Arginyl-fructosyl-glucose, a Major Maillard Reaction Product of Red

May 2, 2019 - Recently, although ginseng (Panax ginseng C. A. Meyer) and its main component saponins (ginsenosides) have been reported to exert ...
0 downloads 0 Views 6MB Size
Download PDF
Article Cite This: J. Agric. Food Chem. 2019, 67, 5754−5763

pubs.acs.org/JAFC

Arginyl-fructosyl-glucose, a Major Maillard Reaction Product of Red Ginseng, Attenuates Cisplatin-Induced Acute Kidney Injury by Regulating Nuclear Factor κB and Phosphatidylinositol 3‑Kinase/ Protein Kinase B Signaling Pathways Rong-yan Li,† Wei-zhe Zhang,† Xiao-tong Yan,† Jin-gang Hou,†,‡ Zi Wang,†,§ Chuan-bo Ding,† Wen-cong Liu,†,§ Yi-nan Zheng,† Chen Chen,∥ Yue-ru Li,† and Wei Li*,†,§ Downloaded via UNIV OF SOUTHERN INDIANA on July 20, 2019 at 13:52:19 (UTC). See https://pubs.acs.org/sharingguidelines for options on how to legitimately share published articles.

†

College of Chinese Medicinal Materials, Jilin Agricultural University, Changchun, Jilin 130118, People’s Republic of China Intelligent Synthetic Biology Center, Daejeon 34141, Republic of Korea § National & Local Joint Engineering Research Center for Ginseng Breeding and Development, Changchun, Jilin 130118, People’s Republic of China ∥ School of Biomedical Sciences, University of Queensland, Brisbane, Queensland 4072, Australia ‡

ABSTRACT: Recently, although ginseng (Panax ginseng C. A. Meyer) and its main component saponins (ginsenosides) have been reported to exert protective effects on cisplatin (CDDP)-induced acute kidney injury (AKI), the beneficial activities of non-saponin on CDDP-induced AKI is little known. This research was designed to explore the protective effect and underlying mechanism of arginyl-fructosyl-glucose (AFG), a major and representative non-saponin component generated during the process of red ginseng, on CDDP-caused AKI. AFG at doses of 40 and 80 mg/kg remarkably reversed CDDP-induced renal dysfunction, accompanied by the decreased levels of serum creatinine and blood urea nitrogen. Interestingly, all of oxidative stress indices were ameliorated after pretreatment with AFG continuously for 10 days. Importantly, AFG relieved CDDPinduced inflammation and apoptosis in part by mitigating the cascade initiation steps of nuclear factor κB signals and regulating the participation of the phosphatidylinositol 3-kinase/protein kinase B signal pathway. In conclusion, these results clearly provide strong rationale for the development of AFG to prevent CDDP-induced AKI. KEYWORDS: arginyl-fructosyl-glucose, cisplatin, acute kidney injury, PI3K/Akt, NF-κB synthase (iNOS), and cyclooxygenase 2 (COX-2).7 Although the precise mechanism of CDDP-induced AKI remains unclear, apoptosis has been considered as a main cause of nephrotoxicity.8 The phosphatidylinositol 3-kinase (PI3K)/protein kinase B (Akt) pathway is critically important in regulating the cell functions, including growth, proliferation, and survival.9 Actually, there have been reports showing modifications of the PI3K/Akt signaling pathway in CDDP-inducted AKI.10 Once the PI3K/Akt signaling pathway is aberrantly activated, it will cause oxidative stress, apoptosis, and inflammatory response, consisting of CDDP pathophysiology. Accordingly, available data revealed that regulating oxidative stress, inflammation, and apoptosis played a key role against CDDP-induced AKI.11 Accumulated research results have proven that natural compounds of medical herbs are able to treat CDDP-induced AKI. Red ginseng (Panax ginseng C. A. Meyer), produced from fresh ginseng through the processes of steaming and drying via the Maillard reaction (MR), possesses multiple biological effects, which include inhibit tumor growth, a decrease blood glucose levels, antioxidant activity, and others.12,13 Furthermore, red ginseng is enriched with amino acids and sugars. It is clear that

1. INTRODUCTION cis-Diamminedichloroplatinum [cisplatin (CDDP)], one of the classic chemotherapeutic agents, is widely applied to patients for killing various malignant tumors, including cervical cancer, ovarian cancer, lung cancer, neck cancer, and other severe cancers.1 However, increasing evidence proves severe side effects of CDDP, including nephrotoxicity electrolyte imbalance, myelotoxicity, and ototoxicity, as main challenges in CDDP-based cancer therapy.2 In clinical CDDP-treated patients, acute kidney injury (AKI) has become the most common and serious complication. Pathophysiologically, the accumulation of CDDP in straight proximal and distal curved tubules in kidneys leads to a rapid decline in renal function.3 Indeed, several studies have revealed that CDDP-induced AKI is a very complex multifactorial pathophysiological process.4 Increased oxidative stress caused by imbalance between oxidation and antioxidation in vivo plays important roles in CDDP-induced kidney injury, through an increase in reactive oxygen species (ROS) production and resultant renal dysfunction, inflammation response, and apoptosis.5 It is well-known that oxidative stress stimulates transcription factors, such as nuclear factor κB (NF-κB).6 As a consequence, the activation of NF-κB results in the increased expression of a series of proinflammatory cytokines, such as interleukin 1β (IL-1β), tumor necrosis factor α (TNF-α), inducible nitric oxide © 2019 American Chemical Society

Received: Revised: Accepted: Published: 5754

January 23, 2019 April 12, 2019 May 2, 2019 May 2, 2019 DOI: 10.1021/acs.jafc.9b00540 J. Agric. Food Chem. 2019, 67, 5754−5763

