B23 in the Proteome of Human Astrocytic

Subscriber access provided by UNIV OF ESSEX

Article

Nucleophosmin (NPM1) / B23 in the proteome of human astrocytic cells restricts Chikungunya virus replication Rachy Abraham, Sneha Singh, Sreeja R Nair, Neha Vijay Hulyalkar, Arun Surendran, Abdul Jaleel, and Easwaran Sreekumar J. Proteome Res., Just Accepted Manuscript • DOI: 10.1021/acs.jproteome.7b00513 • Publication Date (Web): 29 Sep 2017 Downloaded from http://pubs.acs.org on October 2, 2017

Just Accepted “Just Accepted” manuscripts have been peer-reviewed and accepted for publication. They are posted online prior to technical editing, formatting for publication and author proofing. The American Chemical Society provides “Just Accepted” as a free service to the research community to expedite the dissemination of scientific material as soon as possible after acceptance. “Just Accepted” manuscripts appear in full in PDF format accompanied by an HTML abstract. “Just Accepted” manuscripts have been fully peer reviewed, but should not be considered the official version of record. They are accessible to all readers and citable by the Digital Object Identifier (DOI®). “Just Accepted” is an optional service offered to authors. Therefore, the “Just Accepted” Web site may not include all articles that will be published in the journal. After a manuscript is technically edited and formatted, it will be removed from the “Just Accepted” Web site and published as an ASAP article. Note that technical editing may introduce minor changes to the manuscript text and/or graphics which could affect content, and all legal disclaimers and ethical guidelines that apply to the journal pertain. ACS cannot be held responsible for errors or consequences arising from the use of information contained in these “Just Accepted” manuscripts.

Journal of Proteome Research is published by the American Chemical Society. 1155 Sixteenth Street N.W., Washington, DC 20036 Published by American Chemical Society. Copyright © American Chemical Society. However, no copyright claim is made to original U.S. Government works, or works produced by employees of any Commonwealth realm Crown government in the course of their duties.

Page 1 of 24

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Journal of Proteome Research

Nucleophosmin (NPM1) / B23 in the proteome of human astrocytic cells restricts Chikungunya virus replication Rachy Abraham1, Sneha Singh1, Sreeja R Nair1, Neha Vijay Hulyalkar1, Arun Surendran2, Abdul Jaleel2, Easwaran Sreekumar1* 1

Molecular Virology Laboratory; 2Proteomics Core Facility, Rajiv Gandhi Centre for Biotechnology (RGCB), Thiruvananthapram-695014, Kerala, India ABSTRACT

Chikungunya virus (CHIKV), a positive-stranded RNA virus, can cause neurological complications by infecting the major parenchymal cells of the brain such as neurons and astrocytes. A proteomic analysis of CHIKV-infected human astrocytic cell line U-87 MG revealed tight functional associations among the modulated proteins. The predominant cellular pathways involved were of transcription-translation machinery, cytoskeletol re-organization, apoptosis, ubiquitination and metabolism. In the proteome, we could also identify a few proteins that are reported to be involved in host-virus interactions. One such protein, Nucleophosmin (NPM1)/B23, a nucleolar protein, showed enhanced cytoplasmic aggregation in CHIKV infected cells. NPM1 aggregation was predominantly localized in areas wherein CHIKV antigen could be detected.

Further, we observed that inhibition of this aggregation using a specific NPM1

oligomerization inhibitor, NSC348884, caused a significant, dose-dependent enhancement in virus replication. There was a marked increase in the amount of intracellular viral RNA, and ~ 105-fold increase in progeny virions in infected cells. Our proteomic analysis provides a comprehensive spectrum of host proteins modulated in response to CHIKV infection in astrocytic cells. Our results also show that NPM1/B23, a multifunctional chaperone, plays a critical role in restricting CHIKV replication and is a possible target for antiviral strategies. KEY WORDS: Label-free proteomics, Chikungunya, Nucleophosmin, Arbovirus, Astrocytes, Central Nervous system

