Bacteria targeting nanoparticles with microenvironment responsive

Subscriber access provided by Eastern Michigan University | Bruce T. Halle Library

Biological and Medical Applications of Materials and Interfaces

Bacteria targeting nanoparticles with microenvironment responsive antibiotic release to eliminate intracellular S. aureus and associated infection Shengbing Yang, Xiuguo Han, Ying Yang, Han Qiao, Zhifeng Yu, Yang Liu, Jing Wang, and Tingting Tang ACS Appl. Mater. Interfaces, Just Accepted Manuscript • DOI: 10.1021/acsami.7b15678 • Publication Date (Web): 10 Apr 2018 Downloaded from http://pubs.acs.org on April 10, 2018

Just Accepted “Just Accepted” manuscripts have been peer-reviewed and accepted for publication. They are posted online prior to technical editing, formatting for publication and author proofing. The American Chemical Society provides “Just Accepted” as a service to the research community to expedite the dissemination of scientific material as soon as possible after acceptance. “Just Accepted” manuscripts appear in full in PDF format accompanied by an HTML abstract. “Just Accepted” manuscripts have been fully peer reviewed, but should not be considered the official version of record. They are citable by the Digital Object Identifier (DOI®). “Just Accepted” is an optional service offered to authors. Therefore, the “Just Accepted” Web site may not include all articles that will be published in the journal. After a manuscript is technically edited and formatted, it will be removed from the “Just Accepted” Web site and published as an ASAP article. Note that technical editing may introduce minor changes to the manuscript text and/or graphics which could affect content, and all legal disclaimers and ethical guidelines that apply to the journal pertain. ACS cannot be held responsible for errors or consequences arising from the use of information contained in these “Just Accepted” manuscripts.

is published by the American Chemical Society. 1155 Sixteenth Street N.W., Washington, DC 20036 Published by American Chemical Society. Copyright © American Chemical Society. However, no copyright claim is made to original U.S. Government works, or works produced by employees of any Commonwealth realm Crown government in the course of their duties.

Page 1 of 46 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

ACS Applied Materials & Interfaces

Bacteria

targeting

nanoparticles

with

microenvironment responsive antibiotic release to eliminate intracellular S. aureus and associated infection Shengbing Yang† ‡, Xiuguo Han† ‡ , Ying Yang†, Han Qiao† , Zhifeng Yu† ,Yang Liu§, Jing Wang§ and Tingting Tang†*

†

Shanghai Key Laboratory of Orthopaedic Implants, Department of Orthopaedic

Surgery, Shanghai Ninth People’s Hospital, Shanghai Jiao Tong University School of Medicine, 639 Zhizaoju Road, Shanghai 200011, P. R. China §

Key Laboratory for Ultrafine Materials of Ministry of Education, East China

University of Science and Technology, 130 Meilong Road, Shanghai 200237, P.R. China *

Address correspondence to: [email protected], Tel.: +86-021 63137020

ORCID: Tingting Tang: orcid.org/0000-0002-1670-7452

Keywords: nanoparticles, targeting, intracellular infection, bacteria toxin responsive, mesoporous silica nanoparticles

1 ACS Paragon Plus Environment

ACS Applied Materials & Interfaces 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

ABSTRACT Staphylococcus aureus (S. aureus) is a causative agent in life-threatening human diseases that afflict millions of people annually. Traditional antibiotic treatments are becoming less efficient because that S. aureus can invade host cells including osteoblast and macrophages, constituting a reservoir that is relatively protected from antibiotics that can lead to recrudescent infection. We herein report a unique intracellular antibiotic delivery nanoparticles, which is comprised of (i) mesoporous silica nanoparticles (MSNs) core loaded with gentamicin, (ii) a infection microenviroment (bacteria toxin) -responsive lipid bilayers surface shell, and (iii) bacteria-targeting peptite UBI29–41 that is harboring immobilized on the shell. The lipid material acts as a gate that prevents drug release before the MSNs reach the target cells or tissue, at which point they are degraded by bacterial toxins to rapidly release the drug, thus achieving efficient bacteria eliminating. We confirm rapid drug release in the presence of bacteria in an extracellular model and observe that S. aureus growth is effectively inhibited both in vitro and in vivo of planktonic and intracellular infection. The inflammation-related genes expression in infected preosteoblast or macrophage is also down regulated significantly after treatment by the antibiotic delivery nanoparticles. The antibiotic delivery nanoparticles offer advantages in fighting intracellular pathogens and eliminate the inflammation caused by intracellular bacteria infection.


Page 2 of 46

Page 3 of 46 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Introduction Staphylococcus aureus (S. aureus) is a major cause of healthcare-associated infections in almost every organ and tissue in the body.1, 2 The severity and diversity of staphylococcal disease and the difficulty in treating clinical cases highlights the evolutionary versatility of this pathogen and the major challenges faced by healthcare providers.3 S. aureus can invade host cells, e.g. macrophages and osteoblasts, to evade immune surveillance.4,

5

Most antimicrobials have a limited capacity to act upon

intracellular bacteria (for both pharmacokinetic and pharmacodynamics reasons), making them difficult to be eliminated, unless using prolonged treatment time, increased dosages, and antibiotic combinations.6 The cells are thus protected from antimicrobial agents and the host immune defense system. This explains the reduced efficiency of antibiotics such as β-lactams and how acute infections can become chronic.7-9 The macrolides can permeate into phagocytes, but in spite of their high accumulation, they show only limited efficacy for the treatment of intracellular infectious disease.10 S. aureus can survive and proliferate for several days after invading cells.

11, 12

It also expresses toxins and exoenzymes that protect against

immune cells and destroy host tissue, enabling penetration of the pathogen into deep tissue structures.13 There is therefore an urgent need to develop efficient antibiotic delivery systems that can treat intracellular infections. Over the decades, nanoparticles as drug carriers have demonstrated their potential in intracellular delivery of antimicrobial agents for intracellular infections treatment.14, 3 ACS Paragon Plus Environment

15

Liposomes,


Page 4 of 46

biodegradable polymeric nanoparticles and inorganic nanoparticles have been used to deliver antibiotics into phagocytes to treat intracellular infections.16-20 However, their widespread application is limited by their instability in biological fluids fast elimination, and a lack of targeting effect.21 In recent years, mesoporous silica nanoparticles (MSNs) have received much attention as drug delivery system.22,

23

Their high specific surface area and large pore volume make them biocompatible and they can be internalized by cells via endocytosis.24 Moreover, MSNs can be manipulated to achieve controlled drug release in response to external or internal stimuli including redox state, pH, enzymatic activity, magnetic field, or light so that side effects can be minimized , which enhance antibiotic activity with fewer side effects.25-29 In one study, gold- and chitosan-stabilized phospholipid liposomes were developed whereby antimicrobial drug release was triggered by bacterial toxin.30 An anti-S.aureus antibody–antibiotic conjugate that is activated only after its release into the proteolytic environment of the phagolysosome was found to be superior to vancomycin for treatment of bacteremia.31 Despite the promising applications for MSNs, their lack of specific targeting to infected tissue and poor cellular uptake reduces the therapeutic efficacy of the encapsulated antibiotics and increases their toxicity to normal cells while promoting drug resistance.32-34 To improve the efficiency of delivery and target specificity, we developed an active targeting strategy involving the binding of target moieties that promote specific interactions between nanoparticles and bacterial cells (S. aureus). We labeled the targeting ligand, a 4 ACS Paragon Plus Environment

Page 5 of 46 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


cationic human antimicrobial peptide fragment ubiquicidin (UBI)29–41, which showed high sensitivity, specificity, and accuracy to detect bacterial infection. 35, 36 At the site of infection, the outer layer of liposomes was degraded by secreted bacterial toxins, which exposed the antibacterial drug and allowed its accumulation and consequent elimination of bacteria. We hypothesized that the antibiotic delivery nanoparticles could be used to treat intracellular infections in vitro and in vivo.

