Artificial Virus Delivers CRISPR-Cas9 System for Genome Editing of

Artificial Virus Delivers CRISPR-Cas9 System for Genome Editing of Cells in Mice Ling Li,†,§ Linjiang Song,†,§ Xiaowei Liu,†,§ Xi Yang,†,§ Xia Li,† Tao He,† Ning Wang,† Suleixin Yang,† Chuan Yu,† Tao Yin,† Yanzhu Wen,† Zhiyao He,† Xiawei Wei,† Weijun Su,‡ Qinjie Wu,† Shaohua Yao,*,† Changyang Gong,*,† and Yuquan Wei*,† †

State Key Laboratory of Biotherapy and Cancer Center, West China Hospital and Collaborative Innovation Center for Biotherapy, Sichuan University, Chengdu 610041, P. R. China ‡ School of Medicine, Nankai University, Tianjin 300071, P. R. China S Supporting Information *

ABSTRACT: CRISPR-Cas9 has emerged as a versatile genome-editing platform. However, due to the large size of the commonly used CRISPR-Cas9 system, its effective delivery has been a challenge and limits its utility for basic research and therapeutic applications. Herein, a multifunctional nucleus-targeting “core-shell” artificial virus (RRPHC) was constructed for the delivery of CRISPR-Cas9 system. The artificial virus could efficiently load with the CRISPR-Cas9 system, accelerate the endosomal escape, and promote the penetration into the nucleus without additional nuclear-localization signal, thus enabling targeted gene disruption. Notably, the artificial virus is more efficient than SuperFect, Lipofectamine 2000, and Lipofectamine 3000. When loaded with a CRISPR-Cas9 plasmid, it induced higher targeted gene disruption efficacy than that of Lipofectamine 3000. Furthermore, the artificial virus effectively targets the ovarian cancer via dual-receptormediated endocytosis and had minimum side effects. When loaded with the Cas9-hMTH1 system targeting MTH1 gene, RRPHC showed effective disruption of MTH1 in vivo. This strategy could be adapted for delivering CRISPR-Cas9 plasmid or other functional nucleic acids in vivo. KEYWORDS: CRISPR-Cas9, artificial virus, MTH1, genome editing, nucleus-targeting

C

size and safety concern. Currently, nucleofection, electroporation, and lipofectamine have been widely applied to deliver plasmid DNA (pDNA) encoding Cas9/sgRNAs complexes into cultured cells.13−15 Viral vectors, such as adeno-associated viral (AAV), adenoviral (Ad), and lentivirus have also been used to constitutively express Cas9 and/or sgRNAs to targeted cells.16−18 However, nucleofection, electroporation, and lipofectamine may be effective in cultured cells in vitro, but in vivo applications are limited. Commonly used delivery systems, such as lentivirus and AAV, have limited packaging capacity, while viral vectors with higher packaging capacity, such as adenovirus, which could be utilized to deliver large transgenes, generally have limited cell type specificity, higher immunogenicity, and tissue tropism. Given these challenges, there is an urgent need for a more versatile delivery system to enable efficient CRISPRCas9-mediated genome editing in vivo.

lustered regularly interspaced short palindromic repeats (CRISPR) systems are RNA-based adaptable immune mechanisms of bacteria and archaea to protect themselves from exogenous nucleic acids (viruses or plasmids).1−3 CRISPR-associated protein 9 (Cas9) is a doublestranded DNA nuclease present in the type II CRISPR immune system, which uses a small CRISPR RNA (crRNA) and a transactivating crRNA (tracrRNA) to specify the site of cleavage.4 Due to its versatility, simplicity, high specificity and efficiency, the CRISPR-Cas9 platform has been widely applied for genome editing and holds tremendous promise for biomedical research.5−12 The current delivery form of CRISPR-Cas9 system could be classified as either the plasmid encoding Cas9 nuclease and sgRNA sequence or a direct delivery of mRNA or protein. Owing to its versatility and simplicity, the former strategy has been widely applied in most studies. Though CRISPR-Cas9 has been widely applied in varieties of cell line- and embryo-based experiments, delivery poses the major challenge for their further development toward human therapeutics, owing to many factors such as its large transgene © 2016 American Chemical Society

Received: June 28, 2016 Accepted: November 13, 2016 Published: November 13, 2016 95

DOI: 10.1021/acsnano.6b04261 ACS Nano 2017, 11, 95−111

Article

www.acsnano.org

Article

ACS Nano

Figure 1. (A) Schematic diagram of sgRNAs targeting MTH1 gene. PAM sequences are underlined and highlighted in green, and sgRNA targeting sites are highlighted in red. (B) Detection of Cas9/sgRNA3-mediated cleavage of MTH1 loci by T7EI cleavage assay. M, DNA marker. Con, control. (C) Sanger sequencing of the PCR amplicon of the targeted sites in the Cas9/sgRNA3 treatment group. (D) Representative DNA sequences of modified MTH1 loci detected in mutant colonies.

side chains conjugated to HA backbone can improve the stability of the nanoparticles.26 Finally, R8-RGD tandem peptide can be further conjugated to the distal of the PEG chains, endowing the artificial virus with both specific targeting to integrin αvβ3 receptors overexpressed on tumor vascular endothelial cells and tumor cells and high penetrating ability.27−29 Nowadays, the occurrence of cancers is always accompanied by a large number of activated oncogenes.30,31 Many reports have proved that perturbing the expression of oncogenes with siRNA or shRNA can relieve the tumor growth.32−34 However, these conventional methods only have an effect on expression levels of proteins, but retain the original copy of the oncogenes. CRISPR-Cas9 system can remove the oncogenes from the genome. Ovarian cancer is a leading cause of cancer death in women. It is usually diagnosed in late stage, and there is no effective targeted therapy to date. The primary mode of metastasis is unique in that dissemination occurs via tumor cell shedding into the peritoneal cavity, survival and growth within ascites.35 Herein, we chose the ovarian cancer peritoneal metastasis model as an in vivo gene editing model of CRISPRCas9. MTH1 (the MutT Homolog1) sanitizes the oxidized dNTP pool, avoiding incorporation of oxidized nucleotides into the genome DNA, thus avoiding genetic instability and consecutive cell death.36,37 Experimental evidence has shown that MTH1 is overexpressed in many types of cancer cells, and knocking down the expression of MTH1 in cancer cells results in more oxidized dNTP incorporation, genomic DNA damage, and cell apoptosis, whereas normal cells are unresponsive, validating MTH1 as a promising target for cancer treat-

In the past decades, nonviral gene vectors have attracted much attention, due to their low immunogenecity, absence of endogenous virus recombination, and less limitation in delivering large gene payloads.19,20 We hypothesize that nonviral gene vector may be an alternative for the delivery of CRISPR-Cas9 plasmid. However, though conventional nonviral gene vectors performed well in delivering plasmids with normal size, there are few reports about delivering such large plasmids. In this study we constructed a multifunctional nucleustargeting “core-shell” artificial virus (RRPHC) for the targeted delivery of CRISPR-Cas9 system in vivo. RRPHC artificial virus (RRPHC/Cas9-hMTH1) was constituted by a core of fluorinated polymer (PF33) binding with the CRISPR-Cas9 system (PF33/Cas9-hMTH1 nanoparticles) and a versatile multifunctional shell (RGD-R8-PEG-HA, RRPH). RRPH is a multifunctional polymer, obtained by modification of natural hyaluronan (HA) polymer with PEG side chains and R8-RGD tandem peptide. RRPH endowed the artificial virus with multitargeting and depth penetration ability. The negatively charged HA backbone can reverse the positive charge of the PF33/Cas9-hMTH1 nanoparticles and reduce nonspecific interaction with components in a physiological environment. Meanwhile, HA can specifically bind to the CD44 receptors widely overexpressed on many types of tumor cells and improve the cellular uptake efficiency.21−23 After having entered tumor tissues, HA could be partially degraded by the hyaluronidase (HAase) overexpressed in the tumor stroma and intracellular compartments, re-exposing the positively charged PF33/Cas9-hMTH1 nanoparticles, and result in enhanced cellular uptake and endosomal escape.24,25 Subsequently, PEG 96


Article

ACS Nano

Figure 2. Synthesis scheme of PF33 and RRPH.

Table 1. Characterization of the PFsa

ment.38−40 Therefore, we chose MTH1 as the targeted gene of our CRISPR-Cas9 genome editing system. Collectively, in this work we generated a CRISPR-Cas9 expression plasmid targeting the MTH1 gene (Cas9-hMTH1) and verified its function at the cellular level. Subsequently, we constructed the RRPHC artificial virus, evaluated their multitargeting and depth penetration capability, transfection efficiency, and gene disruption efficiency in vitro. Finally, we further explored their efficacy for in vivo genome editing applications.

polymer

X

Y

PF5 PF8 PF10 PF20 PF26 PF33

0.72 1.33 1.65 3.24 4.19 5.31

4.5% 8.3% 10.3% 20.3% 26.2% 33.2%

a

X is the average number of heptafluorobutyric acid groups modified on each sample determined by the ninhydrin assay. Y is the percentage of fluorinated groups modified on each sample.