1 ACS Paragon Plus Environment


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 2 of 24

1. INTRODUCTION There is a significant concern in the expanding geographical spread of chikungunya and its changing clinical spectrum.1 In chikungunya outbreaks reported in the last decade, millions who were infected had classical symptoms of acute fever and symmetrical, debilitating polyarthralgia; however, there was also a significant increase in the number of cases with neurovirulence.2-4. The neurological disease spectrum involved severe encephalitis, meningoencephalitis, peripheral neuropathies and even death.5-16 The disease has spread to the sub-tropical countries in recent times, wherein the Aedes species of the mosquito vector that transmits the chikungunya virus (CHIKV) thrives well.17,18 CHIKV is a positive strand RNA virus belonging to alphavirus genus of the Togaviridae family. Like most RNA viruses, it has accumulated several novel adaptive mutations during the sequential outbreaks that occurred in the last decade.19-21These mutations have been attributed to the changing phenotype of the virus.22-24 Understanding the pathogenesis of neurological complications of CHIKV infection is important considering that it can result in persistent sequelae in neonates.25 Autopsy studies have not clearly documented which cell type component in the brain gets affected in clinical cases of chikungunya encephalitis.10 However, mice studies have shown that the virus preferentially infects astrocytes, and neurons to a lesser extent.22, 26-29 In primary culture of mouse brain cells, predominantly a subpopulation of GFAP+ astrocytes were found to be infected, followed by oligodendrocytes, O-2A progenitors and neurons, which showed a delayed infection.26,30 CHIKV infection of astrocytes resulted in elevated expression of mRNAs for interferons (IFNs), inflammatory cytokines and proapoptotic factors.26 In our earlier study, we found that CHIKV replicated well in the human astrocytic cell line U-87 MG inducing apoptosis and autophagy, and can serve as a suitable cellular model for studying virus infection.31 In order to understand further on intracellular molecules involved in the CHIKV induced cellular pathology, we analysed the proteome of virus infected U-87 MG cells. We identified the major cellular pathways affected upon CHIKV infection of these cells, and also elucidated the role of one of the proteins, Nuclephosmin (NPM1)/ B23, in virus infection. 2. MATERIALS AND METHODS Cell lines and virus CHIKV strain RGCB355/KL08

21, 31

was used for infection. U-87 MG (HTB-14), a human astrocytic cell

line of glioblastoma origin, was obtained from American Type Culture Collection (ATCC) and was grown in DMEM supplemented with 10% heat-inactivated fetal bovine serum (FBS; Pan-Biotech, Germany) and 1× antibiotic-antimycotic mixture (Sigma) at 37°C in a humidified atmosphere with 5% CO2. Immunofluorescence and Hoechst staining Protocols used for immunostaining of CHIKV-infected cells have been described earlier.31 An inhouse rabbit anti-CHIKV polyclonal serum against recombinant E2 protein and anti-NPM1 antibody


Page 3 of 24

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


(Santacruz; B23-sc32256) were used as primary antibodies. Mouse anti-rabbit IgG Alexa fluor 488 (1:2000 dilution) and anti-mouse Cy3 conjugate (1:200 dilution) were used as the secondary antibodies in the experiments. Staining the cells with DAPI (final concentration: 1µg/ml) was done to reveal the nucleus morphology. The cells were stained with Hoechst 33342 Trihydrochloride Trihydrate (Invitrogen) for 20 min for visualizing nuclear condensation. The images were captured using a confocal microscope (Nikon A1Rsi) and analysed using NIS elements software (Nikon) under identical exposure and gain settings for the infected cells as well as the control cells. Label-free quantitative Proteomics analysis U87-MG cell monolayer at a confluency of 80-90% was infected with RGCB355/KL08 at an MOI 1 for 2h at 37°C. Mock infected cells were kept as control. At 48h post-infection, medium was removed and cells were scraped out, washed four times with phosphate-buffered saline (PBS; pH 7.4) and re-suspended in 0.5% Rapigest SF (Waters - 186001860) dissolved in 50mM ammonium bicarbonate having 2µg/ml DNase and 1mM PMSF (All from Sigma). The samples were subjected to label-free quantitative proteomics analysis in the proteomics core-facility of RGCB as per the detailed protocols given in the Supporting information S1. Bioinformatics and bio-statistical analyses The shortlisted genes were classified as per the biological functions based on Swiss-Prot/TrEMBL database