Experimental Section MSNs synthesis. MSNs were prepared by co-condensation using tetraethyl orthosilicate (TEOS) as silica source.37 Briefly, a mixture of hexadectyltrimethyl ammonium bromide (CTAB, 1.0 g, 2.745 mmol), 2.0 M NaOH (3.5 ml, 7.0 mmol), and H2O (480 g, 26.637 mol) was heated at 80 °C for 30 min. TEOS (4.67 g, 22.4 mmol) was added into the mixture, yielding a white precipitate after stirring for 3 min. The reaction was maintained at 80 °C for 2 h and the product was centrifuged at 12,000 rpm for 15 min. After removing the supernatant, the solid precipitate was collected by filtration and thoroughly washed with deionized water and ethanol. The solid sample was collected by centrifugation, washed three times with ethanol, and dried at 60 °C for 24 h. CTAB molecules in the pores were removed by solvent extraction as follows: 0.4 g NH4NO3 in 150 ml 95 % ethanol aqueous solution and 1 g nanoparticles were resuspended in the solution, and the mixture was stirred for 6 h at 60 °C. Solvent-extracted nanoparticles were then isolated by filtration and washed several times with ethanol before drying. 5 ACS Paragon Plus Environment


MSNs were modified with amine-containing silane 3-[2-(2-aminoethylamino) ethylamino] propyltrimethoxysilane (AEPTMS). Briefly, 25 mg MSNs were added to 1 ml of 20 % AEPTMS in pure ethanol, followed by incubation for 24 h at room temperature. After centrifugation at 12,000 rpm for 3 min to remove unreacted AEPTMS, the resultant particles (MSN-NH2) were resuspended in phosphate buffered saline (PBS). Finally, the particles were centrifuged, washed for three times with ethanol and then dispersed in PBS for subsequent use. Gentamicin (Gen) was loaded by mixing 2 mg MSN-NH2 with 2 mg in 1 ml PBS for 24 h at room temperature. The mixture was stirred at room temperature for 24 h. Excess reagent was removed by centrifugation at 12,000 rpm for 10 min, yielding Gen@MSNs. Liposome preparation. Liposomes were prepared by a lipid film-based method.38 Briefly, 15 mg 1,2-dioleoyl-sn-glycero-3-phosphocholine (DOPC), 1.25 mg 1,2-dioleoyl-sn-glycero-3-phosphoethanolamine (DOPE), 7.5 mg cholesterol, and 1.25 mg 1,2-dioleoyl-sn-glycero-3-phosphoethanolamine-N-[methoxy(polyethylene glycol)-2000] (18:0PEG-2000 PE) were dissolved in 3 ml chloroform and evaporated in a rotary evaporator, yielding a thin lipid film that was re-hydrated in 0.5× D-PBS at a concentration of 10 mg/ml and extruded 15 times through two stacks each of Nucleopore/Whatman polycarbonate membranes with progressively smaller pore sizes (100 and 200 nm) (GE Healthcare, Little Chalfont, UK) using a Mini-Extruder


Page 6 of 46

Page 7 of 46 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


set (Avanti Polar Lipids, Alabaster, AL, USA). Resultant liposomes were stored at 4 °C until use. Modification of liposomes with UBI29–41. Liposomes were conjugated with UBI29–41 by an 1-ethyl-3-(3-dimethylaminopropyl) carbodiimide (EDC) activation method, by grafting the carboxyl group of UBI29–41 to the primary amines of phosphatidylethanolamine in the liposomes in the presence of EDC. Briefly, UBI29–41 (2 mg/ml, dissolved in deionized water) was pre-activated with EDC (pH = 4.0) for 2 h at 37°C and added to liposomes in PBS (10 mg lipid/ml) at a ratio of 1:1 (v/v); the pH was adjusted to 8.6 with 0.1 M NaOH. The mixture was incubated for 24 h at 37 °C in a shaker bath under a nitrogen atmosphere. At the end of the incubation period, UBI29–41 modified liposomes (LU) were purified by centrifugation (12,000 rpm) for 30 min at 4 °C and resuspended in 1× D-PBS (pH = 7.4), lyophilized, and stored at −20 °C until use. Preparation of LU-supported bilayers. To prepare LU-coated Gen@MSNs, 50 mg Gen@MSNs was resuspended in 2.0 ml LU (25 mg/ml) and mixed for 10 min in an ice bath. LU-coated Gen@MSNs particles were separated from the LU suspension by centrifugation at 12,000 rpm for 5 min, washed three times with PBS, and lyophilized in an Alpha 1-2 LD Plus freeze dryer (Martin Christ, Osterode am Harz, Germany) as follows: pre-freezing at −45°C for 6 h, followed by incubation at −20°C for 10 h and secondary drying at 25 °C for 4 h. The dried composite sample was Gen@MSN-LU. 7 ACS Paragon Plus Environment


Characterization of nanoparticles. The ultrastructure of drug-free MSNs, Gen@MSNs and Gen@MSN-LU was examined by field-emission transmission electron microscopy (TEM) and scanning electron microscopy (SEM). For TEM imaging, nanoparticles were dispersed in ethanol at a concentration of 5 mg/ml, and 5 µl of the solution was transferred to a carbon-coated copper TEM grid. After air drying, samples were imaged at 200 kV with a JEOL JEM2100F high-resolution TEM (JEOL, Tokyo, Japan). For SEM imaging, dehydrated nanoparticles were coated with gold on a carbon grid and imaged with a HITACHI SU8220 SEM (HITACHI, Tokyo, Japan). Nanoparticle size and zeta potential was measured with a Zetasizer Nano (Malvern Instruments, Malvern, UK). Briefly, samples were prepared by diluting 200 ml of particles (25 mg/ml) in 1.8 ml H2O. Solutions were transferred to 1 ml polystyrene cuvettes for analysis. Nitrogen adsorption-desorption was performed using a JW-BK112 surface area and porosity analyzer (JWGB Sci & Tech Co., Beijing, China). Surface area was determined using the BET model, and cumulative pore volume was calculated from the adsorption branch of the isotherm using the BJH model. Thermo gravimetric analysis (TGA) was carried out in air using an STA 6000 simultaneous thermal analyzer (Perkin Elmer, Waltham, MA, USA) from 30 °C to 800 °C at a heating rate of 5 °C/min. Culture of S. aureus strains. S. aureus (ATCC 25923; American Type Culture Collection, Manassas, VA, USA) was cultured in Luria-Bertani (LB) medium containing 5.0 mg/ml yeast extract, 10.0 mg/ml tryptone and 0.5 mg /ml NaCl (pH = 8 ACS Paragon Plus Environment

Page 8 of 46

Page 9 of 46 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


7.0) on a shaking incubator (200 rpm) at 37°C. We used a Zetasizer Nano particle analyzer tomeasure the zeta potential of the S. aureus. Bacterial affinity studies. The targeting capacity of MSNs and MSN-LU was investigated using S. aureus. Bacteria were cultured overnight in LB medium at 37 °C under 5 % CO2 in an incubator shaker; 10 ml of the overnight culture were re-suspended in fresh LB medium and cultured in the same manner, and 10 ml at steady-state growth were incubated with MSNs (2 mg/ml) or MSN-LU (2 mg/ml) in LB medium at 37 °C for 3 h, followed by centrifugation at 12,000 rpm for 10 min in 15 ml centrifuge tubes. The recovered bacterial pellets were washed three times with PBS and re-dissolved in 10 ml LB medium. For blocking experiment, UBI29-41 (1.0 mg/ml) was added into the dish 1 h before the addition of MSN-LU. The bacteria-binding efficiency of MSNs and MSN-LU was examined by TEM and SEM. Samples for TEM were prepared by drop-coating the treated bacterial cells onto copper grids for 45 s, with any excess liquid removed using filter paper. To observe MSNs or MSN-LU attachment to bacteria by SEM, samples were fixed with a 2.5 % glutaraldehyde solution for 2 h, dehydrated in a graded series of ethanol solution (30 % – 100 %), and air dried. Samples were sputter-coated with a 5-nm layer of gold and examined at an accelerating voltage of 15 kV. Drug release determination. The release profiles of Gen from Gen@MSN-LU in the presence of S. aureus were obtained at 37 °C with 2 ml of 5 % (v/v) tryptic soy broth (TSB) in a bacterial culture tube. Gen@MSN-LU (50 µg/ml) in medium without 9 ACS Paragon Plus Environment


Page 10 of 46

or with S. aureus with an optical density at 600 nm of 1.0 was introduced into the tube. At pre-determined intervals, 300 µl of the solution was collected and purified using an Amicon Ultra-0.5 centrifugal filter (Millipore, Billerica, MA, USA). The filtrate was collected

to

determine

Gen

concentration

by

measuring

the

maximum

ultraviolet–visible (UV-Vis) light absorbance of Gen at λ = 232 nm using a Multimode Reader equipped with a UV-Vis detector (Infinite 200 PRO; TECAN, Männedorf, Switzerland). The release of Gen from Gen@MSN-LU in the presence of lipase was analyzed at 37 °C in TSB composed of 50 U/ml lipase using dialysis membrane

tubing

(Spectra/Por

Float-A-Lyzer,

molecular

weight

cut-off:

12,000–14,000; Sigma-Aldrich, MO, USA). At pre-determined intervals, all release medium from the tubing was collected and the tubing was placed in 15 ml of fresh medium pre-incubated at 37 °C. The concentration of Gen in the release medium was measured by UV-Vis spectroscopy. To confirm the bacteria-triggered release, the release of Gen from Gen@MSN-LU was measured in the presence of S. aureus and 50 U/ml protease and phosphatase inhibitor cocktail (Sigma, P0044). Morphological characterization of bacteria. Bacterial cells (1 × 106 CFU/ml) incubated with Gen@MSNs and Gen@MSN-LU (20 µg/ml for 2 h were collected by centrifugation at 5000 rpm for 10 min and fixed with 2.5 % glutaraldehyde overnight at 4 °C. After washing three times with PBS, cells were dehydrated in a graded series of ethanol (30 % – 100 %) for 30 min and imaged by SEM and TEM.