Article

Journal of Agricultural and Food Chemistry

for quantitative polymerase chain reaction (qPCR) kit SYBR Premix Ex Taq II were acquired from TaKaRa Bioengineering Institute (Dalian, China). The antibody of rabbit monoclonal anti-mouse 4-hydroxynonenal (4-HNE), cytochrome P450 E1 (CYP2E1), iNOS, COX-2, and horseradish peroxidase (HRP)-conjugated anti-mouse immunoglobulin G (IgG) were all obtained from Abcam (Cambridge, U.K.). PI3K (p85), Akt, p-PI3K (p-p85), p-Akt, b-associated X (Bax), B-cell lymphoma 2 (Bcl-2), caspase-3, cleaved-caspase-3, IκB kinase α/β (IKKα/β), inhibitor of κBα (IκBα), NF-κB (p65), p-IKKα, p-IKKβ, phospho-IκBα (p-IκBα), phospho-NF-κB (p-NF-κB, p-p65), COX-2, iNOS, β-actin, and secondary antibodies for western blot were all received from Cell Signaling Technology (Danvers, MA, U.S.A.). A reference standard of AFG was isolated and purified from red ginseng (P. ginseng C. A. Meyer), with a purity of 98.5%, as previously reported using high-performance anion-exchange chromatography through integrated pulsed ampere metric detection (HPAEC− PAD).22 All other chemicals were bought from Beijing Chemical Works (Beijing, China). 2.2. Preparation of AFG. AFG was prepared by the modified method developed by Zheng et al.23 The method is reacted with arginine and maltose under anhydrous acidic conditions at 80 °C for 120 min. We used the process of purifying the Maillard reaction product (MRP)−AFG in combining the cation-exchange resin with the polyacrylamide gel column chromatographic method. First, the crude product of AFG was appended to the cation-exchange resin column with 1/5 times of resin volume and eluted by the distilled water to a neutral stance. Neutralized with distilled water, it was then washed with 4% ammonia−water using thin-layer chromatography (TLC) for tracking AFG. The component was collected with value of the retention factor (Rf) of 0.156, and ammonium hydroxide removed. A portion of ammonia−water was removed by a rotary evaporator, and then the lyophilized powder was diluted with sterile water to a 0.5 g mL−1 super polyacrylamide gel column (Biogel P-II). The AFG single point was collected and freeze-dried. 2.3. Determination of AFG by Ultra-Performance Liquid Chromatography−Tandem Mass Spectrometry (UPLC−MS/ MS). The present method was performed as indicated in the literature, with minor modifications. UPLC consisted of a Shimadzu LC-30AD system (Tokyo, Japan) and a Sciex 4500 system (Applied Biosystems, Inc., Foster City, CA, U.S.A.). AFG was separated on the Waters Acquity UPLC BEH Amide AAA column (100 × 2.1 mm, 1.7 μm) at 40 °C. The mobile phase was coupled with a gradient elution system of solvent A (0.01 mol/L ammoniumformate and methanol buffer solution at pH 6.5) and solvent B (4:1, v/v, acetonitrile/ H2O). The flow rate was set at 0.3 mL/min (0.0 min, 0% B; 2 min, 2% B; and 10 min, 5% B). The MS/MS detection used a positive electrospray ion fragmentation pattern. Multiple reaction monitoring (MRM) mode was performed to the precursor to production transitions, with a dwell time of 150 ms. The optimum conditions were set as follows: curtain gas (N2), 35 psi; ion spray voltage, 5500 V; heated nebulizer temperature, 550 °C; and nebulizing gas (N2) and heater gas (N2), 55 psi. It was finally determined to be AFG. Data were acquired with PeakView software (Applied Biosystems, Inc., Foster City, CA, U.S.A.). 2.4. Animals and Drug Treatment. ICR mice, male, 8 weeks old, weighting 20−22 g, were used for the study, obtained from YISI Experimental Animals Co., Ltd., with Certificate SCXK (JI) 20160003 (Changchun, China). All animals were acclimatized for 1 week at a standard rodent diet, humidity (60 ± 10%), and temperature (25.0 ± 2.0 °C), with a 12/12 h light/dark cycle. The experimental protocol was executed strictly, approved by the Guide for the Care and Use of Laboratory Animals, which was approved by the Ethical Committee for Laboratory Animals of Jilin Agricultural University. For this experiment, all animals were divided into four groups in a random manner: control group, CDDP group (20 mg/kg), and two AFG groups (40 and 80 mg/kg). After adaptive feeding, AFG was dissolved with 0.9% physiological saline and administered intragastrically to mice for 10 consecutive days. The other two groups were

red ginseng has a wide variety of pharmacological effects mainly caused by ginsenosides.14,15 However, less attention has been paid on non-saponins of red ginseng extracts. Arginylfructosyl-glucose (AFG; Figure 1A) is one of the representative

Figure 1. (A) Chemical structure of AFG, (B) UPLC−MS/MS analysis on AFG, and (C) product ion (MS/MS) spectra of AFG.

non-saponins in red ginseng, which accounts for 3−4% of red ginseng (on a dry weight basis).16 It was reported that AFG exerted good antioxidant properties17 and inhibition of synthesis of proinflammatory cytokines both in vitro and in vivo.18,19 Moreover, administration of AFG caused an antihyperglycemic effect.20 Although red ginseng and saponins as active constituents have strong protective effects on kidney injury,21 it is important to explore whether AFG as a major non-saponin contributes to the protective effects of red ginseng. On the basis of accumulated evidence that AFG exerted better antioxidant and anti-inflammatory effects in kidneys, the present research was performed to demonstrate that AFG was capable of preventing CDDP-inducted AKI. Regulation of PI3K/AKT and NF-κB signaling pathways may be the potential molecular mechanism of AFG action.

2. MATERIALS AND METHODS 2.1. Chemical Compounds and Reagents. CDDP was acquired from Sigma-Aldrich (St. Louis, MO, U.S.A.). Hematoxylin and eosin (H&E) and plasma and tissue biochemical assay kits for measuring creatinine (CRE), blood urea nitrogen (BUN), glutathione (GSH), superoxide dismutase (SOD), malondialdehyde (MDA), and catalase (CAT) were purchased from Nanjing Jiancheng Bioengineering Institute (Nanjing, China). Terminal deoxynucleotidyl transferase dUTP nick end labeling (TUNEL) apoptosis detection kits were provided by Beyotime Biotechnology (Shanghai, China). SABCDyLight488-labeled was provided by BOSTER Biological Technology (Wuhan, China). UNIQ-10 Column-Based Trizol Total RNA Extraction Kit and Tap PCR Master Mix (2×, blue dye) were bought from Sangon Biotech (Shanghai, China). Special reagents 5755

DOI: 10.1021/acs.jafc.9b00540 J. Agric. Food Chem. 2019, 67, 5754−5763

Article

Journal of Agricultural and Food Chemistry Table 1. Primer Sequences for Real-Time PCR Analyses gene

primer forward (5′ → 3′)

primer reverse (5′ → 3′)

TNF-α IL-1β IL-6 β-actin

TGGCAAATGTGAGAAACGAG TCCAGGATGAGGACATGAGCAC CCACTTCACAAGTCGGAGGCTTA TCACTGCCACCCAGAAGAC

AAACCAGAACAGACCCAACG GAACGTCACACACCAGCAGGTTA CCAGTTTGGTAGCATCCATCATTTC GAAGTCGCAGGAGACAACC

Figure 2. Protective effects of AFG treatment against CDDP-induced kidney injury in mice. Blood and kidneys were collected at 72 h after CDDP injection in ICR mice. (A) Kidney morphology and representative images of H&E staining were quantified, 400×. Arrows and asterisks show necrotic cells and inflammatory infiltrate cells, respectively. Renal injuries were accessed by (B) necrosis scores, (C) kidney index, (D) serum CRE, and (E) serum BUN. All data are expressed as the mean ± SD (n = 10). (∗) p < 0.05 and (∗∗) p < 0.01 versus the normal group. (#) p < 0.05 and (##) p < 0.01 versus the CDDP group. 2.6. Oxidative Stress Markers in Kidneys. The kidney homogenate was used to estimate the antioxidant activities. Lipid peroxides were measured by MDA kits, and SOD enzymatic activity, CAT activity, and GSH content were determined by related assay kits.3 All of these were determined from the protocols of the manufacturer (Jiancheng, Nanjing, China). Bradford protein assay kits were used to measure protein concentrations (Beyotime Biotechnology, Shanghai, China), using bovine serum albumin (BSA) as the standard. 2.7. Histopathological Examinations. The kidney tissues were kept in 10% formaldehyde before embedded in paraffin and cut into 5 μm thick sections. Later, slices were rehydrated in decreasing concentrations of ethanol and stained with H&E for detecting the changes in histopathological analysis following the established

