separation efficiency, this amount was used for sample assay experiments to allow for binding of both nanoparticle types to the same cell. Dye and Nanoparticle Fluorescent Intensity Comparison. To demonstrate the fluorescence enhancement capabilities of Rubpy-doped nanoparticles, individual Rubpy probes were linked with our DNA aptamer and directly compared to Rubpy nanoparticle-aptamer conjugates after immobilization on our target cells. Equal concentrations of magnetic and Rubpy nanoparticles (0.5 nM) were incubated with CEM cells, then washed by magnetic extraction with 500 µL of media buffer three times, and redispersed in 20 µL of buffer for imaging and 200 µL of buffer for flow cytometric analysis. Panels A and B in Figure 2 compare cell extractions labeled with fluorescent nanoparticles to extractions labeled with Rubpy dye. There is a significant difference in the amount of fluorescent signal seen in the two images. Flow cytometry was used to verify that the Rubpy nanoparticles provide enhanced fluorescence signal, and Figure 2C confirms over a 100fold enhancement of Rubpy nanoparticle-labeled cells to Rubpy dye-labeled cells. This figure also shows the nanoparticle-labeled cells in an apparent bimodal distribution. While the exact cause of this pattern is unknown, possible explanations include the formation of nanoparticle aggregates, formation of cell/nanoparticle aggregates, different levels of receptors on cells, or simply an artifact of the experimental method used. Nonetheless, the experiment illustrates the signal advantage that the fluorescent nanoparticles possess over single fluorophores. Sample Assays. To demonstrate the concept of our two particle-based magnetic collection and detection technique, individual CEM and Ramos cell solutions were subjected to our two-
Figure 2. Fluorescence images of extracted samples after 5min incubation with (A) 40 µM Rubpy dye-aptamer conjugates and (B) 0.5 nM Rubpy nanoparticle-aptamer conjugates, followed by three magnetic washes. (C) Comparison of dye-labeled cells to nanoparticle-labeled cells by flow cytometric analysis.
Analytical Chemistry, Vol. 78, No. 9, May 1, 2006
2921
Figure 3. Images of extracted samples from (A) target cells and (b) control cells and (C) flow cytometric comparison of target and control signal after 5-min incubation with magnetic and fluorescent nanoparticles, followed by three washes by magnetic separation.
Figure 4. Images of (A) 1:1 ratio of target cells mixed with Fluo-4-stained control cells. (B) Fluo-4 signal and (C) Rubpy signal after 5 min, two-particle incubation and three magnetic washes of the mixture in Figure 3A. (D) 1:1 ratio of Fluo-4-stained target cells mixed with control cells. (E) Fluo-4 signal and (F) Rubpy signal after 5 min, two-particle incubation and three magnetic washes of the mixture in Figure 3D.
particle procedures, followed by fluorescent imaging and flow cytometric analysis. Before nanoparticle incubation, cells were dispersed in 500 µL of cell media buffer, centrifuged three times at 920 rpm for 5 min, and then redispersed in 200 µL of media buffer. Fluorescent and magnetic nanoparticle solutions were then simultaneously added to the cell solutions at a 20:1 ratio, respectively. After 5-min nanoparticle incubation, cells were washed by magnetic extraction with 500 µL of media buffer three times and redispersed in 20 µL of buffer for imaging and 200 of µL buffer for flow cytometric analyses. All pure sample experiments started with 1.0 × 105-5.0 × 105 cells before nanoparticle incubation. Each pure cell extraction was repeated 10 times. 2922
Analytical Chemistry, Vol. 78, No. 9, May 1, 2006
Figure 3 shows representative confocal images of 2-µL aliquots of target cells (A) and control cells (B) after 5-min incubation and three magnetic extractions. There is a noticeable change in both the amount of cells present and fluorescent signal between the extracted cell solutions. Magnetic collection pulled out few control cells, while a significant number of target cells were extracted using the same procedures. In addition, the few control cells inadvertently collected by magnetic extractions were labeled with few Rubpy nanoparticles and had no significant fluorescent signal. Conversely, the target CEM cells that were subjected to the assay had very intense fluorescent signals that made them easily distinguishable from
Figure 5. Confocal images of extractions from whole blood. (A) Extracted sample from target cell spiked whole blood. (B) Extraction from unspiked whole blood. (C) and (D) show magnified images of extracted cells from Figure 4A.