Page 11 of 46 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Determination of the minimum inhibition concentration (MIC). Each well of the 96-well plates was added 150 µl of S.aureus bacteria cells (1 ×106 CFU/ml). Then saline (20 µl, as the blank control), Gen, and Gen@MSN-LU were separately added into 96-well plates and shaken at 37 °C on a shaker bed for 24 h.The bacterial viability was determined by OD 600 nm using a multifunctional microplate reader. Determination of antibacterial activity. The antibacterial efficacy of MSNs, Gen, Gen@MSNs, and Gen@MSN-LU against S. aureus was analyzed by Kirbye Bauer antibiotic testing. Briefly, bacteria were inoculated in 5 ml Mueller-Hinton broth and cultured at 37 °C for 12 h. Samples with a Gen concentration of 2.0 µg/ml were transferred to an Oxford cup and plates were incubated in an incubator shaker at 37°C for 12 h. Antibacterial activity was evaluated by measuring the size of inhibition zones. Live/dead cell staining. Live/dead cell staining experiments were carried out using a kit (Biotium, Fremont, CA, USA) according to the manufacturer’s instructions. S. aureus cells (106 CFU/ml) treated with Gen, MSNs, MSN-LU, Gen@MSNs, or Gen@MSN-LU with a Gen concentration of 2.0 µg/ml for 6 h were collected by centrifugation at 8000 rpm for 5 min. Cells were stained with SYTO 9 and PI for 30 min and visualized with a confocal microscope (TCS SP8; Leica, Wetzlar, Germany). Cell culture. Preosteoblast (MC3T3-E1) and macrophage (RAW264.7) cells were cultured in α-Minimal Essential Medium (α-MEM) containing 10 % fetal bovine



serum (FBS) and penicillin (100 U/ml) at 37 °C in a humidified atmosphere of 5 % CO2. Cellular uptake of MSNs and MSN-LU. In order to monitor cellular uptake of nanoparticles by confocal microscopy, MSNs and MSN-LU were labeled with the red fluorescent dye Cy7. Afterwards, MC3T3-E1 and RAW264.7 cells were cultured on coverslips for 24 h until complete adhesion and then incubated with MSNs (25 µg /ml) and MSN-LU (25 µg/ml) at 37 °C for 0.5, 1, or 3 h. The cells were washed three times with cold PBS and fixed with 4 % paraformaldehyde in PBS for 20 min, followed 4ꞌ,6-diamidino-2-phenylindole (DAPI) staining for 10 min and fluorescein isothiocyanate (FITC)-phalloidin staining for 60 min. Samples were analyzed by confocal microscopy. Preparation for TEM Samples. We fixed of MSN-LU NPs-treated MC3T3-E1 samples for 3 h with 2.5 % glutaraldehyde in 0.1 Mcacodylate buffer (pH= 7.4), washed them with PBS twice, further fixed the residues with 0.1 % osmic acid for 30 min, washed them with PBS for three times, dehydrated the samples through graded ethanol solutions with 30, 50, 70, 90, 95, 100 % (v/v, in water), and 50 % ethanol in acetone for 10 min each time, and finally dehydrated them with pure acetone twice for 15 min. We embedded the dehydrated samples in Epon812 and polymerized at 60 °C for 24 h, cut the samples into superthin slices (60 - 70 nm in thickness) and placed the slices on formvar-coated grids for TEM observation.


Page 12 of 46

Page 13 of 46 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Intracellular Antibacterial Activity. MC3T3-E1 and RAW264.7 cells (2 × 104) were seeded on coverslips and cultured overnight. S. aureus was added at a multiplicity of infection of 30 per well. After incubation for 30 min, the supernatant was discarded and infected cells were washed twice with 1× PBS. The α-MEM was replaced with medium supplemented with 30 µg/ml Gen to kill only the remaining extracellular bacteria without affecting intracellular bacteria. Infected MC3T3-E1 cells were cultured in fresh medium in the presence of Gen, MSNs, Gen@MSNs, or Gen@MSN-LU at a drug dose of 2 µg/ml. Infected RAW264.7 cells were cultured in fresh medium in the presence of vancomycin (Van), Gen, MSNs, Gen@MSNs, or Gen@MSN-LU at a drug dose of 1µg/ml, 2 µg/ml, 4 µg/ml and 8 µg/ml. After 24 h, the intracellular viability of S. aureus was determined by confocal microscopy, and by lysing infected cells in sterile distilled water and plating the lysates on tryptic soyagar (TSA) followed by a visual count of bacterial colonies. Cell

viability

assays.

Cell

viability

was

evaluated

by

using

a

methyl-thiazolyltetrazolium (MTT) method. Firstly, MC3T3-E1 or RAW264.7 cells were seeded onto 96-well plates at a density of 5×103 / well. After 24 h, they were incubated with different concentrations of Gen, MSN-LU and Gen@MSN-LU for 24 h. Then 10 µl MTT solution (1 mg/ml) was added into each well, and cells were further incubated for 4 h. After that, the culture medium in 96 wells was discarded through using a micro-syringe and 150 µl dimethylsulfoxide (DMSO) was added into each well. The absorbance intensity was determined at 490 nm by amicroplate reader 13 ACS Paragon Plus Environment


(Bio-tek, Elx800). Results were presented as the % survival with respect to untreated control cells. Real-time PCR. The inflammation-related gene expression inintracellular infection MC3T3-E1 and RAW 264.7 cells with or without treament were quantitatively determined by real-time polymerase chain reaction (PCR) using our reported methods. 39 Primer sequences are listed in Table 1. In vivo anti-bacterial efficacy of Gen@MSN-LU. Planktonic bacterial infection model. Male BALB/c mice (4 weeks old, weighing 25–30 g) were purchased from Slaccas Co. (Shanghai, China). All animal experimental procedures were performed according to the guidelines of the Animal Ethics Committee of Shanghai Ninth People’s Hospital. A 200µl volume of bioluminescent S. aureus Xen29 (1 × 109 CFU/ml) in PBS was subcutaneously injected into the right axillary fossa (injection depth: 5 mm). Intracellular bacterial infection model. Male BALB/c mice (4 weeks old, weighing 25–30 g) were infected by intraperitoneal injection of 6 × 107 CFU S. aureus Xen29, and sacrificed 1 day later. The peritoneum was flushed with 5 ml cold PBS; peritoneal washes were centrifuged for 5 min at 2000 rpm at 4 °C in a table-top centrifuge. The cell pellet containing peritoneal cells was collected and treated with 50 µg/ml lysostaphin for 20 min at 37 °C to kill contaminating extracellular bacteria. Peritoneal cells from donor mice were washed three times in ice-cold PBS to remove


Page 14 of 46

Page 15 of 46 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


lysostaphin and pooled; recipient mice were subcutaneously injected in the right axillary fossa with cells derived from five donors. At 2 days post-infection, mice were treated with Van (5.0 mg/kg, 15 mg/kg, and 20 mg/kg), Gen, Gen@MSNs, or Gen@MSN-LU in PBS (free Gen and loaded Gen: 5.0 mg/kg, 15 mg/kg, and 20 mg/kg calculated based on Gen concentration) via the tail vein once a day for 2 days. Fluorescence images were captured with a near-infrared (NIR) fluorescence imaging system to assess targeting capacity and biodistribution within 48 h of injection at pre-determined times (6, 12, 24 and 48 h). Real-time in vivo bioluminescence images of representative animals harboring metabolically active S. aureus were collected with a 5 min exposure time using an IVIS Spectrumimaging system (Perkin Elmer) to monitor bacterial growth. To compare the targeting capacity of the nanoparticles and antibiotic efficiency, contrast ratios (bacterial infection to normal tissue) were calculated at the different time points in a circular region of interest using Living Image software (Caliper, Newton, MA, USA). In vivo bioluminescence and NIR fluorescence imaging was carried out in five randomly selected animals per group. After 2 days, mice were sacrificed and infectedtissue samples were collected and processed for analysis. In order to characterize inflammatory response, sections were probed with primary antibodies against IL-6 and TNF-α (1:100; Abcam) followed by labeling with horseradish peroxidase-conjugated secondary antibody and counterstaining with hematoxylin using reagents from the Histostain-SP kit (Invitrogen, Carlsbad, CA, USA). The in 15 ACS Paragon Plus Environment


vivo inflammatory response was quantified by evaluating six random fields (at 200 × magnification) of stained sections from three individual mice (two fields per mouse). Simultaneously, the major organs (heart, liver, spleen, lung and kidney) and infection tissue were excised from Gen@MSNs and Gen@MSN-LU treated group. The tissue sections were stained with hematoxylin and eosin (H&E) and observed by bright field microscopy. Five mice were used for each test group (n = 5). Body weight of the mice were checked every day. To determine the amount of bacteria in infected tissue samples, the tissue was homogenized in normal saline (1.0 ml) and plated on LB agar, and the number of grown colonies was counted for analysis.