given 0.9% saline. On the seventh day, mice were injected with CDDP (20 mg/kg, diluted with 0.9% warm saline) by intraperitoneal injection for 1 time to all of the groups, except for the normal group, 1 h after the final AFG treatment. The experiment was terminated 72 h after injection of CDDP. The blood samples were collected from the eyeball. Then, mice were sacrificed by cervical dislocation under anesthesia and dissected rapidly. The serum samples were separated by centrifugation (3500 rpm for 10 min) and collected for subsequent measurement. Kidneys were collected for the following research. 2.5. Estimation of CRE and BUN in Serum. Immediately after sacrifice, serum BUN and CRE were evaluated from the protocol of the biochemical assay kits of the manufacturer (Jiancheng, Nanjing, China). 5756

DOI: 10.1021/acs.jafc.9b00540 J. Agric. Food Chem. 2019, 67, 5754−5763

Article

Journal of Agricultural and Food Chemistry protocol.24 Tubular damage was evaluated by scoring tubular necrosis in four different fields in the corticomedullary junction (microscopy, Leica DM750, Germany). The results were expressed as necrosis score as previously reported.25 2.8. TUNEL Staining. Apoptosis was determined by the TUNEL assay, which was carried out as previously described, with slight revision. The In Situ Cell Death Detection Kits (Beyotime Biotechnology) were used to measure apoptotic cells. The apoptosis cells were calculated by microscope (microscopy, Leica DM750, Germany). 2.9. Immunohistochemistry and Immunofluorescence Staining. According to the previously described method, with minor modification,26 the paraffin slices were deparaffinized and rehydrated with xylene and different concentrations of ethanol and then the sections were permeabilized for antigen retrieval. Subsequently, the slides were incubated for 1.5 h under 1% BSA and further incubated with primary antibodies to iNOS (1:200) or COX-2 (1:200) at 4 °C for 12 h. Sections were then through the incubation with HRP-conjugated secondary antibody (Abcam, Cambridge, U.K.). Then, sections were rinsed with distilled water, and then slides were analyzed with dispute adjudication board (DAB) and counterstained with hematoxylin. The brownish yellow color in the cytoplasm of the renal cells was recognized as positive staining and observed (Leica DM750, Germany), and the expression intensity was measured through Image-Pro Plus 6.0 software. The sections were incubated with 4-HNE (1:200) or CYP2E1 (1:200) at 4 °C for 10 h in immunofluorescence staining and, subsequently, hatched by DyLight-488 after 12 h at 37 °C (Abcam, Cambridge, U.K.). 4′,6-Diamidino-2-phenylindole (DAPI) was used to stain the nuclei of fixed tissue cells. A microscope (Leica DMILED, Germany) was used to measure immunofluorescence staining. 2.10. qPCR. The expression of the genes of interest was determined from kidney by qPCR. RNA was isolated with the UNIQ-10 Column-Based Trizol Total RNA Extraction Kit (Sangon, Shanghai, China). Then, total RNA was purified and reversed to cDNA using the Prime Script RT reagent kit (TaKaRa, Dalian, China). qPCR was performed bestowing a StepOne Real-Time PCR System (Applied Biosystems, Foster City, CA, U.S.A.), and amplificatory reactions were achieved according to the protocol of the manufacturer using the SYBRPremix Ex Taq II kit (TaKaRa, Dalian, China). The program for amplification was used at 95 °C for 5 min, followed by 40 cycles of three-step PCR. The specific primer sequences were acquired from TaKaRa Biotechnology (Dalian, China), which are shown in Table 1. The relative expression of β-actin was used as an internal control. All mRNA was calculated by the 2−ΔΔCt method and given as a ratio compared to the normal group. 2.11. Western Blot Analysis. Western blot was processed with a standard procedure. Proteins from kidneys were extracted in radioimmunoprecipitation assay (RIPA) buffer, and then the protein concentration was determined according to the methods introduced above. Subsequently, after the protein concentration was determined, the protein samples were separated by sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS−PAGE) and transferred to polyvinylidene difluoride (PVDF) membranes. After blocking with BSA for 1.5 h, membranes were incubated at 4 °C for 12 h with different primary antibodies. The membranes were then incubated with HRPconjugated secondary antibodies. The protein bands were detected by the emitter coupled logic (ECL) plus western blot detection system with β-actin as the internal reference. Signal intensities were measured with Quantity One software (Bio-Rad Laboratories, Hercules, CA, U.S.A.). 2.12. Statistical Analysis. All data were analyzed using GraphPad Prism 7.0 software (San Diego, CA, U.S.A.), which was established on different experiments as the mean ± standard deviation (SD). Oneway analysis of variance (ANOVA) followed by the Bonferroni post hoc test was used for statistical significance. p values less than 0.05 or 0.01 were considered statistically significant.

Figure 4. Effects of AFG on expressions of (A) 4-HNE and (B) CYP2E1. (C and D) Column chart showed relative fluorescence intensity. Representative immunofluorescence images (green) were taken at 200×. DAPI (blue) acted as a nuclear counterstain. All data were expressed as the mean ± SD. (∗∗) p < 0.01 versus the normal group. (#) p < 0.05 and (##) p < 0.01 versus the CDDP group.

3. RESULTS 3.1. UPLC−MS/MS Assay. According to the previous research, we obtained the crude AFG product under the

anhydrous environment of arginine and maltose. The synthesis rate reached 80%; therefore, it was further purified for this study. Mass spectrometry was carried out in MRM mode for detection of AFG in red ginseng and chemically synthesized.

Figure 3. Pretreatment with AFG protected against renal oxidative stress induced by CDDP, with kidney levels of (A) GSH, (B) SOD, (C) MDA, and (D) CAT. All data were expressed as the mean ± SD (n = 10). (∗) p < 0.05 and (∗∗) p < 0.01 versus the normal group. (#) p < 0.05 and (##) p < 0.01 versus the CDDP group.

