Bacterial Analysis Using an Electrochemical DNA Biosensor with Poly

Subscriber access provided by University of Leicester

Article

Bacterial analysis using an electrochemical DNA biosensor with Poly-adenine-mediated DNA self-assembly Lanying Li, Lele Wang, Qin Xu, Li Xu, Wen Liang, Yan Li, Min Ding, Ali Aldalbahi, Zhilei Ge, Lihua Wang, Juan Yan, Na Lu, Jiang Li, Yanli Wen, and Gang Liu ACS Appl. Mater. Interfaces, Just Accepted Manuscript • DOI: 10.1021/acsami.7b17327 • Publication Date (Web): 31 Jan 2018 Downloaded from http://pubs.acs.org on January 31, 2018

Just Accepted “Just Accepted” manuscripts have been peer-reviewed and accepted for publication. They are posted online prior to technical editing, formatting for publication and author proofing. The American Chemical Society provides “Just Accepted” as a free service to the research community to expedite the dissemination of scientific material as soon as possible after acceptance. “Just Accepted” manuscripts appear in full in PDF format accompanied by an HTML abstract. “Just Accepted” manuscripts have been fully peer reviewed, but should not be considered the official version of record. They are accessible to all readers and citable by the Digital Object Identifier (DOI®). “Just Accepted” is an optional service offered to authors. Therefore, the “Just Accepted” Web site may not include all articles that will be published in the journal. After a manuscript is technically edited and formatted, it will be removed from the “Just Accepted” Web site and published as an ASAP article. Note that technical editing may introduce minor changes to the manuscript text and/or graphics which could affect content, and all legal disclaimers and ethical guidelines that apply to the journal pertain. ACS cannot be held responsible for errors or consequences arising from the use of information contained in these “Just Accepted” manuscripts.

ACS Applied Materials & Interfaces is published by the American Chemical Society. 1155 Sixteenth Street N.W., Washington, DC 20036 Published by American Chemical Society. Copyright © American Chemical Society. However, no copyright claim is made to original U.S. Government works, or works produced by employees of any Commonwealth realm Crown government in the course of their duties.

Page 1 of 30 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

ACS Applied Materials & Interfaces

Bacterial analysis using an electrochemical DNA biosensor with Poly-adenine-mediated DNA self-assembly Lanying Li#, Lele Wang#, Qin Xu#, Li Xu#, Wen Liang#, Yan Li#, Min Ding#, Ali Aldalbahi∥, Zhilei Ge†, Lihua Wang†, Juan Yan§, Na Lu‡, Jiang Li*†, Yanli Wen*#, Gang Liu*# #

Laboratory of Biometrology, Division of Chemistry and Ionizing Radiation

Measurement Technology, Shanghai Institute of Measurement and Testing Technology, Shanghai 201203, China ‡

School of Materials Engineering, Shanghai University of Engineering Science,

Shanghai 201620, China §

College of Food Science & Technology Shanghai Ocean University, Shanghai

201306, China ∥

Chemistry Department, King Saud University, Riyadh 11451, Saudi Arabia

†

Division of Physical Biology & Bioimaging Center, Shanghai Institute of Applied

Physics, Chinese Academy of Science, Shanghai 201800, China

ACS Paragon Plus Environment

ACS Applied Materials & Interfaces 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 2 of 30

ABSTRACT: The spatial arrangement of DNA probes on the electrode surface is of critical significance for the performance of electrochemical biosensors. However, rational control of the probe surface remains challenging. In this work, we develop a capture probe carrying a poly-adenine anchoring block to construct a programmable self-assembled monolayer for a “sandwich-type” electrochemical biosensor. We show that

with

a

co-assembling

strategy

using

a

polyA capture

probe

and

6-mercapto-1-hexanol, the density of the probes on the gold electrode can be simply adjusted by the length of polyA. The electron transfer effect and thus the hybridization efficiency can as well be optimized by tuning the polyA length. As results, we obtained an excellent biosensor performance with a limit of detection as low as 5 fM for a synthetic DNA target. We demonstrate the practicability of this system by analyzing a PCR product from Escherichia coli genomic DNA (0.2 pg/µL). Based on the ideal electrochemical interface, our polyA-based biosensor exhibited excellent reusability and stability, which is important for potential applications in the on-site analysis for a wide range of targets.

