pubs.acs.org/NanoLett
Assembly, Structure and Optical Response of Three-Dimensional Dynamically Tunable Multicomponent Superlattices Huiming Xiong,†,‡ Matthew Y. Sfeir,† and Oleg Gang*,† †
Center for Functional Nanomaterials, Brookhaven National Laboratory, Upton, New York 11973, United States, and Department of Polymer Science and Engineering, School of Chemistry and Chemical Engineering, Shanghai Jiao Tong University, Shanghai 200240, China ‡
ABSTRACT We report the successful fabrication of optically active three-dimensional (3D) superlattices that incorporate DNA-encoded components, metallic nanoparticles, and molecular chromophores in well-defined positions. A DNA linker with three distinct binding sites serves as an assembly agent and dynamically tunable structural element for the superlattice. Using small angle X-ray scattering we have revealed the organization of particle-chromophore 3D arrays and monitored their reversible contractions and expansions that were modulated by ionic strength changes. As the distance between the molecular chromophores and plasmonic nanoparticles in the superlattice was regulated in situ, we were able to uncover the relationship between experimentally determined structure and optical response of the system. This dynamical tunability of superlattice results in a dramatic optical response: nearly a three times change of emission rate of the chromophore. The evolution of lifetime with structural changes reasonably agrees with the calculations based on a cumulitative coupling of chromophores with metallic nanoparticles in different coordination shells. KEYWORDS Assembly, DNA, nanoparticles, plasmonic, fluorescence
M
on feasibility of this approach for assembly of well-defined 3D architectures with controllable lattices and switchable states.24 Since such superlattice exhibits a quite open structure, incorporation of other nanocomponents within the 3D lattice becomes possible. Here, we explore the idea that not only DNA terminuses can specifically bind particles, but also an internal part of DNA linkers can be encoded to provide a site-selective binding for the precise placement of functional components. The approach can potentially allow for a rational fabrication of structurally diverse architectures by choosing encoded sites along DNA linkers using even a relatively simple bodycentered cubic (bcc) superlattice of particles22,23 as 3D scaffold. We demonstrate the realization of this approach for assembly of optically active 3D superlattices that incorporate plasmonic particles (DNA functionalized gold particles, AuNP) and chromophores (fluorescent molecular dye, rhodamine) positioned on the linkers, as shown in Figure 1. By changing the ionic strength of the solution, we can vary the lattice constants and thus tune the optical coupling between the plasmonic particles and chromophores. The combination of in situ small-angle X-ray scattering (SAXS) and time-resolved fluorescent methods revealed a quantitative relationship between the structure change and optical response of the 3D array of particles and chromophores. From an optical standpoint, our studies may shed light on the phenomena related to the collective effects of socalled nanoantennas due to the interaction of chromophores with multiple plasmonic particles in a lattice,25 and the cooperative emission by ensemble of emitters
ethods for integration of nanoscale components of multiple types into well-defined three-dimensional architectures promise a creation of novel optical and magnetic materials, which may exhibit properties not found in the individual components.1-4 However, there are significant challenges for realization of such multicomponent systems, for example, via conventional lithographic methods, which are best suited for planar fabrication. Furthermore, an integration of prefabricated nano-objects is often intricate in a lithographic framework. Although self-assembly approaches have been successfully demonstrated for building nanostructured materials, their ability for rational fabrication of architectures from components of various types is nontrivial due to the complex relationship between the interaction characteristics of individual nano-objects and system phase behavior. Recently, DNA programmability of interactions5-7 emerged as a promising strategy for rational fabrication of various types of nano-objects into clusters8-11 and hierarchical structures.9,12-14 In three-dimensions (3D), a rich phase behavior in mixtures of particles with different DNA encodings and DNA lengths is predicted.15,16 In this case, the structure of assembled 3D aggregate is dictated by the details of interactions between DNA that link particles.17-19 The recent discovery of 3D nanoparticles ordered phase20-23 provided experimental evidence
* To whom correspondence should be addressed. E-mail:
[email protected]. Received for review: 06/29/2010 Published on Web: 09/29/2010 © 2010 American Chemical Society
4456
DOI: 10.1021/nl102273c | Nano Lett. 2010, 10, 4456–4462