the control cells. The flow cytometric analysis of the pure sample assay, Figure 3C confirms that fewer control cells were collected than target cells, and the control cells showed less fluorescent emissions than the extracted target cells. Mixed Cell Sample Assays. To evaluate the potential of the assay, complex samples needed to be tested to determine extraction and detection capabilities in complex matrixes. In Figure 4 we show the results from our artificial complex sample where equal amounts of CEM and Ramos cells were mixed and our two-particle assay was applied. To differentiate CEM from Ramos cells, Fluo-4sa fluorescent calcium indicatorswas used to label Ramos cells prior to nanoparticle incubation. Fluo-4-labeled control cells were mixed (1:1) with unlabeled CEM cells shown in Figure 4A. Magnetic and fluorescent nanoparticles were simultaneously added and incubated at 4 °C for 5 min with occasional gentle stirring. After incubation, a magnetic field was applied to remove cells that were not attached to the aptamerlabeled iron oxide particles. A 2-µL aliquot of the extracted sample was then illuminated to monitor Fluo-4 and Rubpy fluorescence as shown in Figure 4B and C, respectively. Based on the images, the assay was able to collect the CEM cells in the sample and bright fluorescence from the Rubpy nanoparticles made them easily distinguishable. The experiment was also performed by labeling CEM cells with Fluo-4 and mixing them with unlabeled control cells as in Figure 4D. The cells shown in Figure 4E were separated by the two-particle assay, and all exhibit a Fluo-4 signal. In Figure 4F, the same cells are shown with the Rubpy emission overlaid. The presence of the Fluo-4 fluorescence proves that only the CEM cells were collected and imaged. The lack of Fluo-4
signal in Figure 4B, along with the presence of the Fluo-4 signal in Figure 4E, proves that only target cells are being collected using this method for extractions from 1:1 cell mixtures. These sample assays were repeated five times with similar results achieved for each experiment. Whole Blood Sample Assays. Blood samples were also used to determine detection capabilities from complex biological solutions. Control experiments indicated that the aptamer sequence used was stable in serum samples for up to 2 h. Target cells were spiked into whole blood samples (500 µL) and compared to unspiked samples after magnetic extraction to make certain that target cells could be detected in complex biological samples. As shown in Figure 5, nonspecific interactions caused the unwanted collection of some red blood cells, but the lack of Rubpy fluorescent signal on the unwanted cells allows for target cells to still be accurately distinguished. For magnetic extractions from whole blood samples, 40% of the spiked target cells were routinely recovered after three magnetic washes and after accounting for dilution. This is consistent with current extraction efficiency values reported by immunomagnetic separation.28,30 These experiments were repeated for total of five times with similar results being obtained in each sample. This experiment was meant to mimic a real clinical sample, which normally would contain thousands of different species. By successfully extracting our target cell line from whole blood, we have shown that this method is applicable for biomolecular and cellular detection in real clinical applications. Our assay selectively removes our target cells from this complex mixture with collection efficiencies rivaling or surpassing current methods for cellular Analytical Chemistry, Vol. 78, No. 9, May 1, 2006
2923
detection from clinical samples. Discussion. The utilization of aptamer-conjugated magnetic and fluorescent nanoparticles in this assay was possible only because there are sufficient aptamer binding sites for both types of particles on our target leukemia cells. For the analysis of cells having few aptamer recognition sites, different aptamers or other recognition elements can be labeled on each type of particle to eliminate competitive binding. Compared with current diagnostic techniques, the two-particle assay described has three distinct advantages for molecular recognition. First, highly specific aptamers were used for molecular recognition. Prolonged stability and facile synthesis make aptamers an ideal replacement for antibodies in cellular recognition studies. We have shown that incorporating aptamers onto nanoparticles does not adversely affect their binding properties with intact cells, and therefore, they can be utilized for selective extraction and sensitive molecular detection. The aptamer used was selected specifically for intact target cells, and cellular detection is possible without significant sample preparation. The second major advantage of the two-particle assay is magnetic nanoparticle-aptamer-based cell sorting, which allows for selective cell collection from complex samples. Iron oxidedoped silica nanoparticle-aptamer conjugates were used here for t-cell collection and washing. Our aptamer-based MACS application is effective for the selective extraction of target molecules and allows for enhanced extraction efficiency from clinical samples. Another advantage of magnetic extraction is the removal of nanoparticle aggregates and other unbound fluorescent materials that normally would cause increased background fluorescence. The two-particle assay is also very fast, with rapid incubation and magnetic extractions allowing for rapid detection. While immunophenotypic and PCR-based analyses take hours to complete, our two-particle assay requires as little as 5-min incubation for sufficient nanoparticle binding, and the entire method can easily be performed in less than 1 h. Fluorescent dye-doped nanoparticles were used to provide enhanced signaling capabilities. Rubpy-doped nanoparticleaptamer conjugates were used to amplify the signal intensity corresponding to each aptamer binding event, resulting in much
2924
Analytical Chemistry, Vol. 78, No. 9, May 1, 2006
improved sensitivity compared to individual Rubpy dye-labeled probes. Nanoparticles were coated with silica, and dye concentrations inside the nanoparticles were optimized to reduce photobleaching effects, further enhancing the method’s sensitivity. Rubpy nanoparticles are shown here to increase the fluorescent signal corresponding to aptamer binding to our target leukemia cells and have been used here as effective, sensitive replacements for individual Rubpy-labeled aptamer probes. The fluorescent nanoparticles also add an additional level of selectivity to the method since only cells that are magnetically extracted and possess a high fluorescent intensity are recognized as target cells. As in the whole blood experiments, some cells were nonspecifically extracted but were easily distinguished from the target cells based on the fluorescence intensity. Though Rubpy nanoparticles have shown an enhancement here over individual dye-labeled probes, the true benefit of this assay will be revealed when the enhancement effects of nanoparticles are used to detect binding with low expression cell surface markers. This is crucial since there are many markers that are few in number on the cell surface that cannot be detected using current dye-labeling methods. Further optimization of this method may prove necessary for applications in clinical diagnostics; nevertheless, this proof of concept has demonstrated the potential applicability of this method for rapid cellular and molecular detection. The enhanced selectivity of our assay has shown promise for extraction and detection of target cells from whole blood, and additional investigation may prove this method valuable for the detection of numerous molecular analytes from blood or other complex biological mixtures. ACKNOWLEDGMENT The authors acknowledge Ms. Hui Lin for her expertise in DNA synthesis. This work was partially supported by a NSF NIRT grant and NIH grants.
Received for review November 13, 2005. Accepted January 19, 2006. AC052015R