KEYWORDS: self-assembly monolayer, poly-adenine DNA probe, electrochemical biosensor, modification-free, E. coli genome


Page 3 of 30 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


1. INTRODUCTION Electrochemical nucleic acid biosensors (E-biosensor)1-5 have attracted growing research interest as promising tools for quantitative analysis in many important areas including clinical diagnosis6-10, microbiological detection11, anti-bioterrorism, and environmental monitoring12-13, etc. They show unique advantages such as high sensitivity, high specificity, low cost and good portability14-25. For the construction of a typical electrochemical DNA biosensor26-27, a recognition DNA probe is immobilized onto the electrode to capture the target DNA molecules through specific hybridization, and subsequently, the biosensor will transduce the presence of the target DNA to an electrochemical signal. It is well recognized that the performance of the sensors is highly dependent on the spatial arrangements of the self-assembled monolayer (SAM) of DNA probes on the electrode surface. In recent decades, many biosensing strategies have been focusing on building well-organized DNA SAMs28, including anti-biofouling SAM29, biotin-Avidin SAM30 and SAM on nanoscale electrode31. Especially, the thiolate DNA (SH-DNA) SAM on the gold electrode has been intensively studied32-34. For example, Fan’s group35 demonstrated that the hybridization efficiency was highly dependent on the well-ordered upright conformation SH-DNA probes, and the electron transfer rate was highly related to the density of the DNA monolayer33. Nevertheless, critical obstacles still remain for rational control of the SAM organization, which restrict further improvements of the performance of DNA biosensors.



Recently, consecutive adenines (polyA) have been exploited to assemble oligonucleotides on the gold surface with a high affinity comparable to Au-S chemistry36-41. Pei et al. reported a polyA-mediated strategy for DNA assembly on gold nanoparticles (AuNPs) with precise amount regulation and well organized upright conformation42. Later, near-unity yields of nanoparticles with fixed valences or even monovalence were obtained by tuning the length of polyA11, indicating the strong controllability of the DNA arrangements on the gold surface. Since then, the polyA-AuNP assembly strategy has been successfully adopted in biosensors targeting DNAs40,

43

and microRNAs44-45, or in applications for intracellular delivery of

functional nucleic acids46.

However, when applied to electrochemical platform, the poor electron transfer efficiency of the pure polyA SAM seriously hindered the signal-to-noise ratio (S/N) of the electrochemical biosensor. To develop a polyA-based electrochemical interface, in this work, we designed a novel polyA-based capture probe (polyA-P) consist of a recognition part and a polyA anchoring block, tword a sensitive “sandwich-type” electrochemical biosensor. As a novel kind of label-free interface on the gold electrode surface, the electrochemical performance of the polyA-based SAM was systematically studied. Firstly, different co-assembling molecules including a short oligo of 5 consecutive adenines (A5) and 6-Mercapto-1-hexanol (MCH) were compared, to achieve optimized electron-transfer efficiency. Secondly, the surface density of the capture probe was precisely modulated by varying the length of the polyA block of the probe. Based on a series of optimization studies, we successfully


Page 4 of 30

Page 5 of 30 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


developed a polyA-based electrochemical biosensor, which was applied in the analysis of a fragment of Escherichia coli (E. coli) genomic DNA, with a limit of detection (LOD) of 5 fM, and impressively the practicability was as well demonstrated by analyzing a complex PCR product.

2. EXPERIMENTAL SECTION

2.1 Reagents

Tris-(hydroxymethyl)aminomethane was purchased from Cxbio Biotechnology Ltd. Hexaammineruthenium(III) chloride ([Ru(NH3) 6]3+, RuHex), potassium ferricyanide (K3Fe(CN)6), Ethylenediaminetetraacetic acid (EDTA), and 6-Mercapto-1-hexanol (MCH) were purchased from Sigma-Aldrich (St. Louis, MO). The 3, 3’, 5, 5’ -tetramethylbenzidine (TMB) substrate was purchased from Neogen in the format of a ready-to-use reagent (TMB substrate, H2O2 included). The avidin-horseradish peroxidase (Avidin-HRP) was from eBioscience (San Diego, U.S.A.). The diluent buffer was from Fitzgerald Industries International (Acton, MA). The genomic DNA extraction kit was purchased from Tiangen Biotech (Beijing) Co., Ltd. The E. coli strain Dh5α, dNTP mixture, Ex Taq DNA polymerase and 10×Ex Taq buffer were from Takara. All solutions were prepared in Milli-Q water (18 MΩ·cm resistivity) without further purification. All oligonucleotides were synthesized and purified by Invitrogen Inc., and the DNA sequences are shown in Table 1.

Table 1. Sequences of oligonucleotides in this work.