FIGURE 1. Schematics of superlattice fabrication and lattice constant tuning. (Top) The fabrication of superlattice of gold nanoparticles (AuNP) with dye molecules incorporated. (i) Preparation of DNA-dye linkers D30 or D70, (ii) assembly of ssDNA functionalized AuNPs into superlattice using linker D30 or D70. Two types of AuNPs A and B were coated with 30 base ssDNAs that have a 15 base outer recognition part and a 15 base poly dT spacer (A ) 5′-ATTGGAAGTGGATAA-(T)15-C3H6-SH; B ) HS-C6H12-(T)15-TAACCTAACCTTCAT-3′). The two ends of linker D30 or D70 (5′-TTATCCACTTCCAAT- and -ATGAAGGTTAGGTTA-3′) are complementary to the respective ends of ssDNAs on AuNP A and B. The central region of the linker has 20-base nucleotides (CAGCTCGTCAGGCTGCGCCA) for binding dye molecules while its rest is poly dT. Fluorescent dye molecule is attached with nucleotides (5′-RhodamineRedTM-TTTTTTGGCGCAGCCTGACGAGCTG-3′) that are complementary to the central region of the linker with a 5-base poly dT spacer. (Bottom) Superlattice contraction and expansion due to change of slat concentrations.
near metallic particles.26 A large body of experimental and theoretical studies in recent years revealed how pairwise interactions between light-emitting and plasmonic elements depend on their spatial arrangements, spectral characteristics, and orientations. At the same time, the lack of flexible and robust platforms for fabrication of 3D model systems has imposed significant challenges for understanding these effects in three dimensions that are relevant for novel optical materials for photovoltaic, computing, and light-emitting applications.2,27 We organize paper in the following way: first, we discuss the assembly process that allows for the formation of 3D multicomponent array. Next, by applying in situ synchrotronbased X-ray scattering we reveal the structure of formed assemblies and demonstrate the ability to tune interparticle distances and monitor structural changes. The structural studies are followed by the fluorescent lifetime imaging microscopy (FLIM) measurement of assembled structures at different interparticle distances, thus probing the influence of plasmonic superlattice on emitting properties of chromophores. Consequently, we determine how the lifetime of emitters is affected by the changes in the lattice constant of plasmonic superlattice and proposed a model that allows for a quantitative explanation of the observed dependence. System fabrication starts from a formation of DNA linkers containing fluorescent dyes at the specifically designed position, followed by assembly of DNA-functionalized nanoparticles into superlattice using the dye-incorporated DNA linkers (Figure 1). Specifically, a ssDNA linker contains 30 © 2010 American Chemical Society
or 70 nucleotides in the internal part (denoted L30 or L70, respectively) and two distinctive ends that complementary to the respective ends of two types of ssDNAs attached to two different gold nanoparticles (denoted A and B). The central 20-base region of the linkers was encoded with a specific sequence to provide a selective binding at this location. We program a positioning of a chromophore on a linker by encoding a dye with a ssDNA strand containing a 20-base complementary part and a 5-base spacer. The dyeincorporated linkers (correspondingly denoted D30 or D70) are formed by mixing ssDNAs L30 or L70 with dyes at equal mole, followed by an incubation process. Theses linkers D30 and D70 were further used to form assemblies of nanoparticles as previously described.21,22 These two types of AuNPs, A and B, were coated with 30 base ssDNAs containing a 15 base outer recognition part.22 Each system was assembled by mixing an equal mole of particles A and B and the linkers at a DNA/particle mole ratio 36:1 (Supporting Information). For comparison, the analogous systems without incorporation of dyes were also examined. We first studied the structure of assemblies and how it is affected by the incorporation of encoded dyes. The hybridization of dye with ssDNA strand results in the formation of 20 base pair (bp) double helix in D30 or D70. Remarkably, SAXS patterns revealed that the system assembled with D30 and D70 linkers exhibited a well-ordered structure (Figure 2, right panel) which contained the bcc unit cell analogous to the previously observed bcc lattice for L30 and L70 systems.21,22 However, the dye-incorporated system D30 or 4457
DOI: 10.1021/nl102273c | Nano Lett. 2010, 10, 4456-–4462
FIGURE 3. The change of interparticle distances with salt concentration. The dependence of nearest neighbor surface-to-surface interparticle distance D on salt concentration for systems with (D30 and D70) and without (L30 and L70) dye incorporation. The long-range order of bcc lattice is preserved for L30 and L70, D30, and it becomes short-range ordered for D70 (see Supporting Information) after change of salt concentration. Error bars are from the uncertainty of lattice constant in repeated experiments of salt concentration changes on the same assemblies.