(http://www.uniprot.org/uniprot)

and

the

web-based

tool

GOrilla

(Gene

Ontology

enRIchmentanaLysis and visuaLizAtion tool) (http://cbl-gorilla.cs.technion.ac.il). The enriched GO terms in the target list as compared to the background list were searched with a p-value threshold set at 10-3 using the standard hypergeometric statistics. Protein−protein interactions studies were performed using the manually curated STRING database (the Search Tool for the Retrieval of Interacting Genes/Proteins) version 10.5 (http://string-db.org) set at a high level of confidence cut-off (score of >0.9). Quantitative real time PCR U-87 MG cells were mock infected or infected with CHIKV at MOI 1 and incubated for varying time points. Cells were collected in RNAiso Plus (Takara) reagent. Total RNA isolation, first strand cDNA synthesis and SYBR Green–based quantitative real-time PCR were carried out as previously described32 using gene specific primers (Supporting information S2). A melt-curve analysis was done to confirm the amplified product. Relative changes in gene expression were calculated using -∆∆Ct method comparing the virus-infected and the mock infected samples after normalizing to β-actin expression as the internal control. All experiments were done in three biological and two technical replicates, and the results were analysed statistically using GraphPad Prism 7 software.



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 4 of 24

Effect of Nucleophosmin (NPM1)/B23 inhibition on CHIKV replication The NPM1 inhibitor, NSC348884 hydrate was purchased from Sigma. The toxicity of the drug on uninfected U-87 MG cells at varying concentrations was assessed by cytotoxicity evaluation by MTT assay.33 U-87 MG cells were infected at an MOI of 1 and were grown in medium with or without NPM1 inhibitor at the required concentrations for 48 hrs. The CHIKV titre in culture supernatants from inhibitortreated and control cells were evaluated by plaque assay on Vero cells, as described previously.24 RT-PCR for virus replication kinetics was carried out using the forward primer CHIKnsp1F (5’CATCATGGATCCTGTGTACGTGGA3’) for reverse transcription step, and the CHIKnsP1F and CHIKnsP2R (5’TCATTACTCATCCTGCTCGGGTGA3’) for the PCR step. Viral RNA was isolated from the culture supernatant using RNAiso Plus (Takara) and 2µg of the isolated RNA was used to prepare cDNA using AMV RT (Promega). Reaction was done at 45°C for 1 h, followed by enzyme inactivation at 95°C for 5 min. PCR was done using 2X GoTaq master mix (Promega) with nsP1F and nsP2R primers (~477bp amplification) and 1:5 dilution of the prepared cDNA. The PCR product was loaded onto 2% agarose gel and visualized under UV trans-illuminator (UVP Gel Doc-IT imaging system). The image was captured using UVP Doc-IT LS Image acquisition software followed by area density analysis. The CHIKV band density calculations were relative to β-actin intensity. RESULTS Cellular processes modulated in the differential proteome of CHIKV infected U-87 MG astrocytic cells Our previous studies31 have shown that U-87 MG cells get efficiently infected at various MOIs (0.1, 1 and 10) and the cells begin to show varying degrees of apoptotic changes by 48h post-infection (p.i) characterized by nuclear condensation and loss of mitochondrial membrane potential. Since the focus of the present study was to understand the molecular alterations immediately prior to the onset of cytopathogenic changes, we chose an MOI of 1, which lead to infection in more than 90 % of the cells and a moderate level of apoptosis induction by 48h p.i. Temporal analysis of viral progeny release postinfection indicated that CHIKV replication at MOI 1 followed a bi-phasic pattern and resulted in peak viral titre in the supernatant by 48h, indicating infection of all the cells in culture (Figure 1A). Subsequently, the viral titre dropped due to the increased onset of cell death as evidenced by nuclear condensation in the infected cells (Figure 1C & D). Immunofluorescence analysis also showed an optimal infection at 48h (p.i) CHIKV infected U-87 MG cells (Figure 1B). In the label-free proteomic analysis carried out at 48h p.i., a total of 1195 common proteins were identified from the experiments done in three biological replicates (Figure 2A). This number was reduced to 584 when stringent cut-offs were applied (Supporting information S3). The cut-offs included removal of


Page 5 of 24

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


random sequences; removing those proteins having score values less than 500 and having only one peptide. There were 324 upregulated proteins and 260 downregulated proteins in the differential proteome.