RESULTS AND DISCUSSION Construction of the Cas9-hMTH1 System. To construct the Cas9-hMTH1 system, we first designed 4 synthetic guide RNA (sgRNA) targeting the conserved domains of MTH1 gene and cloned them into the pX330 vectors (Figure 1A). The pX330 vector contains two expression cassettes, humanized Streptococcus pyogenes (hSpCas9) and the chimeric guide RNA containing 85nt of tracrRNA (Figure S1). In T7 endonuclease I (T7EI) assay, cleavage bands were visible in targeted locus after the treatment with the sgRNA3 containing CRISPR-Cas9 system (Cas9/sgRNA3) (Figure 1B). Further characterization by DNA sequencing revealed two or more peaks at the same location of PCR fragments, suggesting mixed genomic DNA templates induced by Cas9/sgRNA3 (Figure 1C). Some representative mutant alleles harboring insertion/deletion (indel) were presented in Figure 1D. The Cas9/sgRNA3 induced mutations at or near the targeted site, further confirming the sequence specificity of this targeting process. Therefore, Cas9/sgRNA3 system was chosen as Cas9-hMTH1 system targeting MTH1 gene for our further experiments. Preparation and Characterization of the RRPHC Artificial Virus. We first synthesized a series of fluorinated polymers (PFs) to bind with the Cas9-hMTH1 plasmid (Figure 2, Figure S2, Table 1). Due to the excellent performance of PF33 in the preliminary experiment, PF33 was chosen for further

studies. The PF33/Cas9-hMTH1 nanoparticles showed a hydrodynamic diameter of 77.5 ± 3.6 nm and a moderate positive zeta potential of +21.3 ± 2.3 mV (Figure 3A). Agarose gel retardation assays revealed that PF33 could effectively bind with the Cas9-hMTH1 plasmid and retard the plasmid mobility at a mass ratio of 1:1 (PF33:plasmid) (Figure 3B). Next, we designed a multifunctional polymer (RRPH) to coat the PF33/Cas9-hMTH1 nanoparticles to form the RRPHC artificial virus (Figures 2 and S3). We also coated PF33/Cas9hMTH1 nanoparticles with HA to form HAC/Cas9-hMTH1 nanoparticles as the control. As shown in Figure 3A, RRPHC/ Cas9-hMTH1 nanoparticles had an average hydrodynamic size of 131.3 ± 4.2 nm and a negative zeta potential of −21.8 ± 1.8 mV, confirming that RRPH was successfully coated onto the surface of PF33/Cas9-hMTH1 nanoparticles. Agarose gel retardation assays were also performed to test whether coating with negatively charged polymer interfered with DNA condensation. As shown in Figure 3B, no DNA detachment was observed after RRPH or HA coating, indicating that the RRPH or HA have no influence on DNA condensation. Furthermore, we analyzed the topography of the above nanoparticles by transmission electron microscopy (TEM). 97


Article

ACS Nano

Figure 3. (A) Size distribution and zeta potential of PF33/Cas9-hMTH1, HAC/Cas9-hMTH1, and RRPHC/Cas9-hMTH1 nanoparticles measured by DLS. (B) Agarose gel electrophoresis of PF33/Cas9-hMTH1, HAC/Cas9-hMTH1, and RRPHC/Cas9-hMTH1 nanoparticles. Lane 1, DNA ladder; lane 2, naked Cas9-hMTH1 plasmid; lane 3−8, PF33/Cas9-hMTH1 at mass ratios of 0.25:1, 0.5:1, 1:1, 2:1, 4:1, 8:1; lane 9, HAC/Cas9-hMTH1; and lane 10, RRPHC/Cas9-hMTH1. (C) Morphologies of PF33/Cas9-hMTH1, HAC/Cas9-hMTH1, and RRPHC/ Cas9-hMTH1 nanoparticles; the scale bar indicates 100 nm.

Figure 4. Cellular uptake of different nanoparticles loaded with YOYO-1 labeled Cas9-hMTH1 plasmid in SKOV3 cells after incubation for 2 h at 37 °C detected by flow cytometry.

98


Article

ACS Nano All nanoparticles showed compact and spheroid morphology with an average size about 40 nm (Figure 3C). To evaluate the cytotoxicity of PF33 and RRPH, MTT assays were performed in HEK-293 (human embryonic kidney cells) and SKOV3 (human ovarian cancer cells) cells. The result revealed that RRPH and PF33 was little cytotoxic to both cells (Figure S4). Cellular Uptake Analysis of the RRPHC Artificial Virus. Since efficient cellular uptake of Cas9-hMTH1 plasmid is needed to fully realize its potential of gene disruption. We measured the cellular uptake efficiency of the above nanoparticles, compared with that of PEI 25K/Cas9-hMTH1 polylexes, a golden standard for polymer gene transfection. As shown in Figure 4A,B, plasmid delivered by PF33 showed efficient cellular uptake (∼100%) in SKOV3 cells, higher than that delivered by PEI 25K, which may be attributed to the improved affinity to cell membranes after fluorination.41 Next, we performed cellular uptake experiments of RRPHC/ Cas9-hMTH1 nanoparticles to assess the multiple tumortargeting ability of RRPH polymer. We evaluated the CD44 expression levels of SKOV3 cells. As expected, a high CD44 expression level (almost 100%) was detected in SKOV3 cells (Figure S5). The cells treated by RRPHC/Cas9-hMTH1 nanoparticles exhibited the highest cellular uptake efficiency among all groups (Figure 4A). After preblocking the CD44 or/ and integrin αvβ3 receptors of SKOV3 cells, the cellular uptake of RRPHC/Cas9-hMTH1 nanoparticles was significantly inhibited, further confirming that the effective cellular uptake of RRPHC/Cas9-hMTH1 nanoparticles largely was associated with both CD44 and integrin αvβ3 receptors (Figure 4C,D). Endosomal Escape and Nucleus-Targeting Capability. Efficient endosomal escape ability, preventing proteolytic degradation, was a key characteristic for efficient gene transfection.42 It has been reported that fluorination can facilitate endosomal escape of the polymers by fusion with the endosome/lysosome membrane.43 We further investigated the intracellular distribution of PF33/Cas9-hMTH1 nanoparticles. As presented in Figure 5A, the PF33/Cas9-hMTH1 nanoparticles bound to the cell surface, then entered the cytosol at the first 0.5 h, colocalized with Lyso-Tracker within the first 2 h, and penetrated into the nuclei of SKOV3 cells after 4 h incubation. These results demonstrated that PF33/Cas9hMTH1 can effectively deliver Cas9-hMTH1 plasmid into cells, promote endosomal escape, and improve penetration into nuclei, implying the probable nucleus-targeting ability of PF33. Meanwhile, the intracellular distribution of the RRPHC/Cas9hMTH1 nanoparticles was also evaluated. The RRPHC/Cas9hMTH1 nanoparticles showed slightly delayed endosomal escape within the first 4 h. Possible causes of this delay may be that the RRPH shell needed to be degraded by HAase and then re-exposed PF33/Cas9-hMTH1 nanoparticles to facilitate the endosomal escape. Nevertheless, large amounts of Cas9hMTH1plasmids could also effectively escape from the lysosomes and penetrate into the nuclei after 8 h incubation, indicating RRPHC/Cas9-hMTH1 remains as the excellent endosomal escape ability of PF33/Cas9-hMTH1 nanoparticles (Figure 5B). In Vitro Gene Transfection. We performed the transfection experiment in HEK-293 cells. PF33/pEGFP achieved a transfection efficacy of nearly 100%. Meanwhile, RRPHC/ pEGFP nanoparticles also performed well in HEK-293 cells and induced a much higher transfection efficiency (>80%) than that of HAC/pEGFP nanoparticles (Figure S6).

Figure 5. Confocal images of SKOV3 cells treated with (A) PF33/ Cas9-hMTH1 and (B) RRPHC/Cas9-hMTH1 at 0.5, 1, 2, 4, and 8 h, respectively. Cas9-hMTH1 plasmid was labeled with YOYO-1, and the endosomes and lysosomes were stained with Lyso-Tracker Red, while the nuclei were stained with Hoechst 33342. The arrows indicate colocalization of YOYO-1 labeled Cas9-hMTH1 plasmid and the nuclei. The scale bar indicates 10 μm.

Next, the transfection experiment in SKOV3 cells was conducted. As presented in Figure 6, PF33/pEGFP showed dramatically high transfection efficiency (nearly 90%) at 24 h in both medium without serum and medium containing 10% FBS, while PEI 25K/pEGFP only induced ∼60% transfection efficiency. As expected, the unmodified PEI 1.8 K/pEGFP induced minimal transfection to SKOV3 cells (lower than 99


Article

ACS Nano

Figure 6. Comparison of transfection efficiency of different nanoparticles in SKOV3 cells at 24 h. (A, D) Images taken by fluorescence microscopy after transfected with different nanoparticles in (A) serum-free medium or (D) medium containing 10% serum. (B, E) Quantitative analysis of transfection efficiency in (B) serum-free medium or (E) medium containing 10% serum by flow cytometry. (C, F) Quantitative analysis of transfection efficiency in (C) serum-free medium or (F) medium containing 10% serum. The scale bar indicates 100 μm.