FIGURE 2. Structural characterization of tunable superlattice. (Left) Representative SAXS patterns and structure factors S(q) of systems D30 and D70 in 0.3 M BPS buffer after assembly. (Right) S(q) for D30 at different salt concentrations, where 001, 005, 01, 02, and 03 correspond to 0.01, 0.05, 0.1, 0.2, and 0.3 M and “-b” indicates repeated measurement after the salt concentration change cycle.
D70 showed a larger surface-to-surface distance (D) for nearest neighbors particles compared to similar systems without dyes, as calculated using D ) (3/2)1/2d110-2R from a spacing (d110) of (110) crystalline planes, where R, the radius of AuNP, is equal to ∼5.8 nm. For example, D for both systems D30 and D70 at 0.3 M phosphate-buffered saline (PBS) is about 3 nm larger than that of the corresponding systems L30 and L70 and it is within the range of 2.5-3 nm for all studied ionic strengths. This increased interparticle distance can be attributed to the formation of a rigid 20 bp dsDNA region, whose averaged orientation and tilt relative to an axis Y connecting particle centers result in an estimated displacement of dye from a chain center of about 1.5 nm for all systems. Although a variety of approaches to regulate the length of DNA motifs was recently demonstrated,11,24,28 the polyelectrolyte nature of a ssDNA chain allows for a convenient way to tune the lattice constant of DNA-mediated assemblies by changing the ionic strength of a buffer solution due to the consequential change of persistence length of ssDNA. Figure 2 (left panel) shows an evolution of structure factor for D30 system due to the change of salt concentration. The distributions of peaks and their relative position remained similar while a shift to lower scattering vector q was observed with increase of salt concentration. This indicates that the order of superlattice is preserved during the process. Remarkably, contraction and expansion of the superlattice are found to be highly reversible in the variance of salt concentration (Figure 2). Figure 3 summarizes the structural changes observed for the studied system. The increase of surface-to-surface distance D by about 30% was observed for systems D30 and D70 when the salt concentration was decreased from 0.3 to 0.01 mM. This allowed for tuning of D in the range of ∼22 to ∼37 nm with overlapping points between © 2010 American Chemical Society
systems D30 and D70. Interestingly, while the order is preserved for D30 under all salt concentrations, for D70 the first disturbance by changing salt concentration resulted in a one-time reduction of a correlation length (Supporting Information, Figure S3). We applied multiphoton fluorescence lifetime imaging microscopy (FLIM) to study the fluorescence lifetime of dyes within the plasmonic superlattice as a function of lattice constant tuning as described above. Figure 4a shows three types of the representative optical measurements of system D70 at different salt concentrations: FLIM images, (left), fluorescence intensity images (middle), and optical transmission micrographs (right). The optical penetration depth of the assembled is estimated on order of micrometers, which is about tens of lattice constants considering the volume fraction (a few percentages) of the AuNPs connected by DNA in the lattice.29 Since the optical penetration depth is comparable or exceeds a lattice correlation length determined by SAXS, the detected signal from dye molecules in the assemblies should be able to represent optical properties of the bulk phase. The fluorescence decay curves, obtained by integration of the whole image, are shown in Figure 4b for system D30 and D70 for various ionic strengths. By relating structural information obtained from SAXS measurements for the systems with corresponding salt concentrations, we have mapped decay curves as a function of average dye-to-thenearest-particle surface distance D/2. First, we have examined the measured fluorescence decay behavior by fitting every pixel of FLIM images with a monoexponential decay function. The representative resolution-corrected histograms of lifetime distribution for system D30 and D70 at different ionic strength are shown in Figure 4c. The histograms reveal 4458
DOI: 10.1021/nl102273c | Nano Lett. 2010, 10, 4456-–4462