5757

DOI: 10.1021/acs.jafc.9b00540 J. Agric. Food Chem. 2019, 67, 5754−5763

Article

Journal of Agricultural and Food Chemistry

Figure 5. Effects of AFG on renal tissues stained with TUNEL staining (400×). (A and B) Presence of TUNEL positive cells was evaluated by the image analyzer. All data were expressed as the mean ± SD. (∗∗) p < 0.01 versus the normal group. (#) p < 0.05 and (##) p < 0.01 versus the CDDP group. (C) Expressions of protein Bax, Bcl-2, and caspase-3 were measured, and the β-actin protein level was used as a loading control. (D−F) Quantification of relative protein expression was performed by densitometric analysis (n = 3). (∗∗) p < 0.01 versus the normal group. (#) p < 0.05 and (##) p < 0.01 versus the CDDP group.

p < 0.01; panels D and E of Figure 2), indicating that AFG supplementation significantly attenuated the CDDP-induced renal injury (p < 0.05 or p < 0.01). The results indicated that AFG may prevent CDDP-evoked AKI. 3.3. AFG Attenuated CDDP-Induced Oxidative Stress in Kidney. To assess the functions of AFG against CDDPinduced oxidative stress, the renal levels of MDA, SOD, GSH, and CAT were assayed with the supernatant of kidney homogenate. Relative to the control group, the GSH contents (p < 0.05) and SOD (p < 0.01) and CAT (p < 0.05) activities were clearly reduced by CDDP administration, while the content of MDA was elevated (p < 0.05). On the contrary, pretreatment of AFG remarkably reduced the overproduction of MDA (p < 0.05) and recovered the antioxidant condition, as manifested by increased levels of GSH, CAT, and SOD (p < 0.05 or p < 0.01) (panels A−D of Figure 3). Our study clarified that supplementation with AFG ameliorated oxidative stress through restoring antioxidant enzyme activity and nonenzymatic GSH content. The effects were even more significant at 80 mg/kg of AFG than at 40 mg/kg. In addition, the expressions of CYP2E1 and 4-HNE in renal tissues were detected by immunofluorescence staining. The fluorescence intensities of CYP2E1 and 4-HNE were increased after CDDP injection (p < 0.01). Indeed, AFG administration significantly reduced the fluorescence intensities of them (panels A−D of Figure 4). All results indicated that CDDP-induced oxidative stress injury was improved by AFG pretreatment. 3.4. AFG Regulated CDDP-Induced Inflammation in Kidneys. In the model of CDDP-induced renal injury, the NF-κB signaling pathway is important in inflammatory response.10 The protein expressions of NF-κB and its upstream regulators, including p-IKKα/β and p-IκBα, were markedly regulated by CDDP injection (p < 0.01). Interestingly, these elevated levels

The decluttering potential (DP, 80 V), collision energy (CE), and cell exit potential (CXP, 11 V) were optimized to improve the optimum sensitivity and selectivity. After optimization on the liquid chromatography−tandem mass spectrometry (LC−MS/MS) system and based on previous work,27 the expected molecular mass of [M + H]+ 499.2 was observed and two MRM ion transitions were determined by AFG (Figure 1B). The optimized two fragment ions and CE values for each transition were 499.2 → 70.0 (30 and 93 V) and 499.2 → 112.1 (30 and 35 V) (Figure 1C). As expected, the AFG in red ginseng is in the same fraction with the AFG reference, which was chemically synthesized. These values matched the theoretical molecular weights previously reported. Moreover, AFG was confirmed with a purity of 97.3%, sufficient for the following experiments. 3.2. AFG Attenuated CDDP-Induced Renal Dysfunction and Histopathological Damage. Kidney tissues from CDDP treatment mice was obviously whitened, swollen, and accompanied by hydropic degeneration, which was remarkably improved by the administration of AFG for 10 days (Figure 2A). H&E staining clearly showed that renal tissues in the control group had clear tubular and glomerular structures with a normal nucleus. Serious renal injury was manifested by tubular necrosis and glomerular congestion (p < 0.01) after a single CDDP exposure. In contrast, pretreatment with AFG for 10 consecutive days dose-dependently attenuated pathological changes (p < 0.05 or p < 0.01), leading to a lower histopathological score than that in CDDP-treated mice (p < 0.05 or p < 0.01; panels B and C of Figure 2). CDDP administration significantly elevates the level of CRE and BUN in serum, indicating a serious renal injury (p < 0.01). Nevertheless, after supplementation of AFG pretreatment, the obvious reduction of the levels of CRE and BUN happened in comparison to that in CDDP-treated mice (p < 0.05 or 5758

DOI: 10.1021/acs.jafc.9b00540 J. Agric. Food Chem. 2019, 67, 5754−5763

Article

Journal of Agricultural and Food Chemistry

cells. It is suggested that apoptosis is accordant with necrosis after cisplatin exposure.28 As depicted in panels A and B of Figure 5, in normal group mice, no positive stained renal cells were observed. Actually, administration with CDDP showed significantly more positive cells (p < 0.01). On the contrary, pretreatment of AFG remarkably reduced apoptosis (p < 0.05 or p < 0.01). To explore the molecular mechanism of AFG against CDDP-induced AKI, the PI3K/Akt signal pathway inclusive of its downstream Bcl-2 family, such as pro-apoptotic factor Bax and anti-apoptotic factor Bcl-2 were investigated. In addition, we also tested caspase-3, which is a common downstream part of multiple apoptotic pathways. The levels of PI3K, p-PI3K, Akt, and p-Akt were tested. Our findings demonstrated the reduction of p-PI3K and p-AKT after CDDP treatment (p < 0.01); however, AFG administration restored the expressions of two (p < 0.05 or p < 0.01; panels A−C of Figure 8). The percentage of apoptotic cells was remarkably decreased after AFG pretreatment. The results implied that pretreatment with AFG (40 and 80 mg/kg) relieved the CDDP effects (p < 0.05 or p < 0.01). Moreover, the increase in Bax and cleaved caspase-3 and the decrease in Bcl-2 were seen in kidneys after CDDP treatment. AFG pretreatment at 40 and 80 mg/kg reversed these changes (p < 0.05 or p < 0.01; panels C and F of Figure 5), suggesting the anti-apoptotic effect of AFG in CDDP-induced AKI.