10%). These results suggested that fluorination may greatly change the properties of the polymer and in turn promote the transfection. Meanwhile, we also evaluated the transfection

efficiency of RRPHC/pEGFP nanoparticles to determine whether coating with RRPH had some influence on transfection efficacy. RRPHC/pEGFP nanoparticles exhibited high 100


Article

ACS Nano

Figure 7. Comparison of transfection efficiency of PF33/pEGFP, RRPHC/pEGFP, Lipofectamine 2000/pEGFP, and Lipofectamine 3000/ pEGFP in medium containing 0−30% serum in SKOV3 cells. (A) Images taken on inverted fluorescence microscope. (B, C) Analysis of transfection efficiency in medium containing (B) 30% serum or (C) serum-free medium by flow cytometry. (D, E) Quantitative analysis of positive GFP cells (%) and mean fluorescence intensity (MFI). The scale bar indicates 200 μm.

nanoparticles to lipoplexes of Lipofectamine 2000 and Lipofectamine 3000. As expected, Lipofectamine 2000 and Lipofectamine 3000 performed very well in SKOV3 cells with high gene transfection efficiency (>65%) in medium containing 0−30% serum. PF33/pEGFP nanoparticles maintained their remarkable high efficacy in the presence of 10−30% serum, which surpassed the efficiency of both Lipofectamine 2000 and

gene transfection efficiency (∼90%) comparable to that of PF33/pEGFP nanoparticles, significantly higher than that of HAC/pEGFP nanoparticles (∼30%) in both serum-free medium and medium containing 10% serum (Figure 6). Similar results were observed at 48 h (Figure S7). Inspired by the above results, we further compared the transfection efficiency of PF33/pEGFP and RRPHC/pEGFP 101


Article

ACS Nano

Figure 8. Analysis of in vitro gene disruption potency. (A) DNA sequencing results of PCR amplicon of the targeted sites after treatment with RRPHC/Cas9-hMTH1 or Lipofectamine 3000/Cas9-hMTH1. (B) The relative amplification efficiency of flankF, R2 primers to F2, R2 primers after treatment with RRPHC/Cas9-hMTH1, or Lipofectamine 3000/Cas9-hMTH1 detected by qPCR. (C) Mutation frequencies of hMTH1-target sites after RRPHC/Cas9-hMTH1 treatment detected by deep sequencing. Each value reported was determined from PCR products prepared from genomic DNA pooled from three independent transfection experiments.

Cas9-hMTH1 treatment, confirming a higher gene editing efficiency of RRPHC/Cas9-hMTH1 nanoparticles. Deep sequencing revealed that RRPHC/Cas9-hMTH1 treatment induced indel mutations at a frequency of ∼44%. The frequency of frame-shift mutation was about 42%, while that of in-frame mutation was just ∼1.74% (Figure 8C, Appendix S1). These results implied that the actual frequency of the inframe mutation after disruption of MTH1 gene may be low. Due to the necessity of MTH1 to cancer cells, we hypothesized that after RRPHC/Cas9-hMTH1 nanoparticles transfection, the expression of MTH protein may be reduced, followed by proliferation inhibition and improvement of apoptosis in cancer cells. To confirm our hypothesis, we detected the expression levels of MTH1 protein after treatment. As expected, the expression of MTH1 protein was significantly inhibited after treatment with RRPHC/Cas9hMTH1 nanoparticles, while RRPHC/Cas9-null nanoparticles had negligible effect (Figure 9E). As shown in Figure 9C,D, RRPHC/Cas9-hMTH1 treatment induced ∼64% of the total apoptotic ratio to SKOV3 cells, while the total apoptotic ratio of PF33/Cas9-null treatment was only ∼29%, correlated with the expression level of MTH1 protein. Meanwhile, cell proliferation rate of the RRPHC/Cas9-hMTH1 treatment group was ∼15%, much lower than that of the RRPHC/

Lipofectamine 3000. Notably, RRPHC/pEGFP nanoparticles also exhibited excellent transfection efficacy (>80%) in medium containing 0−30% serum, comparable to that of PF33/pEGFP nanoparticles (Figure 7). Collectively, these results indicated that the coated RRPHC/pEGFP nanoparticles enable cellular transfection. In Vitro Gene Disruption Potency Analysis. Furthermore, we evaluated in vitro gene disruption potency of RRPHC/Cas9-hMTH1 nanoparticles, and the lipoplexes of Lipofectamine 3000 were used as the control. As shown in Figure 8A, the PCR products of RRPHC/Cas9-hMTH1 treated group showed a higher intensity of composite sequence trace in the sequencing graph of the targeted location, compared with that of the Lipofectamine3000/Cas9-hMTH1 treated group, implying a higher gene editing efficiency with RRPHC/Cas9hMTH1 treatment. Subsequently, we used quantitative realtime PCR (qPCR)-based protocol developed by Yu et al., which is a feasible method to quantitatively evaluate the efficiency of the desired indel mutations induced by Cas9 nuleases, to further compare the gene disruption efficacy of RRPHC/Cas9-hMTH1 and Lipofectamine3000/Cas9-hMTH1 (Figure S8).44−46 As shown in Figure 8B, RRPHC/Cas9hMTH1 treatment induced greater reduction in amplicon flanking the target site (flankF, R2) than Lipofectamine 3000/ 102


Article

ACS Nano

Figure 9. In vitro apoptosis and proliferation analysis after gene editing. (A, B) The proliferation of SKOV3 cells treated with RRPHC/Cas9hMTH1 or RRPHC/Cas9-null detected by EdU assay. (C, D) The apoptosis of SKOV3 cells treated with RRPHC/Cas9-hMTH1 or RRPHC/ Cas9-null detected by flow cytometry. (C) Expression levels of MTH1 protein in SKOV3 cells determined by Western blotting assays after different treatments. Cas9-hMTH1 indicates RRPHC/Cas9-hMTH1, while Cas9-null indicates RRPHC/Cas9-null. The scale bar indicates 200 μm.

Tumor Targeting Efficacy of the RRPHC Artificial Virus. In order to assess the tumor targeting capability of RRPHC/Cas9-hMTH1 nanoparticles in vivo, we constructed a subcutaneous xenograft tumor model of SKOV3 cells in BALB/ c nude mice. As shown in Figure 10A,B,D, RRPHC/Cas9hMTH1 nanoparticles rendered a significantly stronger fluorescence signal in tumor tissues over a long time than that of HAC/Cas9-hMTH1 nanoparticles, further confirming the effective tumor targeting effect of RRPHC/Cas9-hMTH1 nanoparticles in vivo. Meanwhile, we also constructed a peritoneal metastasis model of SKOV3 cells to further evaluate the tumor targeting ability of RRPHC/Cas9-hMTH1 nanoparticles after intraperitoneal injection. Interestingly, we observed that the signal of Cas9-hMTH1 plasmid was mainly localized in the tumor nodules attached to the intestine, minimally distributed in liver, while there was no distribution in other organs, such as heart, spleen, lung, kidney, and intestine. A stronger fluorescence signal in the tumor nodules was observed after RRPHC/Cas9-hMTH1 nanoparticle treatment,

Cas9-null treatment group (∼30%) (Figure 9A,B). All of these results further validated the significant role of MTH1 in the survival of cancer cells. Penetration into 3D Tumor Spheroids. An excellent gene delivery vector should have both desirable transfection efficacy and high permeability in targeted tissues.47 The threedimensional (3D) tumor spheroids are ideal platforms mimicking solid tumors to predict the delivery efficiency and mechanism.48,49 As presented in Figure S9, RRPHC/Cas9hMTH1 nanoparticles exhibited deeper and stronger penetration of fluorescence than that of all other groups, confirming the excellent penetration ability of R8-RGD tandem peptide. In contrast, the penetration of HAC/Cas9-hMTH1 nanoparticles into tumor spheroids was just limited to the outer few cell layers of the spheroids. Interestingly, PF33/Cas9-hMTH1 nanoparticles also showed strong penetration ability though weaker than that of RRPHC/Cas9-hMTH1 nanoparticles. This probably attributed to the enhanced affinity of fluorinated polymers to cell membrane. 103


Article

ACS Nano

Figure 10. Analysis of in vivo tumor targeting efficacy of RRPHC artificial virus. (A) In vivo fluorescence imaging of the nude mice bearing subcutaneous xenograft tumor of SKOV3 cells at 2, 6, 12, and 24 h after intravenous injection of HAC/Cas9-hMTH1 or RRPHC/Cas9hMTH1. (B) Ex vivo fluorescence imaging of the tumors and normal tissues harvested from the nude mice bearing subcutaneous xenograft tumor at 2, 6, 12, and 24 h. (C) Ex vivo fluorescence imaging of the tumors and normal tissues harvested from the nude mice bearing peritoneal metastasis of SKOV3 cells after intraperitoneal injection of HAC/Cas9-hMTH1 or RRPHC/Cas9-hMTH1 at 2 and 12 h. (D) Region-of-interest analysis of fluorescent signals from the tumors excised from the nude mice bearing subcutaneous xenograft tumor of SKOV3 cells at 2, 6, 12, and 24 h. (E) Region-of-interest analysis of fluorescent signals from the tumors excised from the nude mice bearing peritoneal metastasis of SKOV3 cells at 4 and 12 h.