FIGURE 4. Optical response of expanded and contracted superlattices. (a) Representative fluorescent lifetime images (on the left) excited by a two-photon laser at 495 nm, fluorescent emission images (in the middle) exited by an argon laser at 514 nm and optical transmission images through a white light (on the right) of assemblies D70 at different ionic strengths: 0.01 M (A), 0.05 M (B), 0.1M(C), 0.2M(D), 0.3M(E) of PBS buffer and consequent adjustment back to 0.05 M (F). The images were acquired by a scanning confocal microscopy with a laser beam focused on a sample area of aggregate, a few tens of micrometers above a coverslide, which results in a visually smaller appearance of a sample on fluorescent image compared to a corresponding optical transmission. The scales of diagrams are 100 µm × 100 µm. The resolution is 256 pixels ×256 pixels. (b) Lifetime decay curves for free dye in 0.3 M PBS buffer and dye in AuNP assemblies in different systems at different ionic strength (red diamond) free dye; (teal circle) D70 at 0.01 M PBS; (blue triangle pointing down) D70 at 0.05 M PBS; (pink triangle pointing up) repeated D70 at 0.05 M PBS; (sage square) D70 at 0.2 M PBS; (aqua open diamond) D30 at 0.01 M PBS; (maroon open circle) D30 at 0.1 M PBS; (maroon open square) D30 at 0.3 M PBS. (c) Representive histograms of lifetime distribution of dye in system D30 and D70 at different ionic strengths (the same symbols as plot b).
a certain degree of lifetime distribution, whose width may reflect positional and orientational uncertainty of molecular dyes in the plasmonic field of AuNPs in bcc packing. Compared to the lifetime of dyes of free D30 or D70 linkers in a solution, τ0 ∼ 2.5 ns, which is salt concentration independent, dyes in a superlattice exhibit significantly shorter lifetimes, τ. Their peak position monotonically shifts from 1.6 to 0.4 ns with increase of salt concentration from 0.01 to 0.3 M. The obtained lifetime evolution is fully reversible upon the change of ionic strength. We summarize the dependence of normalized fluorescent lifetime (τ/τ0) on D/2 in Figure 5a. A monotonic decrease of τ/τ0 is observed for both systems D30 and D70 with an overlapping data region. A minimum of τ/τ0 ∼ 1/5 is found at 11 nm. We note that for an individual system, the lifetime of the chromophores within it is reduced by a factor of ∼2. Interestingly, the essential features of the observed optical behavior can be well captured using a model in which only cross-species electromagnetic interaction between individual components is considered and angular dependence of the interaction with linearly polarized excitation is ignored © 2010 American Chemical Society
(Supporting Information). In this “linear” model, we approximate the lifetime response of a chromophore by accounting for the distance dependent optical coupling between the chromophore and metallic nanoparticles in the different coordination shells; this approach provides reasonable agreement with exact calculations by Govorov et. al25 (Figure 5b and Supporting Information). To investigate inhomogeneous broadening resulting from averaging over randomly oriented domains, we collectively turn on and off the contribution from the near-field radiative enhancement. This treatment is meant to approximate the optical response of two limiting cases, that is, the electric field vector being polarized perpendicular and parallel to the particle-dye axis Y. For perpendicular polarization case, our model considers only the quenching effect of metal nanoparticles in the form of Fo¨rster near-field energy transfer (Supporting Information). A contribution from each metallic nanoparticles in a coordination shell is accounted by scaling Fo¨rster rate linearly with a number of particles near a chromophore.24 Thus, by taking into account experimentally determined 4459
DOI: 10.1021/nl102273c | Nano Lett. 2010, 10, 4456-–4462
FIGURE 5. Experimental and calculated fluorescent lifetimes for tuned superlattices. (a) Dependence of a normalized fluorescent lifetime τ/τ0 of dyes in systems (9) D70 and (0) D30 on average dye-to-particle surface distance D/2. Error bars are obtained from widths at the half height of the measured lifetime profiles shown on Figure 4c. Blue and red lines correspond to calculations of light with perpendicular and parallel polarizations relative to a dye-particle axis Y as discussed in the text. (b) The position of individual dye in the real-space indexed lattice (top). The linear model (bottom) accounts for the number of metallic particles in coordination shells of dye and dye-to-particle surface distance and ignores polarization angle dependence. The dye-to-particle surface distance from different coordination shells is calculated based on SAXS measured lattice constant. The real-space position of a dye is indexed as [111], and those of nanoparticles in different coordination shells (CS) are located at the following: 1st CS, [000], [222]; 2nd CS, [004], [040], [400], [22-2], [2-22], [-222]; 3rd CS, [044], [404], [440], [2-2-2], [-22-2], [-2-22]; 4th CS, [0-40], [00-4], [-400], [-2-2-2], [444]; and 5th CS, [0-44], [04-4], [-404], [-440], [40-4], [4-40].