Results and Discussions Preparation and Characterization of Gen@MSN-LU. In the present study, we developed gentamicin (Gen)-loaded MSNs (Gen@MSNs) as mesoporous channels decorated with bacteria toxin-sensitive liposomes and UBI29-41 modified that exhibited high drug-loading capacity, stability and enabled controlled delivery of high concentrations of Gen into the cytosol of target cells (Figure 1a). The liposomes layer prevented the nonspecific uptake of the particles under physiological conditions, whereas the conjugated UBI29–41 allowed the targeting of particles to bacteria in infected tissues. At the site of infection, the outer layer of liposomes was degraded by secreted bacterial toxins, which exposed the antibacterial drug and allowed its accumulation and consequent elimination of bacteria. We hypothesized that 16 ACS Paragon Plus Environment

Page 16 of 46

Page 17 of 46 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


combination therapy with Gen-loaded MSNs and UBI29–41-coated liposomes could be used to treat both planktonic and intracellular S. aureus infections in vivo. The nanoparticulate mesoporous support was prepared using TEOS as a hydrolytic inorganic precursor and the surfactant CTAB as the porogen species. Bare MSNs were obtained by surfactant removal via solvent extraction and were then loaded with Gen. liposomes that are degradable by toxin produced by bacteria were introduced onto the silica surface and channels to serve as gate-keepersfor drug delivery.40, 41 To achieve controlled release of drug at the infection site while avoiding toxicity to surrounding healthy cells, UBI29-41 was linked to the nanoparticle surface by nucleophilic addition (Figure 1a). Mesoporous silica particle cores were prepared by the surfactant templated aerosol-assisted self-assembly method previously developedand communicated.37 The resulting nanoparticles were further modified with AEPTMS, then Gen was loaded into the pores of MSNs using the immersion procedure which infuses the drug into the pores by means of capillary forces. Gen@MSN-LU was constructed by fusing UBI29-41-modified liposomes to Gen loaded MSNs. MSNs, Gen loaded MSNs and Gen loaded MSN-LU were characterized by TEM and SEM. As shown in Figure 1b, MSNs maintained highly ordered mesoporous structure with mean particle size of about 80 nm. No pores were visible on the MSNs after Gen loading (Figure 1c). To prepare Gen loading MSN-LU, liposomes were fused to the Gen@MSNs core, and the resultant supported lipid bilayer was chemically conjugated to the UBI29-41 17 ACS Paragon Plus Environment


targeting peptide. It has to be noted that liposomes and UBI29-41 possessed a core shell structure on the the Gen loading MSNs core (Figure 1d). From the high resolution SEM images, mesoporous structure could be clearly identified on the MSNs (Figure 1e), mesoporous structure was disappeared after Gen loading and liposomes/UBI29-41 immobilization (Figure 1f, g). With this coating, the hydrodynamic diameter of NPs increased from 81.2 ± 5.8 nm to 94.6 ± 4.9 nm, as determined by dynamic light scattering (Figure 1h). The coating procedure prevented agglomeration of the nanoparticles. The functionalization of MSNs was examined by thermogravimetric analysis (TGA), the Brunauere–Emmere–Teller (BET) and Barrette–Joynere–Halenda (BJH) models. The introduction of UBI29-41 modified liposomes onto MSNs was confirmed by the TGA curves (Figure 1i); the weight loss value of MSNs, unloaded MSN-LU was 8.8 ± 0.5 %, 12.7 ± 0.9 %, and drug content was 25.6 ± 1.5 %. The weight percentages of UBI29-41 modified liposomes peptide and Gen in the nanoparticles was 3.9 ± 0.6 % and 12.9 ± 0.8 %, respectively. The weight loss of MSN-LU indicated that the lipid bilayer was immobilized onto the nanoparticle surface. The typical nitrogen adsorption-desorption isotherms for MSNs and MSN-LU confirmed the porous nature of the particles (Figure 1j). Compared with MSNs, the isotherms of MSN-LU and Gen@MSN-LU showed a smaller specific surface area (from 843 ± 23 m2 g−1 to 456 ± 19 m2 g−1 and 65 ± 9 m2 g−1, respectively) and pore volume (from 0.85 ± 0.08 cm3 g−1 to 0.58 ± 0.07 cm3 g−1 and 0.11 ± 0.08cm3


Page 18 of 46

Page 19 of 46 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


g−1, respectively), confirming successful surface modification and Gen loading in meopores of MSNs. Targeting of planktonic bacteria and responsive antibiotics release. Current challenges associated with bacterial infection include side effects of antibiotics, the development of multidrug resistance, and the negative consequences of intracellular bacterial clearance. The target efficiency of MSNs and MSN-LU was investigated in S. aureus. For blocking experiment, UBI29-41 (1.0 mg/ml) was added into the bacteria solution 1 h before the addition of MSN-LU. We investigated the specificity of MSN-LU for S.aureus in vitro by TEM and SEM and found that MSN-LU was incorporated into the S.aureus membrane (Figure 2a), demonstrating high specificity as compared with MSNs, which showed low affinity for bacterial cells. The specificity of MSN-LU for S.aureus was competitively inhibited by an excess of UBI29-41, which confirming that MSN-LU is internalized by the peptide mediation (Figure S1). The cationic peptite UBI29-41 on the surface of MSNs core electrostatically attracted with the negatively charged S.aureus, which are attributed to the high fraction of anionic phospholipids. We used the liposomes to protect inside drugs from release in the environment without bacteria and infections, thereby avoiding adverse side effects. Bacterial phosphatase, lipases and phospholipase are particularly abundant at sites of infection, which degrade liposomes, to trigger the release of loading antibiotics.42,

43

To

demonstrate that drug release from Gen@MSN-LU could be triggered by bacterial 19 ACS Paragon Plus Environment


lipases, we incubated Gen@MSN-LU with S.aureus and analyzed the Gen release profiles relative to those obtained in the absence of S.aureus. Only 21.2 ± 1.3 % of total encapsulated Gen was released from Gen@MSN-LU incubated in tryptic soy broth (TSB) for 48 h (Figure 2b-A). In contrast, incubation with S.aureus in 5 % TSB accelerated Gen release to 37.9 ± 2.1 % of total encapsulated drug in 6 h, 73.2 ± 4.2 % in 24 h and 90.5 ± 6.5 % in 48 h (Figure 2b-B). To confirm that the lipase could degrade the liposomes, we incubated Gen@MSN-LU in TSB containing lipase. Cumulative Gen release from Gen@MSN-LU was 21.2 ± 1.3 % after 48 h of incubation in TSB and increased to 77.6 ± 1.3 % in the presence of 50 U/ml lipase (Figure 2b-C). Cumulative Gen release from Gen@MSN-LU was decreased to 41.5 ± 1.6 % upon incubation with S.aureus and 50 U/ml lipase inhibitor orlistat for 48 h (Figure 2b-D), demonstrating that drug release from Gen@MSN-LU was triggered by the bacteria. To further investigate the antibacterial activity of Gen@MSN-LU, S. aureus cells with live/dead staining were observed by confocal laser scanning microscopy (Figure 2c). SYTO 9 green fluorescent nucleic acid dye labels both intact and damaged membranes of bacteria, while propidium iodide (PI) penetrates cells with damaged membranes to bind nucleic acids, resulting in enhanced red fluorescence. Untreated control and MSN-LU-treated cells showed mostly green and negligible red fluorescence. In contrast, cells treated with Gen, Gen@MSNs, Gen@MSN-liposome


Page 20 of 46

Page 21 of 46 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


and Gen@MSN-LU exhibited strong red fluorescence, indicating that their cell membranes were disrupted and were thus permeable to PI (Figure 2c, Figure S2). The antibacterial effect of Gen@MSN-LU on S.aureus was also evaluated by examining the size of the inhibition zone on Luria-Bertani (LB) agar plates (Figure S3). As expected, S.aureus growth was inhibited by Gen, Gen@MSN, and especially Gen@MSN-LU (Figure S3). The quantitative antibacterial tests of Gen and Gen@MSN-LU against S. aureus were performed to investigate the antibacterial activity of the nanoparticles. Figure S4 shows the bacteria viability as a function of the concentration of Gen and Gen@MSN-LU. Gen@MSN-LU demonstrates more effective anti-bacterial effect than Gen. The bacteria viability is only 82.5 % for Gen@MSN-LU (1.0 µg/ml) incubated S. aureus, while the value approximates to 100 % for Gen. We examined the zeta potential of the MSNs, MSN-LU and S.aureus, MSNs possesses a zeta potential of -26.7 ± 4.3 mV, while the zeta potential of MSN-LU turned to be 22.3 ± 5.3 mV upon coating with liposome and UBI29-41. The showed zeta potentials of S.aureus is −20.5 ± 3.2 mV. The enhanced antibacterial activity of Gen@MSN-LU over Gen may be partly due to electrostatic interaction between positively charged nano-conjugates and the negatively charged bacterial cell membrane, which could increase binding affinity and consequently, the antibacterial effect.44

These results revealed that the electrostatic interaction between the

MSN-LU NPs and the surface of the S. aurues cell wall, elevating the attachment of 21 ACS Paragon Plus Environment