indeed associated with a disruption in the expression of MTH1 in tumor tissues, the tumors were excised for ex vivo IHC analysis after the completion of experiment. As shown in Figure 12F, the expression of MTH1 protein was significantly inhibited after Cas9-hMTH1 treatment. Additionally, we also assessed the proliferation and apoptosis of tumor cells after treatment (Figure 12F). A significant decrease in Ki-67-positive tumor cells (brown) in tumor tissues was seen upon treatment with RRPHC/Cas9-hMTH1 or HAC/Cas9-hMTH1 nanoparticles. RRPHC/Cas9-hMTH1 was more effective in preventing tumor cell proliferation with less Ki-67-positive tumor cells, compared with HAC/Cas9hMTH1, probably attributed to its excellent multitargeting ability and higher transfection efficiency. Consistent with the result of Ki-67 assay, the apoptosis detection using TUNEL assay also confirmed that treatment with RRPHC/Cas9hMTH1 induced the strongest apoptosis effect in tumor cells. Safety Evaluation. Finally, a complete blood count (CBC) test, blood chemistry profile analysis, and histological analysis of organs were carried out after treatment for the safety evaluation (Figures S10 and S11). All indexes of CBC test and blood

compared with that of HAC/Cas9-hMTH1 nanoparticles treatment (Figure 10C,E). In Vivo Gene Disruption Potency of the RRPHC Artificial Virus. Inspired by the performance of the RRPHC/Cas9-hMTH1 nanoparticles in cell culture, we further explored the gene disruption potency of RRPHC/Cas9hMTH1 nanoparticles in vivo. Since the background expression is crucial for gene disruption, we investigated the MTH1 expression level of cancer samples collected from patients suffering from ovarian cancer. As presented in Figure 11, a strong expression of MTH1 protein was detected in most of the ovarian cancer tissues, implying that targeted disruption of MTH1 gene by the Cas9-hMTH1 system is feasible in ovarian cancer. We then generated a peritoneal metastasis model of SKOV3 cells as previously described. As expected, Cas9hMTH1 treatment (HAC/Cas9-hMTH1, RRPHC/Cas9hMTH1) possessed better antitumor efficacy than Cas9-null (HAC/Cas9-null, RRPHC/Cas9-null) treatment, suggesting that the improved efficacy may be a result from the targeted disruption of MTH1 (Figure 12). To further evaluate whether the retarded tumor growth by Cas9-hMTH1 treatment was 104


Article

ACS Nano

Figure 11. Analysis the expression level of MTH1 protein in ovarian cancer samples collected from patients. Positive MTH1 staining was cytoplasmic; the number of positive cells and the intensity of staining were classified using a semiquantitative system developed by Allred et al.

chemistry profile analysis were in normal range, and no significant difference was observed among all treatment groups. Meanwhile, there was no evidence of abnormal and inflammatory cell infiltration in normal organs (heart, liver, spleen, lung, and kidney) after treatment. Next, we studied if RRPHC/Cas9-hMTH1 nanoparticles can induce gene editing in normal tissues, including liver, kidney, spleen, and intestine. Owing to the significant difference of genome sequence between murine and human, we analyzed the mutation frequency of several potential targets of sgRNA3 in a mouse genome by deep sequencing. We found that mutation frequencies were below 0.4% at all three potential target sites in liver, kidney, spleen, and intestine. Moreover, no insertions or deletions were located around the sgRNA3 target site, and almost all the mutations were a single nucleotide base substitution, which were probably caused by the error of deep sequencing. We next constructed a Cas9 plasmid with a previously qualified sgRNA targeting mouse Rosa 26 gene (Cas9-mRosa 26) to further examine the level of gene disruption in normal tissues.50 As presented in Figure 13, the mutation frequencies of mRosa 26 sites in liver, kidney, spleen, and intestine after RRPHC/Cas9-mRosa 26 treatment were within 0.4%. Similar to RRPHC/Cas9-hMTH1 treatment, RRPHC/Cas9-mRosa 26 did not induce any insertions or deletions located around the mRosa 26 cleavage site, and almost all the mutations detected were a single nucleotide base

substitution. All of these results demonstrated that the RRPHC artificial virus was a safe nanocarrier for the CRISPR-Cas9 system in in vivo application.

CONCLUSIONS In summary, we have developed a delivery system to achieve targeted and effective genome editing with CRISPR-Cas9 in vivo. CRISPR-Cas9 plasmids were compacted by PF33 to form a nanoscale core, which was further shielded by RRPH to form the RRPHC artificial virus. PF33 endowed the artificial virus with enhanced endosomal escape and ultrahigh transfection efficiency, while the RRPH shell endowed the artificial virus with stability, multiple targeting, and depth penetration ability. The RRPHC artificial virus exhibited a transfection efficiency of >90% in SKOV3 cells and mediated effective disruption of MTH1 when delivered with a Cas9-MTH1 plasmid, which largely surpassed that of Lipofectamine 3000. When applied to deliver the CRISPR-Cas9 system in vivo, the RRPHC artificial virus also induced targeted disruption of MTH1and significantly inhibited the tumor growth. Recently, the cell-penetrating peptide-based nanoparticles were applied to the delivery of Cas9 protein and sgRNA.51 The cell-penetrating peptide was conjugated with Cas9 protein by a thioether bond, whereas the sgRNA was complexed with the cell-penetrating peptide. They formed condensed, positively charged nanoparticles and lead to efficient genome disruptions 105


Article

ACS Nano

Figure 12. In vivo gene disruption potency evaluation. (A, B) Representative photographs of abdominal metastatic nodes (arrows) in each treatment group. (C−E) Tumor nodules (C), tumor weights (D), and ascites (E) after treatment with different formulations. (F) IHC analyses of the expression of MTH1, Ki-67, and TUNEL in tumor sections of different treatment groups.

293, HCT 116, SW 480, B16F10 cells and so on). Thus, we hypothesize that PF33 may be a versatile polymer which could be applied to deliver a series of CRISPR-Cas9 systems to the corresponding cells in the future. Additionally, due to the simplicity to construct the RRPH shell, other types of cell/ tissue-specific targeting ligands can be conjugated to the shell to achieve targeted delivery of CRISPR-Cas9 systems to other cells/tissues easily. Meanwhile, we hypothesize that the RRPHC artificial virus could also be used to incorporate Cas9/sgRNA nuclease complexes for targeted genome editing, due to the similarity of delivery systems between plasmid and protein. Future study will focus on validating the feasibility of this artificial virus to deliver other CRISPR-Cas9 systems and functional DNA-binding proteins (Cas9/sgRNA complex, zincfinger nucleases, and TALE nucleases, transcription factors) to expand its applications.

in HEK-293 cells, HeLa cells, and embryonic carcinoma cells. Meanwhile, cationic lipid nucleic acid transfection reagents were also introduced to deliver Cas9/sgRNA nuclease complexes in another study and resulted in effective genome modification in vitro and in vivo.52 Additionally, nonviral nanoparticles termed as “7C1” were also utilized for the delivery of the CRISPR-Cas9-based genome editing system by Platt et al. Cre-dependent and constitutive Cas9-expressing mice were generated. In their study, 7C1 nanoparticle-mediated sgRNA delivery could effectively mutate genes in pulmonary and cardiovascular endothelium.53 More recently, microfluidic membrane deformation method was also applied to deliver sgRNA and Cas9 and achieved successful genome editing.54 Meanwhile, self-assembled DNA nanoclews mediated efficient delivery of the Cas9/sgRNA complex for genome editing in another study.55 All of the above studies were based on Cas9 protein and sgRNA. There is no study to date concerned with the delivery of CRISPR-Cas9 plasmid, except for viral vectors. To the best of our knowledge, our RRPHC artificial virus is a preferred example of polymeric nanoparticles for the efficient in vivo delivery of the CRISPR-Cas9 plasmid. In our preliminary study, PF33 achieved excellent gene transfection efficacy in many types of cell lines (such as HEK-

MATERIALS AND METHODS Materials. Sodium hyaluronate (HA, 35 kDa) was purchased from Shandong Freda Biochem Co., Ltd. (Shandong, China). MaleimidePEG2000-NH2 was obtained from JenKem Technology Co., Ltd. (Beijing, China). R8-RGD peptides with a terminal cysteine [CysRRRRRRRR-c(RGDfK), cysteine modified octa-arginine conjugated 106