parameters, that is, the number of plasmonic particles in each coordination shell, their distances from a dye and the particle diameter, we have calculated a normalized total lifetime for the perpendicular polarization (Supporting Information) considering up to five coordination shells, as shown in Figure 5a (blue line). Specifically, to estimate the distance between chromophore and particles from each of coordination shells we used structural information obtained from SAXS measurements as discussed above. Real-space arrangement of particles around chromophore the bcc lattice of AuNP is shown in Figure 5b. We calculated the chromophore-particle distances (Supporting Information Table S1) based on the indexing of the positions of each component using real-space coordinates [ax, ay, az] (see Figure 5 and figure caption) and by accounting for the ∼1.5 nm displacement of a chromophore from the center of interparticle linker. Considering similar structural arrangements, the calculation of an electromagnetic field parallel to Y (Figure 5a red line) accounts for a further shortening of the total lifetime that is caused by additional near-field enhancement of the radiative rate. Its contribution is more significant at longer separations than the quenching decay term due to weaker distance dependence compared to Fo¨rster process. The obtained estimated lifetime dependence of the chromophore on distance to the particle surface for both polarizations is directly based on experimentally measured structural parameters of the system. Our calculations approximate the upper and lower bounds for the spatially averaged luminescence decays. The obtained dependence describes the observed behavior remarkably well, given a relative simplicity of our model and an absence of any fit parameters in our calculation procedure. Meanwhile, we point out that a relatively small variation in a dye-to-particle distance could © 2010 American Chemical Society
noticeably impact a distribution of lifetimes in this geometry. For example, the positional uncertainty of a chromophore on an order of 1.5 nm at D/2 ∼ 18 nm can be translated into a broadening of lifetime distributions, whose magnitude is comparable with a difference caused by two polarizations. Therefore, we believe that in reality, both factors, polarization effects and positional variation, can contribute to the observed lifetime distribution. Our finding indicates that the optical response of the superlattices is mainly dominated by the interactions of a chromophore with metallic nanoparticles from the closest coordination positions. This may explain the potential insignificance of the long-range system optical responses of dyes within it. Indeed, although D30 and D70 systems exhibit correlation lengths with >20 and 3-4 unit cells, their lifetime responses are similar at D/2 ∼ 14 nm. Our calculations also support this conclusion considering that about 90 and 60% of the decay rates of quenching and radiative terms are determined by the nearest neighbor nanoparticles in bcc lattice, as compared to the 5 coordination spheres treatment. In summary, we have successfully demonstrated an approach of programming an assembly of DNA-encoded components of different types, plasmonic nanoparticles and molecular chromophores, into optically functional superlattices. The tunable structures and dynamical optical responses of the superlattice have been characterized in situ using SAXS and FLIM methods. We show that by regulating the lattice constant, the coupling between the plasmonic fields of spatially arranged metallic nanoparticles and chromophores can be effectively modulated. The observed fluorescence lifetime dependence on superlattice constant agrees well with the calculation by accounting for the cumulative influence of particles from different coordination 4460
DOI: 10.1021/nl102273c | Nano Lett. 2010, 10, 4456-–4462
positions, where experimentally determined parameters were input. Our work demonstrates a novel approach for the fabrication and investigation of optically active nanostructures, which may find applications in light harvesting, optical nanocircuits, and biodetection.