Page 22 of 46

the MSN-LU NPs to bacteria and thus improve the potential of loaded antibiotics to kill bacteria. Thus, Gen@MSN-LU can also overcome drug resistance since it would be difficult for bacteria to develop tolerance against membrane-disrupting antibiotics. Targeting

of

intracellular

bacteria

and

down

regulation

of

the

inflammation-related genes expression. S. aureus is able to invade, survive insideand reproduce after they have been ingested by mammalian cells, which hinders the treatment of this type of infection.45 The intracellular distribution of Gen@MSN-LU in pre-osteoblast cell line MC3T3-E1 or macrophage cell line RAW264.7 was evaluated by confocal microscopy. Cells treated with Gen served as controls. Red fluorescence from Cy7-labeled MSN-LU, blue fluorescence from DAPI-stained nuclei, and green fluorescence from FITC-phalloidin labeling of F-actin was visualized by confocal microscopy (Figure 3a for osteoblast, Figure S5 for macrophage). Nanoparticles taken up by MC3T3-E1 cells were distributed throughout the cytoplasm after 3 h of incubation. Compared with uncoated MSNs, MSN-LU showed increased internalization in MC3T3-E1 and RAW264.7 cells, as evidenced by the higher fluorescence intensities, which may carry more antibiotic into phagocytic cells. Notably, there was greater uptake of MSN-LU than of MSNs, suggesting that liposome and UBI29-41 modification improved nanoparticle internalization and consequently, drug delivery. Subsequently, the uptake of MSN-LU by MC3T3-E1 cell was directly observed by cell TEM images. As shown in Figure


Page 23 of 46 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


3b, TEM image intentionally displayed that a large number of particles were taken by MC3T3-E1 cells. We further investigated the ability of Gen@MSN-LU to inhibit S. aureus growth in osteoblasts and macrophages. S.aureus-infected MC3T3-E1 and RAW 264.7 cells were examined by confocal microscopy to determine the intracellular accumulation of bacteria (Figure 3c for osteoblast, Figure S6, Figure S7 and Figure S8 for macrophage). Compared to the other groups, the amount of intracellular bacteria decreased significantly after the treatment by Gen@MSN-LU at 2 ug/ul (Figure 3c and Figure S8) . This is consistent with the results of several previous studies, which showed that gentamicin is poorly active against the intracellular pathogens. 46, 47 In addition, cell lysates were grown in TSA after treatment with Gen, MSNs, MSN-LU, Gen@MSNs and Gen@MSN-LU, and bacterial colonies were counted (Figure 3d for osteoblast, Figure S6 b for macrophage). The number of bacterial colonies in LB-agar plates (Figure 3d and Figure S6b ) further confirmed the strong antibiotic ability of Gen@MSN-LU toward S. aureus inside the osteoblast and macrophage cells, whereas Gen, MSNs, and Gen@MSN treatment failed to inhibit the intracellular bacteria growth. Gen and Gen@MSNs are poorly active against the intracellular S. aureus in infected macrophages even at high concentration (8 ug/ml, based on Gen concentration) (Figure S6 and Figure S7). We also found that the amount of intracellular bacteria decreased after the treatment by vancomycin at 8 ug/ml in infected macrophages (Figure S9). This indicates that higher concentrations 23 ACS Paragon Plus Environment


of vancomycin could penetrate the cell membrane of macrophages and kill S. aureus in the intracellular compartments. The intracellular concentration of vancomycin depends on the balance between input and output, higher concentrations of vancomycin may cause more drug penetrating in phagocytic cells to destroy the microorganism. These results demonstrate that Gen@MSN-LU can effectively kill bacteria inside mammalian cells. The MSN-LU carrier systems allow antibiotics to be delivered into phagocytic cells and when nanoparticles migrate to the site of bacteria, the liposome shell is degraded by secreted bacterial toxins, thereby exposing the drug that subsequently kill the intracellular bacterial cells (Figure 3e). Inflammation-related genes expression in intracellular infected MC3T3-E1 and RAW 264.7 cells with or without treatment were quantitatively determined by real-time PCR. It can be seen that the expression levels of inflammation-related genes IL-6, TNF-α, CCL2 and CXCL2 were significantly elevated after the infection by S. aureus in both MC3T3-E1 (Figure 3f) and RAW 264.7 cells (Figure S10)，while the treatment of Gen, Gen@MSNs, and especially the Gen@MSN-LU significantly down regulated these genes expression. And the down regulation of these genes expression might be due to the reduction of the level of bacteria. The cytotoxicity of Gen, MSN-LU and Gen@MSN-LU in MC3T3-E1 and RAW 264.7 cells was investigated using the MTT cell viability assay (Figure S11 and Figure S12). This result showed no significant cytotoxicity and antiproliferative effect for cells at concentrations up to 32 µg/ml (Gen and Gen@MSN, calculated 24 ACS Paragon Plus Environment

Page 24 of 46

Page 25 of 46 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


based on Gen) and 250 µg/ml MSN-LU. These resultsindicate desirable innocuousness of MSN-LU for therapeutic drug delivery applications. Eliminations of planktonic and intracellular bacteria infections in vivo. To investigate the in vivo targeting of Gen@MSN-LU, we generated a mouse model of infection by subcutaneously injecting a suspension of bioluminescent planktonicor intracellular S. aureus Xen29 into the right axillary fossa. After 2 days, mice were treated with Gen, Gen@MSNs, or Gen@MSN-LU NPs by daily intravenous injection. Bacterial growth was monitored by real-time in vivo bioluminescence imaging. The biodistribution of Cy7-labeled MSNs and MSN-LU was also visualized based on fluorescence. Activity and body weight were monitored daily and no significant changes in these parameters were observed in the mice. Fluorescence associated with bacteria was observed 6 to 48 h after infection. For the planktonic S. aureus-infected mice, the signals decreased in all groups after 24 h and more significantly reduced after 48 h (Figure 4a). Homogenized tissue dispersions from the infectious site were added to LB-agar plates to evaluate therapeutic efficacy by enumerating the bacterial counts. S. aureus load in the infected tissue was 6.8×106 CFU/g in mice treated with phosphate-buffered saline (PBS); this was reduced by Gen, Gen@MSNs, and Gen@MSN-LU treatment to 2.4× 104, 2.1× 104, and 1.6× 104 CFU/g, respectively (Figure 4c). For the intracellular S. aureus-infected mice, bacteria fluorescence didn’t decreased from 6 to 48 h after infection for Gen and Gen@MSNs with different 25 ACS Paragon Plus Environment


concentration treatment (Figure 5 and Figure 6), while the signals decreased in Gen@MSN-LU treatment after 12 h and could not be detected at 48 h (Figure 7). The bacteria fluorescence didn’t decreased from 6 to 48 h after infection for Van treatment at 5.0 mg/kg, the bacteria fluorescence decreased from 24 h for Van treatment at 10 mg/kg and from 12 h for Van treatment at 20 mg/kg, respectively (Figure S13). Intracellular S. aureus can protect from the action of most antibiotics leads to the recurrence of infection. Our result revealed that vancomycin could kill the intracellular bacteria in vivo at high concentrations. However, high doses of antibiotics may cause noticeable toxicity and add to the risk of kidney injury. Lipoglycopeptides such as telavancin, oritavancin and dalbavancin have been shown to possess a better efficacy in treatment intracellular S. aureus. The use of antibiotic delivery systems with capacity for selective distribution in phagocytic cells is an important resource in improving antibiotic therapy against intracellular infections. The bacterial load in infected tissue from intracellular S. aureus-infected mice was 2.3×107 and 8.4×106 CFU/g upon PBS and Gen (5 mg/kg) treatment, respectively. Gen@MSNs and Gen@MSN-LU (5 mg/kg based on Gen) treatment reduced the bacterial load to 4.7× 106 CFU/g and 1.5 × 104 CFU/g, respectively (Figure 8). Moreover, the distribution of fluorescent of nanoparticles in vivo demonstrates the excellent target efficiency of MSN-LU to infection tissue (Figure 4b, Figure 7b). Sections of planktonic (Figure 4e) and intracellular (Figure 8c) S. aureus-infected 26 ACS Paragon Plus Environment

Page 26 of 46

Page 27 of 46 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


tissue were obtained from mice with different treatment to assess the expression of the pro-inflammatory cytokines interleukin (IL)-6 and tumor necrosis factor (TNF)-α by immunohistochemistry staining. In mice infected with planktonic bacteria, treatment with Gen, Gen@MSNs, or Gen@MSN-LU resulted in a downregulation of IL-6 and TNF-α levels (Figure 4d). In mice infected with intracellular bacteria, Gen@MSN-LU decreased IL-6 and TNF-α levels as compared with Gen and Gen@MSN treatment (Figure 8b). To investigate the side effects of the nanoparticles, the major organs were harvested after treatment for physiopathology studies. The H&E staining didn’t show any noticeable histological change in major organs, indicating no organ toxicity (Figure 9a, b). Infiltration of polymorphous cells in infected tissue significantly decreased for Gen@MSN-LU treated group in comparison with the Gen@MSNs group (Figure 9c). These in vivo results indicate that the treatment of Gen@MSN-LU could effectively inhibit the growth of bacteria both in planktonic and intracellular S. aureus-infected model. The fluorescence signal of S. aureus at day 5 and day 10 was monitored by IVIS Spectrumimaging system (Perkin Elmer). As showed in below Figure. S14, for the planktonic S. aureus-infected mice, the signals could not be detected in all groups, indicating no relapse of bacterial growth. For the intracellular S. aureus-infected mice, obvious bacteria fluorescence can be observed for Gen and Gen@MSN treatment groups and no bacteria fluorescence signals could be detected in Gen@MSN-LU 27 ACS Paragon Plus Environment