4. DISCUSSION AKI is regarded as a major limitation in the clinical use of CDDP chemotherapy, leading to chronic kidney diseases and increased mortality.29 Collectively, it is very important and urgent to develop new prophylactic strategies with a delineated mechanism of action to prevent or diminish CDDP-induced AKI. AFG, one representative non-saponin constituent in red ginseng, has been shown with antihypertensive, antioxidant, and anti-inflammatory activities.30 Oxidative stress, inflammation, and apoptosis are well-established as important factors in CDDP-induced renal toxicity. This research demonstrated the potential protective effects of AFG on oxidative stress, inflammation, and apoptosis in CDDP-induced AKI. CDDP-caused AKI in mouse is a well-established animal model, which is characterized by the renal morphology changes, with significant necrosis of nephrocytes and quick elevation of CRE and BUN.31 In this study, serum levels of CRE and BUN were increased remarkably after CDDP treatment, while the increases were reversed by AFG pretreatment. Meanwhile, tissue histology examination further corroborated that AFG evidently improved the histological abnormalities induced by CDDP. Furthermore, the present work illustrated that AFG administration (40 and 80 mg/kg)32 prevented the elevation of CRE and BUN and markedly attenuated CDDP-induced renal dysfunction. Oxidative stress is one of the key factors in CDDP-induced AKI.33 Previously, the results from Li et al. showed that CDDP administration was associated with excessive ROS generation, elevated free radical production, and subsequent oxidative stress and lipid peroxidation.34 CYP2E1, one of the most significant current drug-metabolizing enzymes, may contribute to the generation of ROS.35 Recent research showed that overexpression of CYP2E1 destroyed the integrity of the cell membrane, thereby threatened the function of DNA and proteins.28 These previous results were consistent with that in this work. Overexpression of CYP2E1 in renal tissues was

Figure 6. Effects of AFG on the NF-κB signaling pathway. (A) Expressions of protein p-NF-κB, NF-κB, p-IKKα, IKKα, p-IKKβ, IKKβ, IκBα, and p-IκBα were analyzed by western blot analysis with specific primary antibodies, and the β-actin protein level was used as a loading control. Quantitative analysis of scanning densitometry for (B) p-IKKα, (C) p-IKKβ, (D) p-IκBα, and (E) p-NF-κB was performed. All data were expressed as the mean ± SD (n = 3). (∗∗) p < 0.01 versus the normal group. (#) p < 0.05 and (##) p < 0.01 versus the CDDP group.

were diminished by the pretreatment with AFG (40 and 80 mg/kg), separately (p < 0.05 or p < 0.01; Figure 6). To analyze whether AFG was able to inhibit other inflammatory mediators in CDDP-induced AKI, mRNA expression levels of TNF-α, IL-1β, and IL-6 in kidney tissues were analyzed by qPCR. The results demonstrated that exposure to CDDP strongly increased expression of TNF-α, IL-1β, and IL-6 at the transcriptional level (p < 0.01). Indeed, AFG treatment mitigated the upregulation of TNF-α, IL-1β, and IL-6 by CDDP (p < 0.05 or p < 0.01; Figure 7G). Likewise, we used IHC staining and western blot analysis to monitor the expressions of COX-2 and iNOS. As shown in panels A−F of Figure 7, our findings indicate that the expressions of iNOS and COX-2 in renal tissues of the mice exposed to CDDP were obviously increased in comparison to the control group (p < 0.01), whereas AFG pretreatment for 10 days significantly decreases them (p < 0.05 or p < 0.01). All results effectively confirmed that AFG treatment prevented CDDP-induced inflammation. 3.5. AFG Alleviated CDDP-Induced Apoptosis. TUNEL staining was used to determine apoptotic kidney 5759

DOI: 10.1021/acs.jafc.9b00540 J. Agric. Food Chem. 2019, 67, 5754−5763

Article

Journal of Agricultural and Food Chemistry

Figure 7. Effects of AFG on inflammatory responses. (A) Expression of iNOS and COX-2 was examined by immunohistochemistry in renal tissues, and (B and C) fluorescence intensities were quantified at 200×. (D) Furthermore, the expression levels of iNOS and COX-2 were determined by western blot analysis. Quantitative analysis of scanning densitometry for (E) iNOS and (F) COX-2 was performed (n = 3). (G) In addition, the expression of IL-1β, TNF-α, and IL-6 was examined by real-time PCR. (∗∗) p < 0.01 versus the normal group. (#) p < 0.05 and (##) p < 0.01 versus the CDDP group.

Figure 8. Effects of AFG on the PI3K/Akt signaling pathway. (A) Expressions of protein p-PI3K, PI3K, p-Akt, and AKT were measured, and the β-actin protein level was used as a loading control. (B and C) Quantification of the relative protein expression was performed by densitometric analysis (n = 3). (∗∗) p < 0.01 versus the normal group. (#) p < 0.05 and (##) p < 0.01 versus the CDDP group.

observed in the CDDP group, which was significantly reversed by administration of AFG. MDA and 4-HNE, reliable biomarkers

of lipid peroxidation, are often used to evaluate the extent of relevant free radical reaction. The present study has shown that 5760

DOI: 10.1021/acs.jafc.9b00540 J. Agric. Food Chem. 2019, 67, 5754−5763

Article

Journal of Agricultural and Food Chemistry

was able to regulate apoptosis.47 In addition, the expression of NF-κB-regulated gene products was also involved in the cellular apoptosis Bcl-2 family.48,49 Moreover, CDDP may induce DNA damage in the kidneys, which is related to ROS formation and caspase-3-dependent apoptosis, through translocation of Bcl-2 family proteins and the activation of caspase-3. In this study, AFG increased p-PI3K and expression of p-Akt, to successfully inhibit the expression of Bax and cleaved caspase-3 and to enhance the expression of Bcl-2 via the PI3K/ Akt pathway. Our previous observations also support our present results, in which MRP maltol attenuated CDDP-induced AKI in mice through the PI3K/Akt pathway.35 Simultaneously, pretreatment with AFG for 10 days obviously decreased cell apoptosis in renal tissues, which was confirmed again by the TUNEL staining assay. All of these results strongly demonstrate that the inhibition of PI3K promotes cell apoptosis, as a potential drug target for renal protection. Further studies are warranted to find out the biological activities of AFG in different experimental disease animal models other than AKI. In conclusion, administration of AFG reverses side effects of CDDP-induced AKI in mice partially through restoring antioxidative activity and reducing inflammatory response. In particular, AFG pretreatment improves CDDP-induced renal injury by eliminating oxidative stress response, NF-κBmediated inflammation, and PI3K/Akt-mediated apoptotic signaling pathways (Figure 9). In our knowledge, it is the