obtained by azimuthal integration of the powderlike scattering in the SAXS patterns. The scattering vector q is defined as q ) 4π/λ(sin θ/2), where λ is the wavelength of X-ray, which is 1.5498 Å, and θ is the scattering angle. The peak position represents d-spacing, which is equal to 2π/q according to Bragg’s law. The scattering vector q is calibrated by using silver behenate. The instrument resolution ∆qres ≈ 0.0012 Å. S(q) was calculated as I(q)/F(q), where I(q) is the background corrected scattering intensity and F(q) is the form factor that is obtained by using Irena 2 macros package fitted with spheroidal model of Gaussian size distribution at relatively high q range (>0.07 Å-1). UV-vis Spectrophotometry. UV-vis spectra were collected on a Perkin-Elmer Lambda 35 spectrometer (200-1100 nm). Fluorescent Spectrometer. The emission spectrum of dye molecules in 0.3 M PBS buffer was measured on PC1 Photon Counting Spectrofluorimeter, ISS Inc. Confocal Microscopy. The Leica TCS SP5 equipped with multiphoton fluorescence lifetime imaging microscopy (MP FLIM) system has been used to measure fluorescence lifetime and confocal imaging. An oil immersion objective (Leica, 63×, 1.4 NA) was employed both for focusing laser light onto the samples and for collecting fluorescence emission from the samples. The fluorescence lifetime for each image pixel is recorded using time correlated single photon counting technique (Becker & Hickl SPEC-830 TCSPC modules).
METHODS Sample Preparation. All DNAs were purchased from IDT Inc. with HPLC purification. The ssDNA with Rhodamine dye modification (5′-RhodamineRedTM-TTTTTTGGCGCAGCCTGACGAGCTG -3′) was also purchased from IDT and has a 20 base recognition part and 5 base poly dT spacer separating the dye molecule. Two types of ssDNAs containing a 15 base outer recognition part and a 15 base poly dT spacer (A ) 5′-ATTGGAAGTGGATAA-(T)15-C3H6-SH; B ) HS-C6H12-(T)15-TAACCTAACCTTCAT-3′) are attached to a AuNP of diameter 11.5 ( 1.1 nm through thiolation. The ends of the linker (5′TTATCCACTTCCAAT-(T)n-ATGAAGGTTAGGTTA-3′)arecomplementary to the respective ends of ssDNAs on AuNPs and are separated by a central flexible fragment that contains 30 and 70 nucleotides, respectively. To incorporate dye molecules into the lattice, the central 20 bases of linkers of 30 and 70 have been modified to a sequence that is complementary to recognition part in the dye-DNA. The sequences of the modified linkers are 5′-TTATCCACTTCCAAT-(T)25-CAGCTCGTCAGGCTGCGCCA-(T)25-ATGAAGGTTAGGTTA-3′ and 5′-TTATCCACTTCCAAT-(T)5-CAGCTCGTCAGGCTGCGCCA-(T)5-ATGAAGGTTAGGTTA-3′, respectively. The dye molecule attached to the DNA strand, 5′RhodamineRedTM-TTTTTTGGCGCAGCCTGACGAGCTG-3′, was first mixed with an equal mole of modified linkers. The mixture was then incubated in 0.3 M PBS (phosphate buffered saline) buffer at 70 °C for 10 min, followed by cooling to room temperature for ∼2 h. These hybridized linkers with the dye molecules are used for assembly of AuNPs. The assembly of AuNPs follows previous procedure by using linkers of regular 30 and 70 base central part or hybridied ones with dye molecules