Page 28 of 46

treatment group. No relapse of bacterial growth at day 5 and day 10 after treatment by Gen@MSN-LU in the intracellular S. aureus-infected mice. Besides, no obvious differences in body weight were observed across all the planktonic S. aureus-infected mice Figure. S15. The body weight of intracellular S. aureus-infected mice decreased for gentamicin and Gen@MSN treatment, indicating the continuous bacterial infection. In contrast, the body weight increment of the Gen@MSN-LU group was similar to that in the control group (uninfected mice), indicating that Gen@MSN-LU has a better antibacterial effect in intracellular S. aureus-infected mice than free gentamicin and Gen@MSN. These results demonstrate that MSN and MSN-LU have no apparent toxicity in mice. Conclusion The intracellular location of S. aureus can evade the immune system and protects them from some antibiotics with poor cellular penetration. Only a few new antibacterial agents such as telavancin, clindamycin and quinolones are effective treatment of intracellular infections. Over the decades, nanoparticles have been explored for intracellular delivery of antibiotics against intracellular infections. In this paper,

we

successfully

developed

a

gentamicin-loaded

mesoporous

silica

nanoparticles (MSNs) coated with lipid bilayers and harboring immobilized bacteria-targeting peptide UBI29–41 (Gen@MSN-LU) targeting intracellular S. aureus. The liposomes material acted as a gate that prevented drug release before the MSNs reached the target cells or tissue, at which point they were degraded by bacterial 28 ACS Paragon Plus Environment

Page 29 of 46 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


toxins to release the drug. Compared with free gentamicin, the nanoparticulate system is effcient in drug loading, protection from inactivation, overcoming cellular barriers and treating intracellular infections. The nanoconstruct efficiently targeted S. aureus in vitro and S. aureus growth was effectively inhibited in vivo in mouse models of planktonic and intracellular infection. The low cytotoxicity and responsive drug release make this nanosystem can be adapted to deliver any other antibiotics targeting different bacteria for the treatment of a broad range of infections.

Corresponding Author *Tingting Tang. E-mail address:[email protected] Author Contributions S.B Yang and X.G Han contributed equally to this work.

Notes The authors declare no competing financial interest.

Acknowledgments This work was funded by the National Key R&D Program (2016YFC1102100) , National Natural Science Foundation ofChina (81672205), Biomedical Engineering Crossover Project of Shanghai JiaoTong University (YG2014ZD01), the grant from the National Natural Science Foundation of China (81401819) and the China Postdoctoral Science Foundation (2015M571574). 29 ACS Paragon Plus Environment


Supporting Information TEM and SEM images of S. aureus after treating with MSN-LU, confocal fluorescence images of S. aureus with the treatments of Gen@MSNs and Gen@MSN-liposome, S.aureus growth evaluated by the size of inhibition zone on LB agar plates, quantitative antibacterial tests against the S. aureus with different concentrations of Gen@MSN-LU and Gen, CLSM microphotograph of RAW 264.7 cells incubated with gentamicin, MSNs and MSN-LU for 3 h, CLSM microphotograph of S.aureus-infected RAW264.7 cells with the treatments of gentamicin, MSNs, MSN-LU, Gen@MSNs vancomycin, and Gen@MSN-LU at different concentration for 24 h, Real-time PCR of inflammation-related genes expression in intracellular infected RAW 264.7 cells with or withot treament and cellviability of MC3T3-E1, RAW264.7 cells incubated for 24 h with different concentrations of Gen, Gen@MSNs and Gen@MSN-LU and in vivo antibacterial evaluation of vancomycin with different concentration in intracellular bacteria infected model.

References 1.

Maya, S.; Indulekha, S.; Sukhithasri, V.; Smitha, K. T.; Nair, S. V.; Jayakumar,

R.; Biswas, R., Efficacy of tetracycline encapsulated O-carboxymethyl chitosan nanoparticles against intracellular infections of Staphylococcus aureus. International Journal of Biological Macromolecules 2012, 51, 392-399. 2.

Diekema, D. J.; Pfaller, M. A.; Schmitz, F. J.; Smayevsky, J.; Bell, J.; Jones, R.

N.; Beach, M., Survey of infections due to Staphylococcus species: frequency of occurrence and antimicrobial susceptibility of isolates collected in the United States, Canada, Latin America, Europe, and the Western Pacific region for the SENTRY 30 ACS Paragon Plus Environment

Page 30 of 46

Page 31 of 46 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Antimicrobial Surveillance. Clinical Infectious Diseases An Official Publication of the Infectious Diseases Society of America 2001, 32 Suppl 2, S114-132. 3.

Paterson, G. K.; Larsen, A. R.; Robb, A.; Edwards, G. E.; Pennycott, T. W.;

Foster, G.; Mot, D.; Hermans, K.; Baert, K.; Peacock, S. J.; Parkhill, J.; Zadoks, R. N.; Holmes, M. A., The newly described mecA homologue, mecALGA251, is present in methicillin-resistant Staphylococcus aureus isolates from a diverse range of host species. Journal of Antimicrobial Chemotherapy 2012, 67, 2809-2813. 4.

Schwarz Linek, U.; Höök, M.; Potts, J. R., The molecular basis of

fibronectin-mediated bacterial adherence to host cells. Molecular Microbiology 2004, 52, 631–641. 5.

Fraunholz, M.; Sinha, B., Intracellular Staphylococcus aureus: live-in and let die.

Frontiers in Cellular & Infection Microbiology 2012, 2, 43. 6.

Carrasco, L. C. D. M.; Santos, H. C. A. S.; Sampaio, J. L. M.; Carmona-Ribeiro,

A. M., Self-assembled Antibiotic Nanoparticles Against Intracellular Bacteria. Drug Delivery Letters 2017, 7, 39-47. 7.

Abraham, A. M.; Walubo, A., The effect of surface charge on the disposition of

liposome-encapsulated gentamicin to the rat liver, brain, lungs and kidneys after intraperitoneal administration. International journal of antimicrobial agents 2005, 25, 392-397. 8.

Maurin, M.; Raoult, D., Use of Aminoglycosides in Treatment of Infections Due

to Intracellular Bacteria. Antimicrobial Agents & Chemotherapy 2001, 45, 2977-2986. 9.

Carryn, S.; Chanteux, H.; Seral, C.; Mingeot-Leclercq, M. P.; Van, B. F.;

Tulkens, P. M. Intracellular pharmacodynamics of antibiotics. Infectious Disease Clinics of North America 2003, 17, 615-634. . 10. Mor, N.; Vanderkolk, J.; Mezo, N.; Heifets, L., Effects of clarithromycin and rifabutin alone and in combination on intracellular and extracellular replication of Mycobacterium avium. Antimicrobial Agents & Chemotherapy 1994, 38, 2738-2742. 11. Majumdar, S.; Flasher, D.; Friend, D. S.; Nassos, P.; Yajko, D.; Hadley, W. K.; Duzgunes, N., Efficacies of liposome-encapsulated streptomycin and ciprofloxacin against Mycobacterium avium-M. intracellulare complex infections in human peripheral blood monocyte/macrophages. Antimicrobial agents and chemotherapy 1992, 36, 2808-2815.