Article

ACS Nano

Figure 13. Mutation frequencies of off-target sites (mMTH1, mOFF1, mOFF2) and mRosa 26-target sites by deep sequencing. Each value was determined from a single deep-sequencing library prepared from genomic DNA pooled from three mice. purified PCR product was denatured and reannealed in 2 μL of NEB buffer 2 (10×) using the following protocol: 95 °C, 5 min; 95−85 °C, −2 °C/s; 85−25 °C, −0.1 °C/s; then held at 4 °C. Then 1 μL of T7EI Endonuclease I (M0302S) was added to the annealed PCR products and incubated at 37 °C for 15 min. Products were finally analyzed on 2.0% agarose gels and imaged with a Gel Doc gel imaging system (BioRad). PCR products with mutations indicated by T7E1 assay were subjected to DNA sequencing and then subcloned into T-clone vector pMD19-T (Takara). Colonies were picked up randomly and further analyzed by DNA sequencing. Synthesis of Fluorinated Polymers (PFs). PEI 1.8K and heptafluorobutyric anhydride were codissolved at different molar ratios (0.5:1, 0.4:1, 0.3:1 0.2:1, 0.1:1, 0.05:1, respectively) in methanol. Triethylamine was added to the mixtures. The mixtures were stirred at room temperature for 48 h and dialyzed against double-distilled water. The obtained products were lyophilized as white powders and confirmed by 19F-NMR and FTIR. To determine the number of heptafluorobutyric acid modified on PEI 1.8K, the ninhydrin assay was used to measure the remaining primary amine groups on each PF. Briefly, 170 mg ninhydrin and 30 mg hydrindantin were dissolved in 20 mL 2-methoxyethanol, and 50 μL of this solution was mixed with 50 μL sodium acetate buffer (0.2 M, pH = 5.4). 50 μL of PEI 1.8K and PFs with different concentrations was added into the above mixtures, followed by incubation in boiling water for 10 min. After cooling to room temperature, 150 μL of ethanol/water (v/v = 60:40) solution was added to the mixtures. The absorbance of the samples was measured at 570 nm. The calibration curve was made according to the PEI 1.8K concentration and the absorbance. The numbers of fluorinated groups modified on each sample were determined by the calibration curve (Abs = 0.2879C + 0.0955, = 0.9954, Abs is the absorbance at 570 nm, and C is the concentration of primary amine groups, mM). Each sample was conducted in three repeats. The numbers of fluorinated groups modified on each PEI 1.8K were calculated based on the formula (X = (16 − 1.8 × C)/(0.196 × C + 1), where X is the number of fluorinated groups modified on PEI 1.8K, and C is the concentration of primary amine groups, mM), as listed in Table 1. Synthesis of RRPH. HA (84.6 mg), EDCI (4.6 mg), and NHS (2.8 mg) were dissolved in 30 mL of MES buffer (pH, 6.5) to activate

to the branch of lysine] were provided by Chinapeptides Co. Ltd. (Shanghai, China). PEI 25K and PEI 1.8K were purchased from Sigma-aldrich and Alfa Aesar, respectively. YOYO-1, TOTO-3, LysoTracker red, Hoechst 33342, Lipofectamine 2000, and Lipofectamine 3000 transfection reagents were purchased from Invitrogen (U.S.A.). All other chemicals were purchased from Sigma-Aldrich (China) and used without further purification. Annexin V/PI apoptosis detection kit was obtained from Nanjing KeyGen Biotech. Co., Ltd. (Nanjing, China). Horseradish peroxidase (HRP)-labeled goat antirabbit or antimouse secondary antibodies were provided by Cell Signaling Technology (CST, Beverly, MA), while anti-MTH1 antibody was obtained from Abcam (Cambridge, MA). Procedures for Generating sgRNAs Expressing Vector. CRISPR-Cas9 target sites were designed with ZIFIT Targeter (http://zifit.partners.org/zifit/Introduction.aspx). Four pairs (sgRNA1, sgRNA2, sgRNA3, sgRNA4) of oligos of two complementary 24 bp oligonucleotides with a 20 bp target sequence were annealed to generate double-strand DNA (dsDNA) with 4 bp overhangs on both ends and ligated to the BbsI-predigested pX330 plasmid for generating the sgRNAs expressing vectors. T7EI Cleavage Assay and Sequencing. In our preliminary experiment, we used Lipofectamine 2000 to validate the gene disruption potency of Cas9-hMTH1 plasmid in SKOV3 cells. Briefly, cells were seeded into 6-well plates at a density of 2 × 105 cells/well for 24 h. Thereafter, the medium was replaced with 800 μL of OptiMEM medium. Both 5 μL of Lipofectamine 2000 and 2 μg of Cas9hMTH1 plasmid were diluted in 50 μL Opti-MEM Medium, respectively. After 5 min incubation, the diluted DNA and diluted Lipofectamine 2000 were combined, mixed gently, and incubated for another 20 min at room temperature. Subsequently, the formed lipoplexes were added to each well and mixed gently. The medium was replaced with 2 mL DMEM containing 10% serum after 5 h incubation. After another 72 h, the transfected cells were collected, and genomic DNA was extracted. Genomic regions flanking the 4 target sites were amplified by the corresponding primers (F1: CCTTTCAGAACCCAGGGACC, R1: CCTGCTCCAGGTCACTTAGC; F2: GTCACTGGTACACAGAGGGC, R2: ACTCAGAGATGGTTTGGGCG). T7EI cleavage assays were conducted according to the manufacturer’s instructions. In brief, 200 ng of 107


Article

ACS Nano carboxyl groups in HA for 2 h. Then Maleimide-PEG2000-NH2 (80 mg) was added, and the solution was allowed to react for another 24 h and dialyzed against distilled water. Subsequently, R8-RGD (7.84 mg) dissolved in deionized water was added to the dialyzed solution and further reacted for another 48 h. The product (RRPH) was dialyzed, followed by lyophilization. The product was further characterized by 1 H NMR and FTIR. Preparation and Characterization of RRPHC Artificial Virus. Twenty μg of PF33 and 2 μg of Cas9-hMTH1 plasmid were mixed gently and incubated for 25 min to form the PF33/Cas9-hMTH1 nanoparticles. Then a certain volume of RRPH (60 μg) or HA (60 μg) was added and incubated for another 20 min to form RRPHC/Cas9hMTH1 or HAC/Cas9-hMTH1 nanoparticles, respectively. The size distribution and zeta potential of the prepared nanoparticles were measured by dynamic light scattering (DLS) measurements ((Malvern, Zetasizer NanoZS ZEN 3600, U.K.). The morphologies were observed by TEM (JEOL JEM-100CX, Japan). The gel retardation assays were performed as follows: PF33/Cas9hMTH1 nanoparticles were prepared at mass ratios of 0.25:1, 0.5:1, 1:1, 2:1, 4:1, 8:1 (PF33:Cas9-hMTH1 plasmid). Then the nanoparticles were diluted with PBS, adjusted to equal concentration, loaded onto 1% (w/v) agarose gel in tris-acetate-EDTA (TAE) buffer, and ran at 120 V for about 40 min. DNA retardation was then visualized by a UV illuminator with a Gel Doc System (Bio-Rad). In Vitro Cytotoxicity analysis. The cytotoxicity of PF26, PF33 and RRPH was evaluated in HEK-293 and SKOV3 cells by 3-(4, 5dimethylthiazol-2-yl)-2,5-diphenyl tetrazolium bromide (MTT) assays and compared with that of PEI 25K and PEI 1.8K. Briefly, both cells were seeded into 96-well plates (4000 cells/well) and incubated for 24 h. Then PEI 25K, PEI 1.8K, PF26, PF33, and RRPH in a series of concentrations (ranging from 0 to 200 μg/mL) were added and incubated with the cells for another 48 h. Finally, 20 μL of MTT (5 mg/mL) was added to each well and incubated for 4 h at 37 °C. The precipitated formazan was dissolved in 150 μL DMSO, and the absorbance at 570 nm was measured. All experiments were performed three times. Data are expressed as means ± standard deviations (SD) of the measured absorbance normalized to the absorbance of nontreated cells in plain medium. Cellular Uptake and Endosomal Escape. The expression level of CD44 in SKOV3 cells was determined by flow cytometry. Briefly, cells were collected, washed, and incubated with FITC-conjugated anti-CD44 antibody on ice for another 30 min. Then, cells were washed and analyzed by flow cytometry (BD Calibur). FITCconjugated IgG 2a antibody was performed as an isotype control. In the cellular uptake analysis, Cas9-hMTH1 plasmids were labeled with YOYO-1 based on the manufacturer’s instruction. SKOV3 cells were plated in 6-well plate (2 × 105 cells/well). After incubation for 24 h, the cells were treated with the nanoparticles loaded with 2 μg of Cas9-hMTH1 plasmid for another 2 h at 37 °C. Thereafter, the cells were harvested, rinsed with cold PBS, and suspended in PBS for the flow cytometry analysis. In the competitive assay, SKOV3 cells were pre-incubated with 10 mg/mL of free HA or/and 25 mM of RGD peptide for 1 h to block the CD44 or/and integrin αvβ3 receptors in the cells. All experiments were performed at least in triplicate. The intracellular distribution of the nanoparticles in SKOV3 cells was examined by confocal fluorescence microscopy (CLSM) (ZEISS, LSM 880, Germany). Cas9-hMTH1 plasmids were labeled with YOYO-1 as described above. SKOV3 cells were seeded in 6-well plate over glass coverslips (2 × 105 cells/well). The nanoparticles loaded with 2 μg of Cas9-hMTH1 plasmid were added into each well. LysoTracker Red probe was used to stain lysosomes and endosomes. At determined time intervals (0.5, 1, 2, 4, 8 h), cells were washed and further stained with Hoechst 33342 for 8 min to stain the nucleus. Thereafter, cells were washed and fixed in 4% paraformaldehyde and observed with CLSM. In Vitro Gene Transfection. To determine the transfection efficiency of the above nanoparticles, a plasmid encoding EGFP (pEGFP), which had a similar gene size (∼10 Kb) with the Cas9hMTH1 plasmid, was chose as a reporter gene for the gene transfection experiment. The transfection efficiency of the nano-