D30 or D70. Each system was formed by mixing an equal mole of the two types of ssDNAs capped AuNPs and the linker (DNA/particle mole ratio 36:1) in 0.3 M PBS buffer, after which the mixture was incubated at 60 °C for 10 min, followed by cooling to room temperature for ∼2 h. The assemblies were then annealed at 54 °C for 1 h. The corresponding assembled systems are denoted as system L30, L70, D30, and D70, respectively. The salt concentration was initially adjusted to 0.01 M and then increased from 0.01 to 0.3 M, followed by decrease to 0.01 M. The systems are allowed to equilibrate for at least 0.5 h when the concentration is changed during the X-ray scattering measurement. Small Angle X-ray Scattering. The SAXS experiments were performed at the National Synchrotron Light Source (NSLS) X-21 beamline. The samples in buffer solution were contained in quartz capillary tubes. Scattering profiles are © 2010 American Chemical Society
Acknowledgment. We are grateful to A. Shytov for the help with calculations, M. Hybertsen for stimulating discussion, D. van der Lelie for suggestions on DNA work, M. Cotlet for advice on confocal microscopy, and A. Govorov for helpful discussion. We thank the Center for Functional Nanomaterials and to the National Synchrotron Light Source at Brookhaven National Laborary for use of their facilities. Research was supported by the U.S. Department of Energy, Office of Basic Energy Sciences under contract No. DE-AC02-98CH10866. H.X. thanks support from Shanghai Pujiang Program (10PJ1405400). Supporting Information Available. Additonal calculations, figures, table, and references. This material is available free of charge via the Internet at http://pubs.acs.org. REFERENCES AND NOTES (1) (2) (3) (4) (5)
4461
Nie, Z. H.; Petukhova, A.; Kumacheva, E. Properties and emerging applications of self-assembled structures made from inorganic nanoparticles. Nat. Nanotechnol. 2010, 5, 15. Atwater, H. A.; Maier, S.; Polman, A.; Dionne, J. A.; Sweatlock, L. The new p-n junction. Plasmonics enables photonic access to the nanoworld. MRS Bull. 2005, 30, 385. Redl, F. X.; Cho, K. S.; Murray, C. B.; O’Brien, S. Threedimensional binary superlattices of magnetic nanocrystals and semiconductor quantum dots. Nature 2003, 423, 968. Tamma, V. A.; Lee, J. H.; Wu, Q.; Park, W. Visible frequency magnetic activity in silver nanocluster metamaterial. Appl. Opt. 2010, 49, A11. Aldaye, F. A.; Palmer, A. L.; Sleiman, H. F. Assembling materials with DNA as the guide. Science 2008, 321, 1795. DOI: 10.1021/nl102273c | Nano Lett. 2010, 10, 4456-–4462
(6) (7)
(8)
(9)
(10)
(11)
(12)
(13) (14)
(15) (16)
Alivisatos, A. P.; et al. Organization of “nanocrystal molecules” using DNA. Nature 1996, 382, 609. Mirkin, C. A.; Letsinger, R. L.; Mucic, R. C.; Storhoff, J. J. A DNAbased method for rationally assembling nanoparticles into macroscopic materials. Nature 1996, 382, 607. Aldaye, F. A.; Sleiman, H. F. Dynamic DNA templates for discrete gold nanoparticle assemblies: Control of geometry, modularity, write/wrase and structural switching. J. Am. Chem. Soc. 2007, 129, 4130. Mastroianni, A. J.; Claridge, S. A.; Alivisatos, A. P. Pyramidal and Chiral Groupings of Gold Nanocrystals Assembled Using DNA Scaffolds. J. Am. Chem. Soc. 2009, 131, 8455. Maye, M. M.; Nykypanchuk, D.; Cuisinier, M.; van der Lelie, D.; Gang, O. Stepwise surface encoding for high-throughput assembly of nanoclusters. Nat. Mater. 