12. Van Bambeke, F.; Barcia-Macay, M.; Lemaire, S.; Tulkens, P. M., Cellular pharmacodynamics and pharmacokinetics of antibiotics: current views and perspectives. Current opinion in drug discovery & development 2006, 9, 218-230. 13. Yang, C.; Krishnamurthy, S.; Liu, J.; Liu, S.; Lu, X.; Coady, D. J.; Cheng, W.; De Libero, G.; Singhal, A.; Hedrick, J. L.; Yang, Y. Y., Broad-Spectrum Antimicrobial Star Polycarbonates Functionalized with Mannose for Targeting Bacteria Residing inside Immune Cells. Advanced Healthcare Materials 2016, 5, 1272-1281. 14. Imbuluzqueta, E.; Gamazo, C.; Ariza, J.; Blanco-Prieto, M. J., Drug delivery systems for potential treatment of intracellular bacterial infections. Frontiers in Bioscience A Journal & Virtual Library 2010, 15, 397-417. 15. Briones, E.; Colino, C. I.; Lanao, J. M., Delivery systems to increase the selectivity of antibiotics in phagocytic cells. Journal of Controlled Release Official Journal of the Controlled Release Society 2008, 125, 210-227. 16. Dicheva, B. M.; Hagen, T. L. M. t.; Li, L.; Schipper, D.; Seynhaeve, A. L. B.; Rhoon, G. C. v.; Eggermont, A. M. M.; Lindner, L. H.; Koning, G. A., Cationic Thermosensitive Liposomes: A Novel Dual Targeted Heat-Triggered Drug Delivery Approach for Endothelial and Tumor Cells. Nano Letters 2013, 13, 2324-2331. 17. Zaru, M.; Sinico, C.; Logu, A. D.; Caddeo, C.; Lai, F.; Manca, M. L.; Fadda, A. M., Rifampicin-loaded liposomes for the passive targeting to alveolar macrophages: in vitro and in vivo evaluation. Journal of Liposome Research 2009, 19, 68-76. 18. Faria, T. J.; Roman, M.; de Souza, N. M.; De, V. R.; de Assis, J. V.; dos Santos, A. L.; Bechtold, I. H.; Winter, N.; Soares, M. J.; Silva, L. P., An isoniazid analogue promotes Mycobacterium tuberculosis-nanoparticle interactions and enhances bacterial killing by macrophages. Antimicrobial Agents & Chemotherapy 2012, 56, 2259-2267. 19. Akbari, V.; Abedi, D.; Pardakhty, A.; Sadeghi-Aliabadi, H., Ciprofloxacin nano-niosomes for targeting intracellular infections: an in vitro evaluation. Journal of Nanoparticle Research 2013, 15, 1-14. 20. Skidan, I. N.; Gel'Perina, S. E.; Severin, S. E.; Guliaev, A. E., Enhanced activity of rifampicin loaded with polybutyl cyanoacrylate nanoparticles in relation to intracellularly localized bacteria. Antibiotics and chemoterapy 2003, 48, 23-26.


Page 32 of 46

Page 33 of 46 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


21. Li, J.; Qu, X.; Payne, G. F.; Zhang, C.; Zhang, Y.; Li, J.; Ren, J.; Hong, H.; Liu, C., Biospecific Self-Assembly of a Nanoparticle Coating for Targeted and Stimuli-Responsive Drug Delivery. Advanced Functional Materials 2015, 25, 1404-1417. 22. Zhang, X.; Zhang, X.; Wang, S.; Liu, M.; Zhang, Y.; Tao, L.; Wei, Y., Facile Incorporation of Aggregation-Induced Emission Materials into Mesoporous Silica Nanoparticles for Intracellular Imaging and Cancer Therapy. ACS applied materials & interfaces 2013, 5, 1943-1947. 23. López, V.; Villegas, M. R.; Rodríguez, V.; Villaverde, G.; Lozano, D.; Baeza, A.; Vallet-Regí, M., Janus Mesoporous Silica Nanoparticles for Dual Targeting of Tumor Cells and Mitochondria. ACS applied materials & interfaces 2017, 9, 26697-26706. 24. Qu, Q.; Ma, X.; Zhao, Y., Anticancer Effect of α-Tocopheryl Succinate Delivered by Mitochondria-Targeted Mesoporous Silica Nanoparticles. ACS applied materials & interfaces 2016, 8, 34261-34269. 25. Kwon, D.; Cha, B. G.; Cho, Y.; Min, J.; Park, E.-B.; Kang, S.-J.; Kim, J., Extra-Large Pore Mesoporous Silica Nanoparticles for Directing in Vivo M2 Macrophage Polarization by Delivering IL-4. Nano Letters 2017, 17, 2747-2756. 26. Mackowiak, S. A.; Schmidt, A.; Weiss, V.; Argyo, C.; von Schirnding, C.; Bein, T.; Bräuchle, C., Targeted Drug Delivery in Cancer Cells with Red-Light Photoactivated Mesoporous Silica Nanoparticles. Nano Letters 2013, 13, 2576-2583. 27. He, Q.; Shi, J., MSN anti-cancer nanomedicines: chemotherapy enhancement, overcoming of drug resistance, and metastasis inhibition. Advanced materials 2014, 26, 391-411. 28. Pan, L.; Liu, J.; He, Q.; Shi, J., MSN-mediated sequential vascular-to-cell nuclear-targeted drug delivery for efficient tumor regression. Advanced Materials 2014, 26, 6742-6748. 29. Xiong, M. H.; Bao, Y.; Yang, X. Z.; Wang, Y. C.; Sun, B.; Wang, J., Lipase-Sensitive Polymeric Triple-Layered Nanogel for “On-Demand” Drug Delivery. Journal of the American Chemical Society 2012, 134, 4355-4362. 30. Thamphiwatana, S.; Gao, W.; Pornpattananangkul, D.; Zhang, Q.; Fu, V.; Li, J.; Li, J.; Obonyo, M.; Zhang, L., Phospholipase A2-responsive antibiotic delivery via nanoparticle-stabilized liposomes for the treatment of bacterial infection. Journal of materials chemistry. B, Materials for biology and medicine 2014, 2, 8201-8207. 33 ACS Paragon Plus Environment


Page 34 of 46

31. Lehar, S. M.; Pillow, T.; Xu, M.; Staben, L.; Kajihara, K. K.; Vandlen, R.; DePalatis, L.; Raab, H.; Hazenbos, W. L.; Morisaki, J. H.; Kim, J.; Park, S.; Darwish, M.; Lee, B. C.; Hernandez, H.; Loyet, K. M.; Lupardus, P.; Fong, R.; Yan, D.; Chalouni, C.; Luis, E.; Khalfin, Y.; Plise, E.; Cheong, J.; Lyssikatos, J. P.; Strandh, M.; Koefoed, K.; Andersen, P. S.; Flygare, J. A.; Wah Tan, M.; Brown, E. J.; Mariathasan, S., Novel antibody-antibiotic conjugate eliminates intracellular S. aureus. Nature 2015, 527, 323-328. 32. Kim, H. J.; Matsuda, H.; Zhou, H.; Honma, I., Ultrasound-Triggered Smart Drug Release from a Poly(dimethylsiloxane)– Mesoporous Silica Composite. Advanced materials 2006, 18, 3083-3088. 33. Veeranarayanan, S.; Poulose, A. C.; Mohamed, M. S.; Varghese, S. H.; Nagaoka, Y.; Yoshida, Y.; Maekawa, T.; Kumar, D. S., Synergistic Targeting of Cancer and Associated Angiogenesis Using Triple-Targeted Dual-Drug Silica Nanoformulations for Theragnostics. Small 2012, 8, 3476-3489. 34. Jiao, Y.; Sun, Y.; Tang, X.; Ren, Q.; Yang, W., Tumor-Targeting Multifunctional Rattle-Type Theranostic Nanoparticles for MRI/NIRF Bimodal Imaging and Delivery of Hydrophobic Drugs. Small 2015, 11, 1962-1974. 35. Chen, H.; Liu, C.; Dan, C.; Madrid, K.; Peng, S.; Dong, X.; Min, Z.; Gu, Y., Bacteria-Targeting Conjugates Based on Antimicrobial Peptide for Bacteria Diagnosis and Therapy. Molecular Pharmaceutics 2015, 12, 2505-2516. 36. Saeed, S.; Zafar J Fau - Khan, B.; Khan B Fau - Akhtar, A.; Akhtar A Fau Qurieshi, S.; Qurieshi S Fau - Fatima, S.; Fatima S Fau - Ahmad, N.; Ahmad N Fau Irfanullah, J.; Irfanullah, J., Utility of

99

mTc-labelled antimicrobial peptide

ubiquicidin (29-41) in the diagnosis of diabetic foot infection. Eur J Nucl Med Mol Imaging 2013, 40, 737-743 37. Lopez, V.; Villegas, M. R.; Rodríguez, V.; Villaverde, G.; Lozano, D.; Baeza, A.; Vallet, R. M., Janus mesoporous silica nanoparticles for dual-targeting for tumoral cells and mitochondria. Acs Applied Materials & Interfaces 2017, 9, 26697-26706. 38. Dong, W.; Jingbin, H.; Xinxia, W.; Yuan, Y.; He, Z.; Yan, C.; Junjie, L.; Zhiguo, S.; Hao, Z.; Duxin, S., The eradication of breast cancer cells and stem cells by 8-hydroxyquinoline-loaded

hyaluronan

modified

mesoporous

silica

nanoparticle-supported lipid bilayers containing docetaxel. Biomaterials 2013, 34, 7662-7673. 34 ACS Paragon Plus Environment