particles was evaluated in HEK-293 cells and SKOV3 cells. Briefly, cells were seeded into 6-well plates (2 × 105 cells/well). Thereafter, the culture medium was replaced with fresh medium (containing 0− 30% serum based on the purpose). The nanoparticles loaded with 2 μg of pEGFP were added to each well and incubated for 5 h. Then the medium was replaced with 2 mL fresh medium containing 10% serum. The cells were further incubated at 37 °C for another 24 or 48 h. PEI 25K, PEI 1.8K, Lipofetamine 2000, and Lipofetamine 3000 at their optimal conditions were used as controls. At the end of experiment, the cells were rinsed with PBS. The images of GFP expression were analyzed by an fluorescence microscope (Olympus, Japan). The transfection efficiency was quantified by flow cytometry (Calibur, BD, U.S.A.). All of these transfections were performed in triplicate. qPCR Analysis for Identifying Mutations. To compare the gene disruption efficiency of RRPHC/Cas9-hMTH1 nanoparticles and Lipofetamine 3000/Cas9-hMTH1 polyplexes, the transfection experiment was conducted with SKOV3 cells by a similar procedure to the transfection of pEGFP. The cells were harvested 3 days after transfection. Genomic DNAs from the pooled triplicate samples were amplified by F2 and R2 primers for DNA sequencing. Meanwhile, these PCR products were quantified to equal amounts of qPCR using a protocol described by Yu et al. We designed two pairs of primers for the targeted site. F2 and R2 could prime outside the double strand breaks, while the latter primer flankF(CAGGAGGAGAGCGGTCTGAC), R2, flanked the double strand breaks at the 3′ of most nucleotides. The newly introduced mutations would disrupt the amplification of flankF, R2, but not affect that of F2, R2. The qPCR was performed as following: 95 °C, 5 s; 57 °C, 30 s; 72 °C, 30 s. All experiments were performed in triplicate. Furthermore, we applied deep sequencing to quantify indel mutations frequency after RRPHC/Cas9-hMTH1 nanoparticles transfection. Briefly, locus-specific primers (F3: GATCAGGAGCCTCTCAACCAAAATCAGT; R3: TAGCTTAGGAGATGGGACCCGCATA) were designed to flank MTH1 to produce PCR products ∼400 bp in length. Genomic DNAs from the pooled triplicate samples were used as templates. PCR products were amplified, purified, quantified, and then subjected to deep sequencing using illumina Hiseq 2500 PE250 (China Novogene Bioinformatics Technology Co. Ltd.). Additionally, to further determine the ratio of frame-shift mutation and in-frame mutation after gene disruption of MTH1, we ligated annealed products of sgRNA3 to the pX459 vector with a puromycin resistance cassette to construct the pX459-Cas9-hMTH1 plasmid. We transfected 2 × 105 SKOV3 cells with RRPHC/pX459-Cas9hMTH1nanoparticles (2 μg of pX459-Cas9-hMTH plasmid), and puromycin was added 20 h after transfection. Three days posttransfection, genomic DNAs, the pooled triplicate samples were purified and amplified by F2 and R2 primers for Sanger sequencing or by F4 and R4 primers (F4: GGCTACGAGCCTCTCAACCAAAATCAGT;R4:CTTGTAAGGAGATGGGACCCGCATA) for deep sequencing. Meanwhile, 3 days post-transfection, the transfected cells were sorted to obtain single cell clones. Then the genomic DNAs of the single cell clones were extracted and amplified by F2 and R2 primers for Sanger sequencing. In Vitro Apoptosis and Proliferation Analysis. After transfected with RRPHC/Cas9-hMTH1 nanoparticles for 72 h, the cells were collected and analyzed by Annexin V/PI and EdU detection kit. All experiments were performed at least in triplicate. In Western blotting analysis, the cells were collected, washed with cold PBS, and suspended in 100 μL of RIPA lysis buffer supplemented with a cocktail. After incubated on ice for 1 h, the cell lysates were centrifuged for 15 min at 12,000 g. BCA protein assay kits were used to determine the concentration of proteins. Then, total protein (∼30 μg) was separated using 15% SDS-PAGE gel and transferred to PVDF membranes. The PVDF membranes were blocked in 5% nonfat milk for 2 h at RT, followed by incubation with antibodies against MTH1 at 4 °C overnight. Subsequently, the PVDF membranes were washed with TBST buffer (Tris-buffered saline Tween) and incubated with HRP-conjugated secondary antibodies in 5% nonfat milk for 45 min at 37 °C. Then PVDF membranes were washed with TBST three times and analyzed with a chemiluminescence (ECL) detection system. 108


Article

ACS Nano

Significant differences between groups were indicated by *p < 0.05, **p < 0.01, and ***p < 0.001, respectively.

Penetration into 3D Tumor Spheroids. The 3D tumor spheroids of HEK-293 were established as previously described. Briefly, cells (5 × 103 per well) were plated I 96-well plates precoated with 60 μL of 2% low melting point agarose. After 5 days incubation, the appropriate tumor spheroids were selected and treated with the above nanoparticles loaded with 2 μg of YOYO-1 labeled Cas9hMTH1 plasmid for 4 h. Then, tumor spheroids were washed and fixed with 4% paraformaldehyde. The permeability of different nanoparticles into tumor spheroids was investigated by CLSM (Leica, Germany). In Vivo Distribution and Imaging. The female BALB/c nude mice (16−18 g) were received from the Vital Laboratory Animal Center (Beijing, China). All animals experiments were carried out in accordance with the Guide for Care and Use of Laboratory Animals, approved by the Ethics Committee of Sichuan University (Chengdu, P. R. China). The subcutaneous xenograft tumor model was generated by subcutaneous injection of SKOV3 cells (1 × 107 cells for each mouse) in the right flank of the BALB/c nude mice, while the peritoneal metastasis model was established by intraperitoneal injection of SKOV3 cells (1 × 107 cells for each mouse). To investigate the in vivo distribution and tumor targeting ability of RRPHC/Cas9-hMTH1 nanoparticles, in vivo imaging experiments were performed. TOTO-3 was used to label the Cas9-hMTH1 plasmid. In the subcutaneous xenograft tumor model, when the tumor size reached 40−500 mm3, RRPHC/Cas9-hMTH1 or HAC/Cas9hMTH1 nanoparticles loaded with 5 μg of Cas9-hMTH1 plasmid were intravenously administered. Images were taken by IVIS Lumina imaging system (Caliper, U.S.A.) at 2, 6, 12, and 24 h post-injection. In the peritoneal metastasis model, RRPHC/Cas9-hMTH1 or HAC/ Cas9-hMTH1 nanoparticles loaded with 5 μg of Cas9-hMTH1 plasmid were intraperitoneally injected at 20 days after inoculation. Images were taken at 4 and 12 h post-injection. After completion of the in vivo imaging, the mice were sacrificed. The tumors as well as major organs including heart, liver, spleen, lung, and kidney were collected and subjected for ex vivo imaging. In Vivo Gene Disruption Potency. The peritoneal metastasis model of SKOV3 cells was established as described above. Treatment began 7 days after inoculation. Mice were randomly allocated into six groups and intraperitoneally administered with Control, RRPH (150 μg), HAC/Cas9-null, RRPHC/Cas9-null, HAC/Cas9-hMTH1, and RRPHC/Cas9-hMTH1 once every 3 days, respectively. The dosage of plasmid of each injection was 5 μg per mouse. Treatment completed when the mice in the PBS group became moribund (at day 30). The blood was collected for CBC test and blood chemistry profile analysis. The tumors were harvested, weighed, and fixed with 4% paraformaldehyde for further IHC analysis. The organs, including heart, liver, spleen, lung, and kidney, were also fixed in 4% paraformaldehyde for further hematoxylin and eosin (H&E) staining. To examine potential off-target effects in other organs, we identified three potential off-target sites (mMTH1, mOFF1, mOFF2) in the mouse genome for hMTH1 (sgRNA3). Off-target loci and corresponding primers are listed in Supplementary Table 1. Genomic DNAs from the liver, kidney, spleen, and intestine were used as templates for PCR. PCR products for each off-target locus were amplified from each of the pooled triplicate samples (n = 3), purified, quantified, and then pooled together in equal quantities for deep sequencing with illumina Hiseq 2500 PE250 (China Novogene Bioinformatics Technology Co. Ltd.). Additionally, to further examine the level of gene disruption in other normal tissues, we constructed the Cas9-mRosa 26 plasmid, which induced targeted disruption of mRosa 26 gene in murine. BALB/c mice were intraperitoneally administered with RRPHC/Cas9-mRosa 26 nanoparticles once every 3 days. At day 30, the mice were sacrificed, and genomic DNAs from the liver, kidney, spleen, and intestine were extracted. mRosa 26 gene was amplified using primers listed Supplementary Table 1. PCR products were amplified from pooled triplicate samples (n = 3), purified, quantified, and then subjected to deep sequencing with illumina Hiseq 2500 PE250 (China Novogene Bioinformatics Technology Co. Ltd.). Statistical Analysis. All data are expressed as means ± standard deviations (SD). Statistic analysis was performed by one-way ANOVA.