2009, 8, 388. Sebba, D. S.; Mock, J. J.; Smith, D. R.; LaBean, T. H.; Lazarides, A. A. Reconfigurable core-satellite nanoassemblies as molecularlydriven plasmonic switches. Nano Lett. 2008, 8, 1803. Deng, Z. X.; Tian, Y.; Lee, S. H.; Ribbe, A. E.; Mao, C. D. DNAencoded self-assembly of gold nanoparticles into one-dimensional arrays. Angew. Chem., Int. Ed. 2005, 44, 3582. Le, J. D.; et al. DNA-templated self-assembly of metallic nanocomponent arrays on a surface. Nano Lett. 2004, 4, 2343. Pal, S.; Deng, Z. T.; Ding, B. Q.; Yan, H.; Liu, Y. DNA-OrigamiDirected Self-Assembly of Discrete Silver-Nanoparticle Architectures. Angew. Chem., Int. Ed. 2010, 49, 2700. Tkachenko, A. V. Morphological diversity of DNA-colloidal selfassembly. Phys. Rev. Lett. 2002, 89, 148303. Dai, W.; Hsu, C. W.; Sciortino, F.; Starr, F. W. Valency Dependence of Polymorphism and Polyamorphism in DNA-Functionalized Nanoparticles. Langmuir 2010, 26, 3601.
© 2010 American Chemical Society
(17) Biancaniello, P. L.; Kim, A. J.; Crocker, J. C. Colloidal interactions and self-assembly using DNA hybridization. Phys. Rev. Lett. 2005, 94, 058302. (18) Leunissen, M. E.; et al. Switchable self-protected attractions in DNA-functionalized colloids. Nat. Mater. 2009, 8, 590. (19) Maye, M. M.; Nykypanchuk, D.; van der Lelie, D.; Gang, O. DNARegulated micro- and nanoparticle assembly. Small 2007, 3, 1678. (20) Nykypanchuk, D.; Maye, M. M.; van der Lelie, D.; Gang, O. DNAguided crystallization of colloidal nanoparticles. Nature 2008, 451, 549. (21) Park, S. Y.; et al. DNA-programmable nanoparticle crystallization. Nature 2008, 451, 553. (22) Xiong, H. M.; van der Lelie, D.; Gang, O. DNA linker-mediated crystallization of nanocolloids. J. Am. Chem. Soc. 2008, 130, 2442. (23) Xiong, H. M.; van der Lelie, D.; Gang, O. Phase Behavior of Nanoparticles Assembled by DNA Linkers. Phys. Rev. Lett. 2009, 102, 015504. (24) Maye, M. M.; Kumara, M. T.; Nykypanchuk, D.; Sherman, W. B.; Gang, O. Switching binary states of nanoparticle superlattices and dimer clusters by DNA strands. Nat. Nanotechnol. 2010, 5, 116. (25) Govorov, A. O.; et al. Exciton-plasmon interaction and hybrid excitons in semiconductor-metal nanoparticle assemblies. Nano Lett. 2006, 6, 984. (26) Pustovit, V. N.; Shahbazyan, T. V. Cooperative emission of light by an ensemble of dipoles near a metal nanoparticle: The plasmonic Dicke effect. Phys. Rev. Lett. 2009, 102. (27) Engheta, N. Circuits with light at nanoscales: Optical nanocircuits inspired by metamaterials. Science 2007, 317, 1698. (28) Feng, L. P.; Park, S. H.; Reif, J. H.; Yan, H. A two-state DNA lattice switched by DNA nanoactuator. Angew. Chem., Int. Ed. 2003, 42, 4342. (29) Kreibig, U.; Vollmer, M. Optical Properties of Metal Clusters; Springer: Berlin, 1995; pp 21-23.
4462
DOI: 10.1021/nl102273c | Nano Lett. 2010, 10, 4456-–4462