Page 35 of 46 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


39. Han, X. G.; Du, L.; Qiao, H.; Tu, B.; Wang, Y. G.; Qin, A.; Dai, K. R.; Fan, Q. M.; Tang, T. T., CXCR1 knockdown improves the sensitivity of osteosarcoma to cisplatin. Cancer letters 2015, 369, 405-415. 40. Mohamed, W.; Sommer, U.; Sethi, S.; Domann, E.; Thormann, U.; Schütz, I.; Lips, K. S.; Chakraborty, T.; Schnettler, R.; Alt, V., Intracellular proliferation of S. aureus in osteoblasts and effects of rifampicin and gentamicin on S. aureus intracellular proliferation and survival. European Cells and Materials 2014, 28, 258-268. 41. Chen, S.; Chen, R., A Virus-Mimicking, Endosomolytic Liposomal System for Efficient, pH-Triggered Intracellular Drug Delivery. Acs Applied Materials & Interfaces 2016, 8, 22457-22467. 42. Pornpattananangkul, D.; Zhang, L.; Olson, S.; Aryal, S.; Obonyo, M.; Vecchio, K.; Huang, C. M.; Zhang, L., Bacterial toxin-triggered drug release from gold nanoparticle-stabilized liposomes for the treatment of bacterial infection. Journal of the American Chemical Society 2011, 133, 4132-4139. 43. Zhou, J.; Loftus, A. L.; Mulley, G.; Jenkins, A. T., A thin film detection/response system for pathogenic bacteria. Journal of the American Chemical Society 2010, 132, 6566-6570. 44. Jeon, S. J.; Oh, M.; Yeo, W. S.; Galvão, K. N.; Jeong, K. C., Underlying mechanism of antimicrobial activity of chitosan microparticles and implications for the treatment of infectious diseases. Plos One 2014, 9, e92723. 45. Garzoni, C.; Kelley, W. L., Staphylococcus aureus: new evidence for intracellular persistence. Trends in Microbiology 2009, 17, 59-65. 46. Seral, C.; Van Bambeke, F.; Tulkens, P. M., Quantitative Analysis of Gentamicin,

Azithromycin,

Telithromycin, Ciprofloxacin,

Moxifloxacin, and

Oritavancin (LY333328) Activities against Intracellular Staphylococcus aureus in Mouse J774 Macrophages. Antimicrobial Agents and Chemotherapy 2003, 47, 2283-2292. 47. Carryn, S.; Bambeke, F. V.; Mingeotleclercq, M. P.; Tulkens, P. M., Comparative Intracellular (THP-1 Macrophage) and Extracellular Activities of β-Lactams, Azithromycin, Gentamicin, and Fluoroquinolones against Listeria monocytogenes at Clinically Relevant Concentrations. Antimicrobial Agents & Chemotherapy 2002, 46, 2095-2103. 35 ACS Paragon Plus Environment


Page 36 of 46

Table 1 Sequences of primers used in real-time PCR Gene

Primer sequences (5′–3′)

Product size (bp)

TNF-α-F

AGGCACTCCCCCAAAAGATG

TNF-α-R

TTTGCTACGACGTGGGCTAC

IL-6-F

GTCCTTCCTACCCCAATTTCCA

IL-6-R

CGCACTAGGTTTGCCGAGTA

CXCL2-F

GGAAGCCTGGATCGTACCTG

CXCL2-R

TCACCCTCTCCCCAGAAACT

CCL2-F

GATGCAGTTAACGCCCCACT

CCL2-F

ACCCATTCCTTCTTGGGGTC

GAPDH-F

CCCTTAAGAGGGATGCTGCC

GAPDH-R

ACTGTGCCGTTGAATTTGCC


250

151

289

292

263

Page 37 of 46 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


GRAPHIC FOR MANUSCRIPT



Figure 1. Schematics of the synthetic route of Gen@MSN-LU. UBI29-41 was used to target the bacteria and liposomes outer layer can be degraded by the bacterium-secreted toxins, leading to the gentamicin release (a). Typical TEM image of MSNs (b), Gen@MSNs (c) and Gen@MSN-LU (d) (Scale bar = 50 nm.). Typical SEM image of MSNs (e), Gen@MSNs (f) and MSN-LU (g). Size distribution of MSNs and MSN-LU (h). TGA curves recorded for MSNs, MSN-LU and Gen@MSN-LU (i). N2 adsorption-desorption isotherm for MSNs, MSN-LU and Gen@MSN-LU (j). 140x175mm (300 x 300 DPI)

ACS Paragon Plus Environment

Page 38 of 46

Page 39 of 46 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Figure 2. TEM and SEM image of S. aureus before and after treating with MSNs and MSN-LU (a). Cumulative release of gentamicin from Gen@MSN-LU in TSB medium (A) ; in the presence of S. aureus strain ATCC 25923 at an OD 600 value of 1.0 (B); with 50 unit ml-1 lipase add to the TSB medium (C) and with 50 unit ml-1 lipase inhibitors inthe presence of S. aureus strain ATCC 25923 at an OD 600 value of 1.0 (D) (b). Confocal fluorescence images of S. aureus stained with BacLight Live/Dead kit showing the presence of live bacteria (green) and dead bacteria (red) in the LB solutions without the treatment (control) and with the treatments of gentamicin, MSN-LU and Gen@MSN-LU (Scale bars represent 100 µm) (c). 140x95mm (300 x 300 DPI)



Figure 3. Confocal laser scanning microscopy (CLSM) observations of MC3T3-E1 cells incubated with gentamicin, MSNs and MSN-LU for 3 h, for each panel, the images from left to right show cell nuclei stained by DAPI (blue), MSNs and MSN-LU fluorescence in cells (red), FITC fluorescence in cells (green) and the merged one of the left three images (Scale bars represent 50 µm) (a). TEM image of intracellular distributions of MSN-LU in MC3T3-E1 cell (b). Confocal fluorescence images of S.aureus-infected MC3T3-E1 cells with the treatments of gentamicin, MSNs, MSN-LU, Gen@MSNs and Gen@MSN-LU for 24 h (Scale bars represent 20 µm) (c); Photographs of bacterial colonies formed on LB-agar plates (d). Schematics of possible antimicrobial mechanism in phagocytic cells (e). Inflammation-related gene expression inintracellular infected MC3T3-E1 cells with or withot treament (f), the data shown are the mean expression levels relative to housekeeping gene GAPDH expression.Data are presented as the means ± SD. * indicates p < 0.05. All data were obtained from at least three independent experiments. 160x167mm (300 x 300 DPI)


Page 40 of 46

Page 41 of 46 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Figure 4. In vivo antibacterial evaluation of gentamicin or gentamicin loading nanoparticles in planktonic bacteria infected model. In vivo bioluminescence of S. aureus (a) , NIR of cy7 labeled Gen@MSNs and Gen@MSN-LU (b) were monitored non-invasively. The tissue dispersions were diluted 1000 times and plated on the LB-agar medium for 12 h and The CFU counts in various groups (c). Immunohistochemistry stainings of IL-6 and TNF-α in infected tissue before and after treatment were photographed (Scale bars represent 100 µm) (d). Tissue sections were prepared from infected tissue of mice at day 2 after treatment. The results were expressed in terms of mean density of positive staining. The data are presented as the means ± S.D. * indicates p < 0.5,** indicates p < 0.01 and *** indicates p < 0.001. Each group contained 5 animals. 145x231mm (300 x 300 DPI)



Figure 5. In vivo antibacterial evaluation of gentamicin with different concentration (A: 5.0 mg kg−1, B: 10 mg kg−1, C: 20 mg kg−1) in intracellular bacteria infected model were monitored non-invasively. 76x89mm (300 x 300 DPI)


Page 42 of 46

Page 43 of 46 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Figure 6. In vivo antibacterial evaluation of Gen@MSNs with different concentration (A: 5.0 mg kg−1, B: 10 mg kg−1, C: 20 mg kg−1, calculated based on Gen concentration) in intracellular bacteria infected model. In vivo bioluminescence of S. aureus (a), NIR of cy7 labeled Gen@MSNs (b) were monitored non-invasively. 140x106mm (300 x 300 DPI)



Figure 7. In vivo antibacterial evaluation of Gen@MSN-LU with different concentration (A: 5.0 mg kg−1, B: 10 mg kg−1, C: 20 mg kg−1, calculated based on Gen concentration) in intracellular bacteria infected model. In vivo bioluminescence of S. aureus (a), NIR of cy7 labeled Gen@MSN-LU (b) were monitored noninvasively. 140x106mm (300 x 300 DPI)


Page 44 of 46

Page 45 of 46 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Figure 8. The tissue dispersions were diluted 1000 times and plated on the LB-agar medium for 12 h and the CFU counts in various groups (a). Immunohistochemistry staining of of IL-6 and TNF-α in infected tissue before and after treatment were photographed (Scale bars represent 100 µm) (b). Tissue sections were prepared from infected tissue of mice at day 2 after treatment. The results were expressed in terms of mean density of positive staining. The data are presented as the means ± S.D. * indicates p < 0.05 and *** indicates p < 0.001. Each group contained 5 animals. 140x128mm (300 x 300 DPI)



Figure 9. Histological evaluation of major organs (heart, liver, spleen, lung and kidney) (a: planktonic bacteria infections, b: intracellular bacteria infections) and infection tissue (c) from mice after treatment with Gen@MSNs and Gen@MSN-LU. Infiltration of polymorphous cells in the infected tissue (arrows). 140x88mm (300 x 300 DPI)


Page 46 of 46

Bacteria targeting nanoparticles with microenvironment responsive

Recommend Documents