ASSOCIATED CONTENT

S Supporting Information *

The Supporting Information is available free of charge on the ACS Publications website at DOI: 10.1021/acsnano.6b04261. Supplementary Table 1 and Figures S1−S11 (PDF)

AUTHOR INFORMATION Corresponding Authors

*E-mail: [email protected]. *E-mail: [email protected]. *E-mail: [email protected]. ORCID

Changyang Gong: 0000-0002-2913-0891 Author Contributions §

These authors contributed equally to this work.

Notes

The authors declare no competing financial interest.

ACKNOWLEDGMENTS This work was financially supported by National Young Topnotch Talent Program, National High Technology Research and Development Program of China (2015AA020309), National Natural Science Foundation of China (81372143), and Distinguished Young Scholars of Sichuan University (2015SCU04A42). REFERENCES (1) Barrangou, R.; Fremaux, C.; Deveau, H.; Richards, M.; Boyaval, P.; Moineau, S.; Romero, D.; Horvath, P. CRISPR Provides Acquired Resistance against Viruses in Prokaryotes. Science 2007, 315, 1709− 1712. (2) Horvath, P.; Barrangou, R. CRISPR/Cas, the Immune System of Bacteria and Archaea. Science 2010, 327, 167−170. (3) Wiedenheft, B.; Sternberg, S. H.; Doudna, J. A. RNA-Guided Genetic Silencing Systems in Bacteria and Archaea. Nature 2012, 482, 331−338. (4) Deltcheva, E.; Chylinski, K.; Sharma, C. M.; Gonzales, K.; Chao, Y.; Pirzada, Z. A.; Eckert, M. R.; Vogel, J.; Charpentier, E. CRISPR RNA Maturation by Trans-Encoded Small RNA and Host Factor RNase III. Nature 2011, 471, 602−607. (5) Bikard, D.; Euler, C. W.; Jiang, W.; Nussenzweig, P. M.; Goldberg, G. W.; Duportet, X.; Fischetti, V. A.; Marraffini, L. A. Exploiting CRISPR-Cas Nucleases to Produce Sequence-Specific Antimicrobials. Nat. Biotechnol. 2014, 32, 1146−1150. (6) Wu, Y.; Liang, D.; Wang, Y.; Bai, M.; Tang, W.; Bao, S.; Yan, Z.; Li, D.; Li, J. Correction of a Genetic Disease in Mouse via Use of CRISPR-Cas9. Cell Stem Cell 2013, 13, 659−662. (7) Long, C.; McAnally, J. R.; Shelton, J. M.; Mireault, A. A.; BasselDuby, R.; Olson, E. N. Prevention of Muscular Dystrophy in Mice by CRISPR/Cas9-Mediated Editing of Germline DNA. Science 2014, 345, 1184−1188. (8) Heckl, D.; Kowalczyk, M. S.; Yudovich, D.; Belizaire, R.; Puram, R. V.; McConkey, M. E.; Thielke, A.; Aster, J. C.; Regev, A.; Ebert, B. L. Generation of Mouse Models of Myeloid Malignancy with Combinatorial Genetic Lesions Using CRISPR-Cas9 Genome Editing. Nat. Biotechnol. 2014, 32, 941−946. (9) Belhaj, K.; Chaparro-Garcia, A.; Kamoun, S.; Patron, N. J.; Nekrasov, V. Editing Plant Genomes with CRISPR/Cas9. Curr. Opin. Biotechnol. 2015, 32, 76−84. (10) Yang, D.; Yang, D.; Xu, J.; Zhu, T.; Fan, J.; Lai, L.; Zhang, J.; Chen, Y. E. Effective Gene Targeting in Rabbits Using RNA-Guided Cas9 Nucleases. J. Mol. Cell. Biol. 2014, 6, 97−99. 109


Article

ACS Nano (11) Ma, Y.; Zhang, X.; Shen, B.; Lu, Y.; Chen, W.; Ma, J.; Bai, L.; Huang, X.; Zhang, L. Generating Rats with Conditional Alleles Using CRISPR/Cas9. Cell Res. 2014, 24, 122. (12) Niu, Y.; Shen, B.; Cui, Y.; Chen, Y.; Wang, J.; Wang, L.; Kang, Y.; Zhao, X.; Si, W.; Li, W.; Xiang, A.; Zhou, J.; Guo, X.; Bi, Y.; Si, C.; Hu, B.; Dong, G.; Wang, H.; Zhou, Z.; Li, T.; et al. Generation of Gene-Modified Cynomolgus Monkey via Cas9/RNA-Mediated Gene Targeting in One-Cell Embryos. Cell 2014, 156, 836−843. (13) Ding, Q.; Regan, S. N.; Xia, Y.; Oostrom, L. A.; Cowan, C. A.; Musunuru, K. Enhanced Efficiency of Human Pluripotent Stem Cell Genome Editing through Replacing TALENs with CRISPRs. Cell Stem Cell 2013, 12, 393−394. (14) Fu, Y.; Foden, J. A.; Khayter, C.; Maeder, M. L.; Reyon, D.; Joung, J. K.; Sander, J. D. High-Frequency Off-Target Mutagenesis Induced by CRISPR-Cas Nucleases in Human Cells. Nat. Biotechnol. 2013, 31, 822−826. (15) Mali, P.; Yang, L.; Esvelt, K. M.; Aach, J.; Guell, M.; DiCarlo, J. E.; Norville, J. E.; Church, G. M. RNA-Guided Human Genome Engineering via Cas9. Science 2013, 339, 823−826. (16) Koike-Yusa, H.; Li, Y.; Tan, E.-P.; Velasco-Herrera, M. D. C.; Yusa, K. Genome-Wide Recessive Genetic Screening in Mammalian Cells with a Lentiviral CRISPR-Guide RNA Library. Nat. Biotechnol. 2014, 32, 267−273. (17) Maggio, I.; Holkers, M.; Liu, J.; Janssen, J. M.; Chen, X.; Gonçalves, M. A. Adenoviral Vector Delivery of RNA-Guided CRISPR/Cas9 Nuclease Complexes Induces Targeted Mutagenesis in a Diverse Array of Human Cells. Sci. Rep. 2014, 4, 5105. (18) Senís, E.; Fatouros, C.; Große, S.; Wiedtke, E.; Niopek, D.; Mueller, A. K.; Börner, K.; Grimm, D. CRISPR/Cas9-Mediated Genome Engineering: an Adeno-Associated Viral (AAV) Vector Toolbox. Biotechnol. J. 2014, 9, 1402−1412. (19) Pack, D. W.; Hoffman, A. S.; Pun, S.; Stayton, P. S. Design and Development of Polymers for Gene Delivery. Nat. Rev. Drug Discovery 2005, 4, 581−593. (20) Guo, X.; Huang, L. Recent Advances in Nonviral Vectors for Gene Delivery. Acc. Chem. Res. 2012, 45, 971−979. (21) Mo, R.; Jiang, T.; DiSanto, R.; Tai, W.; Gu, Z. ATP-Triggered Anticancer Drug Delivery. Nat. Commun. 2014, 5, 3364. (22) Choi, K. Y.; Silvestre, O. F.; Huang, X.; Hida, N.; Liu, G.; Ho, D. N.; Lee, S.; Lee, S. W.; Hong, J. I.; Chen, X. A Nanoparticle Formula for Delivering siRNA or miRNAs to Tumor Cells in Cell Culture and In Vivo. Nat. Protoc. 2014, 9, 1900−1915. (23) Cohen, Z. R.; Ramishetti, S.; Peshes-Yaloz, N.; Goldsmith, M.; Wohl, A.; Zibly, Z.; Peer, D. Localized RNAi Therapeutics of Chemoresistant Grade IV Glioma Using Hyaluronan-Grafted LipidBased Nanoparticles. ACS Nano 2015, 9, 1581−1591. (24) Jiang, T.; Mo, R.; Bellotti, A.; Zhou, J.; Gu, Z. Gel-LiposomeMediated Co-Delivery of Anticancer Membrane-Associated Proteins and Small-Molecule Drugs for Enhanced Therapeutic Efficacy. Adv. Funct. Mater. 2014, 24, 2295−2304. (25) Sun, Q.; Kang, Z.; Xue, L.; Shang, Y.; Su, Z.; Sun, H.; Ping, Q.; Mo, R.; Zhang, C. A Collaborative Assembly Strategy for TumorTargeted siRNA Delivery. J. Am. Chem. Soc. 2015, 137, 6000−6010. (26) Qhattal, H. S. S.; Hye, T.; Alali, A.; Liu, X. Hyaluronan Polymer Length, Grafting Density, and Surface Poly (ethylene glycol) Coating Influence In Vivo Circulation and Tumor Targeting of HyaluronanGrafted Liposomes. ACS Nano 2014, 8, 5423−5440. (27) Hatakeyama, H.; Akita, H.; Harashima, H. A Multifunctional Envelope Type Nano Device (MEND) for Gene Delivery to Tumours Based on the EPR Effect: a Strategy for Overcoming the PEG Dilemma. Adv. Drug Delivery Rev. 2011, 63, 152−160. (28) Liu, Y.; Ran, R.; Chen, J.; Kuang, Q.; Tang, J.; Mei, L.; Zhang, Q.; Gao, H.; Zhang, Z.; He, Q. Paclitaxel Loaded Liposomes Decorated with a Multifunctional Tandem Peptide for Glioma Targeting. Biomaterials 2014, 35, 4835−4847. (29) Desgrosellier, J. S.; Cheresh, D. A. Integrins in Cancer: Biological Implications and Therapeutic Opportunities. Nat. Rev. Cancer 2010, 10, 9−22.