CDDP increased the production of renal MDA and reduced the renal level of GSH in kidney tissues, which were restored to almost normal levels in AFG-treated mice. Additionally, present results illustrated that CDDP impaired antioxidant function, as manifested by rapidly reducing the activity of CAT and SOD.36 By activation of CAT and SOD activities, antioxidative abilities were re-established by AFG in CDDPinduced AKI mice. These finding integrated with previous results further confirmed that MRPs, including maltol fructose− histidine and others, exerted useful effects in cancer adjuvant chemotherapy via reducing oxidative-stress-related CDDPinduced AKI.17,37 In addition to oxidative stress, another major pathogenesis of AKI is inflammation. We therefore evaluated the NF-κB signaling pathways. Specifically, oxidative stress exaggerates proinflammatory gene expressions, including TNF-α, IL-1β, COX-2, and iNOS, through the activation of the NF-κB pathway. NF-κB is a transcription factor, which participates in the expression of multiple genes and proteins in CDDPindicated AKI.38 Normally, NF-κB presents in an inactive form or IκB-bound form in the cytoplasm.25 Nearly all signals that lead to activation of NF-κB converge on the activation of a high-molecular-weight complex that contains a serine-specific IκB kinase (IKKα/β). Once activated, IκB is degraded by activated IKK, causing NF-κB translocation from the cytoplasm to the nucleus, where NF-κB stimulates the expressions of inflammation-related genes to further enhance inflammatory signals.39 Meanwhile, inflammatory cells also induce overproduction of ROS as a vicious cycle, leading to the emergence and development of a variety of diseases, including AKI.40 Previous work reported anti-inflammatory effects of L-arginine through inhibiting NF-κB activation.41 Western blot analysis in the present study also showed the similar results that AFG blocked NF-κB activation by restraining the activation of IKKα, IKKβ, and IκBα. In the current experiments, the expressions of COX-2 and iNOS sharply increased in the CDDP injection, whereas AFG reversed such increases. Moreover, the qPCR results showed the increase in several proinflammatory cytokines, TNF-α, IL-1β, and IL-6, by CDDP, whereas AFG treatment partially subdued the overexpression of inflammatory factors. These results were also consisted with a previous study.42 Numerous results suggest that kidney cell necrosis, inflammation, and apoptosis are participated in CDDP-induced AKI.43 In the present work, the apoptosis rate of kidney cells was markedly decreased by AFG compared to that in the CDDP group. To better illustrate the connection between apoptosis and CDDP-induced renal injury, western blot analysis was used to explore the expression of related proteins. PI3K is an intracellular phosphatidyl inositol kinase, which is involved in numerous cellular functions, such as differentiation, cell proliferation, and apoptosis.44 Akt is an important downstream effector of PI3K, which displays the key functions via phosphorylation of several downstream signal pathways, including Bcl-2 family and caspase-dependent pathways.9 Bcl-2 family proteins, including Bax and Bcl-2, are typical proteins to regulate cell proliferation and apoptosis.45 Actually, expressions of Bcl-2 and Bax apoptotic molecules are also driven by NF-κB and oxidative stress, apart from PI3K/Akt. NF-κB has been implicated in inhibiting apoptosis through a transcriptional induction of multiple anti-apoptotic factors, including Bcl-2 family proteins.46 The subunit of NF-κB is a target for phosphorylation by IKK, and a cell-permeable peptide from NF-κB

Figure 9. Schematic diagram of the molecular mechanism underlying ameliorative effects of AFG against CDDP-induced AKI.

first time demonstrating that AFG pretreatment alleviates adverse effects of AKI induced by CDDP in a mice model. This study suggests a future research direction of MRPs from red ginseng.

■

AUTHOR INFORMATION

Corresponding Author

*Telephone/Fax: +86-431-84533304. E-mail: liwei7727@126. com. ORCID

Wei Li: 0000-0002-2988-4298 5761

DOI: 10.1021/acs.jafc.9b00540 J. Agric. Food Chem. 2019, 67, 5754−5763

Article

Journal of Agricultural and Food Chemistry Funding

(12) Lee, H.; Ok, H.; Kwon, O. Protective Effects of Korean Red Ginseng against Alcohol-Induced Fatty Liver in Rats. Molecules 2015, 20, 11604−11616. (13) Han, J.; Lee, S.; Yang, J.; Kim, S.; Sim, J.; Kim, M.; Jeong, T.; Ku, S.; Cho, I.; Ki, S. Korean Red Ginseng attenuates ethanol-induced steatosis and oxidative stress via AMPK/Sirt1 activation. J. Ginseng Res. 2015, 39, 105−115. (14) Mohanan, P.; Subramaniyam, S.; Mathiyalagan, R.; Yang, D. Molecular signalingofginsenosides Rb1, Rg1, and Rg3 and their mode of actions. J. Ginseng Res. 2018, 42, 123−132. (15) Vinh, L.; Lee, Y.; Han, Y.; Kang, J.; Park, J.; Kim, Y.; Yang, S.; Kim, Y. Two new dammarane-type triterpene saponins from Korean red ginseng and their anti-inflammatory effects. Bioorg. Med. Chem. Lett. 2017, 27, 5149−5153. (16) Takaku, T.; Han, K. L.; Kameda, K.; Ninomiya, H.; Okuda, H. Production of arginyl-fructosyl-glucose during processing of red ginsen. J. Tradit. Med. 1996, 13, 118−123. (17) Lee, J.-S.; Kim, G.-N.; Lee, S.-H.; Kim, E.-S.; Ha, K.-S.; Kwon, Y.-I.; Jeong, H.-S.; Jang, H.-D. In vitro and cellular antioxidant activity of arginyl-fructose and arginyl-fructosyl-glucose. Food Sci. Biotechnol. 2009, 18, 1505−1510. (18) Iwasaki, H.; Zhou, Y.; Iwahashi, H.; Kuwahara, H. Maltulosyl arginine and fructosyl arginine as anti-inflammatory drugs, anti-aging agents, nitrogen monoxide production stimulators, and skin cosmetics. Japanese Patent 2010090076 A, April 22, 2010; pp 219− 225. (19) Kim, G.-N.; Lee, J.-S.; Song, J.-H.; Oh, C.-H.; Kwon, Y.-I.; Jang, H.-D. Heat processing decreases Amadori products and increases total phenolic content and antioxidant activity of Korean red ginseng. J. Med. Food 2010, 13, 1478−1484. (20) Kwon, Y.-I.; Ha, K. S.; Jo, S.-H.; Apostolidis, E.; Jang, H.-d.; Lee, M. s. Anti-hyperglycemic Effect of 2 Amadori Rearrangement Compounds, Arginyl-fructose and Arginyl-fructosyl-glucose. FASEB J. 2012, 813−821. (21) Kim, Y.-J.; Lee, M.-Y.; Son, H.-Y.; Park, B.-K.; Ryu, S.-Y.; Jung, J.-Y. Red ginseng ameliorates acute cisplatin-induced nephropathy. Planta Med. 2014, 80, 645−654. (22) Joo, K. M.; Park, C. W.; Jeong, H. J.; Lee, S. J.; Chang, I. S. Simultaneous determination of two Amadori compounds in Korean red ginseng (Panax ginseng) extracts and rat plasma by highperformance anion-exchange chromatography with pulsed amperometric detection. J. Chromatogr. B: Anal. Technol. Biomed. Life Sci. 2008, 865, 159−166. (23) Zheng, Y. N.; Matsuura, Y.; Han Takaku, T.; Xiang, L.; Kameda, K.; Li, X. G.; Okuda, H. Isolation and solation and structure elucidation of a new amino acid derivative from red ginseng. Acta Pharm. Sin. 1996, 31, 195−198. (24) Li, W.; Chen, C. Response to the Comments on CaspaseMediated Anti-Apoptotic Effect of Ginsenoside Rg5, a Main Rare Ginsenoside, on Acetaminophen-Induced Hepatotoxicity in Mice. J. Agric. Food Chem. 2018, 66, 1734−1735. (25) Ma, Z. N.; Liu, Z.; Wang, Z.; Ren, S.; Tang, S.; Wang, Y. P.; Xiao, S. Y.; Chen, C.; Li, W. Supplementation of American ginseng berry extract mitigated cisplatin-evoked nephrotoxicity by suppressing ROS-mediated activation of MAPK and NF-κB signaling pathways. Food Chem. Toxicol. 2017, 110, 62−73. (26) Li, W.; Xu, Q.; He, Y.-F.; Liu, Y.; Yang, S.-B.; Wang, Z.; Zhang, J.; Zhao, L.-C. Anti-Tumor Effect of SteamedCodonopsis lanceolatain H22 Tumor-Bearing Mice and Its Possible Mechanism. Nutrients 2015, 7, 8294−8307. (27) Gao, F. F.; Zhang, W. Y.; Liu, L. M.; Chang, C.; Han, L. K.; Wei, C. Y.; Li, W.; Song, Z. F.; Zheng, Y. N. Detection and distribution of arginine derivatives in Panax quinquefolius L. and investigations of their antioxidant properties. Food Sci. Technol. 2012, 49, 34−41. (28) Ma, Z.; Li, Y.; Li, W.; Yan, X.; Yang, G.; Zhang, J.; Zhao, L.; Yang, L. Nephroprotective Effects of Saponins from Leaves of Panax quinquefolius against Cisplatin-Induced Acute Kidney Injury. Int. J. Mol. Sci. 2017, 18, 1407.