Figure 1. CHIKV infection in U-87 MG astrocytic cells. (A) Plaque assay to measure the temporal release of viral progeny (B) Immunofluorescence detection of CHIKV antigen 48h post-infection using antiCHIKV E2 envelope protein polyclonal serum. (C) Induction of apoptosis in CHIKV infected U-87 MG cells upon CHIKV infection. Nuclear condensation revealed by Hoechst 33342 staining is shown. (D) Quantitation of the nuclear condensation post-CHIKV infection Categorization of the differentially expressed proteins showed major differences in the number of proteins between upregulated and downregulated group in various cellular processes. These were transcription and translation (23.7% vs. 9.3%); ubiqutination (8.02% vs. 3.09%); stress and chaperone



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 6 of 24

response (8.02% vs 3.09%); apoptosis and cell cycle (6.17% vs. 2.37%) and cytoskeletol and cell motility (9.26% vs.3.56%), among others (Figure 2B & C).

Figure 2. Analysis of proteomics data (A) Venn diagram created using the program Venny (http://bioinfogp.cnb.csic.es/tools/venny/index.html) showing the total number of proteins differentially expressed in each of the biological replicates. The common proteins (1195) identified from the three replicates were used for further analysis. Pie diagram showing the functional grouping of the modulated proteins, selected at a high-stringency cut-off, based on Swiss-Prot/TrEMBL database and GOrilla, (B) 324 up-regulated proteins (C) 260 down-regulated proteins. Proteins involved in functions of apoptosis, cell cycle and stress response, ubiquitin protein ligase activity, transcription, translation and energy metabolism showed high statistical significance in GOrilla analysis (Supporting information S4). Analysis using STRING program for the physical and functional associations of the differentially expressed proteins revealed strong protein-protein interaction in the processes like transcription and translation, ubiquitination, cytoskeletol organization and cellular metabolism (Supporting information S5) and also in processes involved in virus infection (Figure 3).


Page 7 of 24

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Figure.3. STRING analysis of differentially expressed proteins in the proteome of CHIKV-infected U-87 MG cells. Network interactions of the modulated proteins involved in viral processes, at a confidence level set at o.9, are shown. The protein Nucleophosmin (NPM1/B23), which was further studied for its functional implications in CHIKV infection, is highlighted in blue colour. Transcript level validation of differential expression of major proteins From the dominant categories of proteins identified in the differential proteome, we selected the proteins having functional role in apoptosis, chaperone activity, ubiquitination, immune response, cytoskeleton organization and neurotransmission for further validation by qRT-PCR of mRNA transcripts. In the functional group of proteins involved in apoptosis, we analysed transcripts of four proteins (LGALS1, BCAP31, PEA15 and PARK7) (Figure 4). LGALS1 was seen down-regulated at 48h time point on proteomics study, while a modulation could be seen in its transcript level at 12h p.i. B-cell receptor-associated protein 31 (BCAP31), which could be detected only in infected sample proteome, showed a transcript level modulation at 36h and 48h p.i. Astrocytic phosphoprotein PEA-15, an antiapoptotic molecule, was seen up-regulated at transcript level at 48h p.i. both in the infected cell proteome and at mRNA level. Protein deglycase DJ-1(PARK7) that regulates the astrocyte inflammatory response was also seen modulated in its transcript level, though at a comparatively low level.



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 8 of 24

Figure 4. Kinetics of mRNA transcript expression of selected genes upon CHIKV infection in U-87 MG cells analysed by quantitative Real-time PCR (qRT-PCR). Ct values are normalized to β-actin mRNA expression levels and relative fold-changes with respect to control are plotted. Modulation of genes representing pathways of Apoptosis, Chaperone activity and Ubiquitination are shown. Statistical analysis was done using Two-way ANOVA (Dunnett’s test) in Graphpad Prism 7 software. Each value represent average from three independent experiments (n=3). ‘*’ p

B23 in the Proteome of Human Astrocytic

Recommend Documents