(30) Wan, P. T.; Garnett, M. J.; Roe, S. M.; Lee, S.; Niculescu-Duvaz, D.; Good, V. M.; Jones, C. M.; Marshall, C. J.; Springer, C. J.; Barford, D.; Marais, R. Mechanism of Activation of the RAF-ERK Signaling Pathway by Oncogenic Mutations of B-RAF. Cell 2004, 116, 855−867. (31) Halazonetis, T. D.; Gorgoulis, V. G.; Bartek, J. An OncogeneInduced DNA Damage Model for Cancer Development. Science 2008, 319, 1352−1355. (32) Oh, Y.-K.; Park, T. G. siRNA Delivery Systems for Cancer Treatment. Adv. Drug Delivery Rev. 2009, 61, 850−862. (33) Rupaimole, R.; Previs, R.; Lee, J.; Pradeep, S.; Wu, S. Y.; Ivan, C.; Ferracin, M.; Dennison, J.; Rodriguez-Aguayo, C.; Calin, G. A.; Mills, G.; Zhang, W.; Lopez-Berestein, G.; Bhattacharya, P.; Sood, A. K. siRNA Therapy against Novel LncRNA NRCP: Shutting Down the Fuel for Cancer Cells. Cancer Res. 2015, 75, 142−142. (34) Han, L.; Tang, C.; Yin, C. Oral Delivery of shRNA and siRNA via Multifunctional Polymeric Nanoparticles for Synergistic Cancer Therapy. Biomaterials 2014, 35, 4589−4600. (35) Lengyel, E. Ovarian Cancer Development and Metastasis. Am. J. Pathol. 2010, 177, 1053−1064. (36) Oka, S.; Ohno, M.; Tsuchimoto, D.; Sakumi, K.; Furuichi, M.; Nakabeppu, Y. Two Distinct Pathways of Cell Death Triggered by Oxidative Damage to Nuclear and Mitochondrial DNAs. EMBO J. 2008, 27, 421−432. (37) Ichikawa, J.; Tsuchimoto, D.; Oka, S.; Ohno, M.; Furuichi, M.; Sakumi, K.; Nakabeppu, Y. Oxidation of Mitochondrial Deoxynucleotide Pools by Exposure to Sodium Nitroprusside Induces Cell Death. DNA Repair 2008, 7, 418−430. (38) Gad, H.; Koolmeister, T.; Jemth, A. S.; Eshtad, S.; Jacques, S. A.; Ström, C. E.; Svensson, L. M.; Schultz, N.; Lundbäck, T.; Einarsdottir, B. O.; Saleh, A.; Göktürk, C.; Baranczewski, P.; Svensson, R.; Berntsson, R.; Gustafsson, R.; Strömberg, K.; Sanjiv, K.; JacquesCordonnier, M.; Desroses, M.; et al. MTH1 Inhibition Eradicates Cancer by Preventing Sanitation of the dNTP Pool. Nature 2014, 508, 215−221. (39) Huber, K. V.; Salah, E.; Radic, B.; Gridling, M.; Elkins, J. M.; Stukalov, A.; Jemth, A. S.; Göktürk, C.; Sanjiv, K.; Strömberg, K.; Pham, T.; Berglund, U.; Colinge, J.; Bennett, K.; Loizou, J.; Helleday, T.; Knapp, S.; Superti-Furga, G. Stereospecific Targeting of MTH1 by (S)-Crizotinib as an Anticancer Strategy. Nature 2014, 508, 222−227. (40) Gao, W.; Cao, W.; Sun, Y.; Wei, X.; Xu, K.; Zhang, H.; Tang, B. AuNP Flares-Capped Mesoporous Silica Nanoplatform for MTH1 Detection and Inhibition. Biomaterials 2015, 69, 212−221. (41) Wang, M.; Liu, H.; Li, L.; Cheng, Y. A Fluorinated Dendrimer Achieves Excellent Gene Transfection Efficacy at Extremely Low Nitrogen to Phosphorus Ratios. Nat. Commun. 2014, 5, 3053. (42) Yan, H.; Oommen, O. P.; Yu, D.; Hilborn, J.; Qian, H.; Varghese, O. P. Chondroitin Sulfate-Coated DNA-Nanoplexes Enhance Transfection Efficiency by Controlling Plasmid Release from Endosomes: a New Insight into Modulating Nonviral Gene Transfection. Adv. Funct. Mater. 2015, 25, 3907−3915. (43) Kasuya, M. C. Z.; Nakano, S.; Katayama, R.; Hatanaka, K. Evaluation of the Hydrophobicity of Perfluoroalkyl Chains in Amphiphilic Compounds that are Incorporated into Cell Membrane. J. Fluorine Chem. 2011, 132, 202−206. (44) Yu, C.; Zhang, Y.; Yao, S.; Wei, Y. A PCR based Protocol for Detecting Indel Mutations Induced by TALENs and CRISPR/Cas9 in Zebrafish. PLoS One 2014, 9, e98282. (45) Carrington, B.; Varshney, G. K.; Burgess, S. M.; Sood, R. CRISPR-STAT: an Easy and Reliable PCR-Based Method to Evaluate Target-Specific sgRNA Activity. Nucleic Acids Res. 2015, 43, e157. (46) Shah, A. N.; Davey, C. F.; Whitebirch, A. C.; Miller, A. C.; Moens, C. B. Rapid Reverse Genetic Screening Using CRISPR in Zebrafish. Nat. Methods 2015, 12, 535−540. (47) Wang, H.; Wang, Y.; Wang, Y.; Hu, J.; Li, T.; Liu, H.; Zhang, Q.; Cheng, Y. Self-Assembled Fluorodendrimers Combine the Features of Lipid and Polymeric Vectors in Gene Delivery. Angew. Chem., Int. Ed. 2015, 54, 11647−11651. 110


Article

ACS Nano (48) Kunz-Schughart, L. A.; Freyer, J. P.; Hofstaedter, F.; Ebner, R. The Use of 3-D Cultures for High-Throughput Screening: the Multicellular Spheroid Model. J. Biomol. Screening 2004, 9, 273−285. (49) Haycock, J. W. 3D Cell Culture: a Review of Current Approaches and Techniques. In 3D Cell Culture; Haycock, J. W., Ed.; Humana Press: New York, 2011; pp 1−15. (50) Chu, V.; Weber, T.; Wefers, B.; Wurst, W.; Sander, S.; Rajewsky, K.; Kühn, R. Increasing the Efficiency of Homology-Directed Repair for CRISPR-Cas9-Induced Precise Gene Editing in Mammalian Cells. Nat. Biotechnol. 2015, 33, 543−548. (51) Ramakrishna, S.; Kwaku, D. A. B.; Beloor, J.; Gopalappa, R.; Lee, S. K.; Kim, H. Gene Disruption by Cell-Penetrating PeptideMediated Delivery of Cas9 Protein and Guide RNA. Genome Res. 2014, 24, 1020−1027. (52) Zuris, J. A.; Thompson, D. B.; Shu, Y.; Guilinger, J. P.; Bessen, J. L.; Hu, J. H.; Maeder, M. L.; Joung, J. K.; Chen, Z. Y.; Liu, D. R. Cationic Lipid-Mediated Delivery of Proteins Enables Efficient Protein-Based Genome Editing In Vitro and In Vivo. Nat. Biotechnol. 2014, 33, 73−80. (53) Platt, R. J.; Chen, S.; Zhou, Y.; Yim, M. J.; Swiech, L.; Kempton, H. R.; Dahlman, J. E.; Parnas, O.; Eisenhaure, T. M.; Jovanovic, M.; Graham, D. B.; Jhunjhunwala, S.; Heidenreich, M.; Xavier, R. J.; Langer, R.; Anderson, D. G.; Hacohen, N.; Regev, A.; Feng, G.; Sharp, P. A.; et al. CRISPR-Cas9 Knockin Mice for Genome Editing and Cancer Modeling. Cell 2014, 159, 440−455. (54) Han, X.; Liu, Z.; Jo, M. C.; Zhang, K.; Li, Y.; Zeng, Z.; Li, N.; Zu, Y.; Qin, L. CRISPR-Cas9 Delivery to Hard-to-Transfect Cells via Membrane Deformation. Sci. Adv. 2015, 1, e1500454. (55) Sun, W.; Ji, W.; Hall, J. M.; Hu, Q.; Wang, C.; Beisel, C. L.; Gu, Z. Self-Assembled DNA Nanoclews for the Efficient Delivery of CRISPR-Cas9 for Genome Editing. Angew. Chem. 2015, 127, 12197− 12201.

111


Artificial Virus Delivers CRISPR-Cas9 System for Genome Editing of

Recommend Documents