The present work was supported by grants of the National Natural Science Foundation of China (NSFC, with Certificate 31770378) and the Science & Technology Development Plan of Jilin Province (20180201083YY and 20191102051YY). Notes

The authors declare no competing financial interest.

■

ABBREVIATIONS USED CDDP, cisplatin; AFG, arginyl-fructosyl-glucose; BUN, blood urea nitrogen; MDA, malondialdehyde; CAT, catalase; 4-HNE, 4-hydroxynonenal; iNOS, inducible nitric oxide synthase; TNF-α, tumor necrosis factor α; IL-6, interleukin 6; Akt, protein kinase B; NF-κB, nuclear factor κB; Bcl-2, B-cell lymphoma 2; qPCR, quantitative polymerase chain reaction; AKI, acute kidney injury; CRE, creatinine; H&E, hematoxylin and eosin; GSH, glutathione; SOD, superoxide dismutase; CYP2E1, cytochrome P450 E1; COX-2, cyclooxygenase 2; IL1β, interleukin 1β; PI3K, phosphatidylinositol 3-kinase; IκB, inhibitor of κB; IKK, IκB kinase; Bax, B-associated X; LC− MS/MS, liquid chromatography−tandem mass spectrometry

■

REFERENCES

(1) Dugbartey, G. J.; Peppone, L. J.; De Graaf, I. A. An integrative view of cisplatin-induced renal and cardiac toxicities: Molecular mechanisms, current treatment challenges and potential protective measures. Toxicology 2016, 371, 58−66. (2) Li, W.; Yan, M. H.; Liu, Y.; Liu, Z.; Wang, Z.; Chen, C.; Zhang, J.; Sun, Y. S. Ginsenoside Rg5 Ameliorates Cisplatin-Induced Nephrotoxicity in Mice through Inhibition of Inflammation, Oxidative Stress, and Apoptosis. Nutrients 2016, 8, 566−568. (3) Li, Y. Z.; Ren, S.; Yan, X. T.; Li, H. P.; Li, W.; Zheng, B.; Wang, Z.; Liu, Y. Y. Improvement of Cisplatin-induced renal dysfunction by Schisandra chinensis stems via anti-inflammation and anti-apoptosis effects. J. Ethnopharmacol. 2018, 217, 228−237. (4) Lee, S.; Cozzi, M.; Bush, E.; Rabb, H. Distant Organ Dysfunction in Acute Kidney Injury: A Review. Am. J. Kidney Dis. 2018, 72 (6), 846−856. (5) Fernández-Rojas, B.; Medina-Campos, O.; Hernández-Pando, R.; Negrette-Guzmán, M.; Huerta-Yepez, S.; Pedraza-Chaverri, J. Cphycocyanin prevents cisplatin-induced nephrotoxicity through inhibition of oxidative stress. Food Funct. 2014, 5, 480−490. (6) Bubici, C.; Papa, S.; Dean, K.; Franzoso, G. Mutual cross-talk between reactive oxygen species and nuclear factor-κB: Molecular basis and biological significance. Oncogene 2006, 25, 6731−48. (7) Li, Y.; Ren, S.; Yan, X.; Li, H.; Li, W.; Zheng, B.; Wang, Z.; Liu, Y. Improvement of Cisplatin-induced renal dysfunction by Schisandra chinensis stems via anti-inflammation and anti-apoptosis effects. J. Ethnopharmacol. 2018, 217, 228−237. (8) Jiang, M.; Dong, Z. Regulation and Pathological Role of p53 in Cisplatin Nephrotoxicity. J. Pharmacol. Exp. Ther. 2008, 327, 300− 307. (9) Leng, J.; Wang, Z.; Fu, C. L.; Zhang, J.; Ren, S.; Hu, J. N.; Jiang, S.; Wang, Y. P.; Chen, C.; Li, W. NF-κB and AMPK/PI3K/Akt signaling pathways are involved in the protective effects of Platycodon grandiflorum saponins against acetaminophen-induced acute hepatotoxicity in mice. Phytother. Res. 2018, 32 (11), 2235−2246. (10) Zhang, W.; Hou, J.; Yan, X.; Leng, J.; Li, R.; Zhang, J.; Xing, J.; Chen, C.; Wang, Z.; Li, W. Platycodon grandif lorum Saponins Ameliorate Cisplatin-Induced Acute Nephrotoxicity through the NF-κB-Mediated Inflammation and PI3K/Akt/Apoptosis Signaling Pathways. Nutrients 2018, 10, 1328. (11) Dos Santos, N. A. G.; Carvalho Rodrigues, M. A.; Martins, N. M.; Dos Santos, A. C. Cisplatin-induced nephrotoxicity and targets of nephroprotection: An update. Arch. Toxicol. 2012, 86, 1233−1250. 5762

DOI: 10.1021/acs.jafc.9b00540 J. Agric. Food Chem. 2019, 67, 5754−5763

Article

Journal of Agricultural and Food Chemistry (29) Hassan, S. M.; Khalaf, M. M.; Sadek, S. A.; Abo-Youssef, A. M. Protective effects of apigenin and myricetin against cisplatin-induced nephrotoxicity in mice. Pharm. Biol. 2017, 55, 766−774. (30) Rufián-Henares, J. A.; Morales, F. J. Functional properties of melanoidins: In vitro antioxidant, antimicrobial and antihypertensive activities. Food Res. Int. 2007, 40, 995−1002. (31) Gao, Z.; Zhang, C.; Tian, C.; Ren, Z.; Song, X.; Wang, X.; Xu, N.; Jing, H.; Li, S.; Liu, W.; Zhang, J.; Jia, L. Characterization, antioxidation, anti-inflammation and renoprotection effects of selenized mycelia polysaccharides from Oudemansiella radicata. Carbohydr. Polym. 2018, 181, 1224−1234. (32) Shao, Y.; Sun, R.-h.; Wang, D.; Li, W.; Zheng, Y.-n.; Zhang, J. The protective effect of arginyl-fructosyl-glucose against cyclophosphamide-inducted immunosuppression in mice. Acta Nutr. Sin. 2015, 3, 022. (33) Trujillo, J.; Molina-Jijón, E.; Medina-Campos, O.; RodríguezMuñoz, R.; Reyes, J.; Loredo, M.; Barrera-Oviedo, D.; Pinzón, E.; Rodríguez-Rangel, D.; Pedraza-Chaverri, J. Curcumin prevents cisplatin-induced decrease in the tight and adherens junctions: Relation to oxidative stress. Food Funct. 2016, 7, 279−293. (34) Li, W.; Yan, M.-H.; Liu, Y.; Liu, Z.; Wang, Z.; Chen, C.; Zhang, J.; Sun, Y.-S. Ginsenoside Rg5 ameliorates cisplatin-induced nephrotoxicity in mice through inhibition of inflammation, oxidative stress, and apoptosis. Nutrients 2016, 8, 566. (35) Mi, X.-J.; Hou, J.-G.; Wang, Z.; Han, Y.; Ren, S.; Hu, J.-N.; Chen, C.; Li, W. The protective effects of maltol on cisplatin-induced nephrotoxicity through the AMPK-mediated PI3K/Akt and p53 signaling pathways. Sci. Rep. 2018, 8 (1), 15922. (36) Niaz, S. K.; Quraishy, M. S.; Taj, M. A.; Abid, S.; Alam, A.; Nawaz, A. A.; Ali Shah, S. H.; Khan, I. M.; Memon, A. R.; Zuberi, B. F.; Tayyab, G. N.; Malik, K.; Mirza, S.; Abbas, Z. Guidelines on gastroesophageal reflux disease. J. Pak. Med. Assoc. 2015, 65, 532− 541. (37) Kim, J. H.; Han, I.-H.; Yamabe, N.; Kim, Y.-J.; Lee, W.; Eom, D.-W.; Choi, P.; Cheon, G. J.; Jang, H.-J.; Kim, S.-N.; Ham, J.; Kang, K. S. Renoprotective effects of Maillard reaction products generated during heat treatment of ginsenoside Re with leucine. Food Chem. 2014, 143, 114−121. (38) Ozkok, A.; Ravichandran, K.; Wang, Q.; Ljubanovic, D.; Edelstein, C. L. NF-κB transcriptional inhibition ameliorates cisplatininduced acute kidney injury (AKI). Toxicol. Lett. 2016, 240, 105−113. (39) Häcker, H.; Karin, M. Regulation and function of IKK and IKK-related kinases. Sci. STKE 2006, 357 (2006), 13. (40) Qi, Z. L.; Wang, Z.; Li, W.; Hou, J. G.; Liu, Y.; Li, X. D.; Li, H. P.; Wang, Y. P. Nephroprotective Effects of Anthocyanin from the Fruits of Panax ginseng (GFA) on Cisplatin-Induced Acute Kidney Injury in Mice. Phytother. Res. 2017, 31, 1400−1409. (41) Han, F.; Hu, L.; Xuan, Y.; Ding, X.; Luo, Y.; Bai, S.; He, S.; Zhang, K.; Che, L. Effects of high nutrient intake on the growth performance, intestinal morphology and immune function of neonatal intra-uterine growth-retarded pigs. Br. J. Nutr. 2013, 110, 1819−1827. (42) Gao, M. T.; Wang, J. Q.; Chen, K.; Li, Y.; Li, J. Y.; Liu, Y. T.; Ding, C. B.; Liu, W. C.; Zheng, Y. N. Effects of Arginyl-FructosylGlucose on the Secretion of Inflammatory Cytokines in Macrophages Induced by Lipopolysaccharide. Chin. J. Vet. Drug 2016, 11, 014. (43) Park, J. Y.; Choi, P.; Kim, T.; Ko, H.; Kim, H.-k.; Kang, K. S.; Ham, J. Protective Effects of Processed Ginseng and Its Active Ginsenosides on Cisplatin-Induced Nephrotoxicity: In Vitro and in Vivo Studies. J. Agric. Food Chem. 2015, 63, 5964−5969. (44) Zhou, Y. D.; Hou, J. G.; Liu, W.; Ren, S.; Wang, Y. P.; Zhang, R.; Chen, C.; Wang, Z.; Li, W. 20(R)-ginsenoside Rg3, a rare saponin from red ginseng, ameliorates acetaminophen-induced hepatotoxicity by suppressing PI3K/AKT pathway-mediated inflammation and apoptosis. Int. Immunopharmacol. 2018, 59, 21−30. (45) Sadhukhan, P.; Saha, S.; Dutta, S.; Sil, P. C. Mangiferin Ameliorates Cisplatin Induced Acute Kidney Injury by Upregulating Nrf-2 via the Activation of PI3K and Exhibits Synergistic Anticancer Activity with Cisplatin. Front. Pharmacol. 2018, 9, 638.

(46) Zheng, C.; Ren, Z.; Wang, H.; Zhang, W.; Kalvakolanu, D. V.; Tian, Z.; Xiao, W. E2F1 Induces tumor cell survival via nuclear factorκB-dependent induction of EGR1 transcription in prostate cancer cells. Cancer Res. 2009, 69, 2324−2331. (47) Takada, Y.; Singh, S.; Aggarwal, B. B. Identification of a p65 peptide that selectively inhibits NF-κB activation induced by various inflammatory stimuli and its role in down-regulation of NF-κBmediated gene expression and up-regulation of apoptosis. J. Biol. Chem. 2004, 279, 15096−15104. (48) Gupta, S.; Afaq, F.; Mukhtar, H. Involvement of nuclear factorκB, Bax and Bcl-2 in induction of cell cycle arrest and apoptosis by apigenin in human prostate carcinoma cells. Oncogene 2002, 21, 3727−3738. (49) Bui, N. T.; Livolsi, A.; Peyron, J. F.; Prehn, J. H. Activation of nuclear factor κB and Bcl-x survival gene expression by nerve growth factor requires tyrosine phosphorylation of IκBα. J. Cell Biol. 2001, 152, 753−764.

5763

DOI: 10.1021/acs.jafc.9b00540 J. Agric. Food Chem. 2019, 67, 5754−5763