Page 6 of 30

Probe Name

Sequence (5’-3’)

polyA5 capture probe

A5CCCACCAACGCTG


A10CCCACCAACGCTG


A20CCCACCAACGCTG


A30CCCACCAACGCTG


A40CCCACCAACGCTG

A5

AAAAA

Reporter probe

ATCAATTCCACAGTTTTCGC-Biotin

Target

GCGAAAACTGTGGAATTGATCAGCGTTGGTGGGAA

PCR primer1

GCGAAAACTGTGGAATTGAT

PCR primer2

TGATGCTCCATCACTTCCTG

PCR product (250 bp)

GCGAAAACTG

TGGAATTGAT

CAGCGTTGGT

GGGAAAGCGC

GTTACAAGAA

AGCCGGGCAA

TTGCTGTGCC

AGGCAGTTTT

AACGATCAGT

TCGCCGATGC

AGATATTCGT

AATTATGCGG

GCAACGTCTG

GTATCAGCGC

GAAGTCTTTA

TACCGAAAGG

TTGGGCAGGC

CAGCGTATCG

TGCTGCGTTT

CGATGCGGTC

ACTCATTACG

GCAAAGTGTG

GGTCAATAAT

CAGGAAGTGA

TGGAGCATCA

2.2 Preparation of the polyA-P/MCH SAM on electrode Gold electrodes were cleaned following one of our reported work26, and then, the cleaned electrodes were incubated in immobilization buffer (pH 7.4, 10 mM Tris·HCl, 1 mM EDTA, 1 M NaCl) containing polyA-P of appropriate concentrations overnight under room temperature. Then, the polyA-P modified electrodes were treated with 0.1 mM MCH to construct the interface of polyA-P/MCH SAMs. The prepared electrode


Page 7 of 30 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


was then stored in TE buffer at 4 °C overnight before applied for DNA analysis.

2.3 Electrochemical Measurements

Step 1, the target DNA was mixed with the biotinylated reporter probe (500 nM) in 10 mM TE buffer (pH 7.4, 10 mM Tris·HCl, 1 mM EDTA) containing 1 M NaCl for 5 min under 80 °C, and then cooled down to room temperature for 20 min. Step 2, the electrode with certain SAM was immersed into 150 µL solution from step 1 under 37 °C for 2 hr, for the hybridization between the polyA-P and the target. Step 3, the gold electrode was rinsed with the washing buffer (pH 7.4, 10 mM Tris·HCl, 1 mM EDTA containing 0.1 M NaCl) and dried lightly with N2, and then incubated with 3 µL of avidin-HRP (0.5 U/mL) for 15 min at room temperature. Finally, the sensors were rinsed again with washing buffer.

A CHI 630 electrochemical workstation (CH Instruments Inc., Austin) was applied for the cyclic voltammetry (CV), amperometry (I-t) and chronocoulometry (CC) analysis, and an Autolab TYPE Ⅲ

(Metrohm Autolab Ltd., Switzerland) was applied

for the electrochemical impedance spectroscopy (EIS) analysis. The classic three-electrode system was used throughout the experiments following a reported protocol57. Particularly, CC was carried out at a pulse period of 250 ms and pulse width of 700 mV, and the electrolyte buffer was thoroughly purged with N2 before CC experiments. EIS measurement was performed in 5 mM K3[Fe(CN)6]/K4[Fe(CN)6] (1:1) containing 0.1 M KCl by applying an alternating current (AC) voltage of 5 mV amplitude in a frequency range from 0.01 Hz to 100 kHz under open circuit potential.



3. RESULTS AND DISCUSSION

3.1 Design of polyA-based DNA sensors

In this work, we developed a novel two-dimension (2-D) DNA probe assembling strategy for the construction of a “sandwich-type” DNA biosensor on gold electrode through the strong combination between polyA and gold surface and the strategy was illustrated in Figure 1. A key element of our biosensor was the polyA-P consisted of 2 parts: a recognition block which could specifically capture the target DNA through hybridization and an anchoring block consisted of polyA which could combine to the gold electrode surface with an affinity comparable to the thiol group. Our novel label-free SAM was conveniently obtained under much lower economic cost, and of particular significance, the surface density of the probe can be easily controlled by varying the length of the polyA block. In the presence of the target DNA, the capture probe and biotinylated reporter probe formed a sandwich-like structure on the gold electrode surface, and then, the biotin-labeled reporter probe could specifically capture an avidin-HRP. With the help of a commercially purchased TMB co-substrate (H2O2 contained), the HRP enzyme could produce an enzyme catalytic signal that is quantitatively related to the amount of target DNA.


Page 8 of 30

Page 9 of 30 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Figure 1. Schematic illustration of the polyA-based electrochemical DNA biosensor.

3.2 Electrochemical impedance spectroscopy (EIS) characterization of the SAM

To investigate the establishing process of the polyA-based biosensor, EIS was performed after each step of the experiment in the solution of a classic electrochemical probe [Fe(CN)6]3-/4-. The equivalent circuit (the inset of Figure 2) was chosen to calculate the obtained impedance data. The components in the equivalent circuit included the charge-transfer resistance (Ret), Cdl related to the interfacial double layer capacity, the diffusion impedance (Zw) and the solution resistance (Rs). Ret of the electrode accounts for the diameter of the semicircle in the Nyquist plot. Figure 2 shows the results in form of Nyquist plots. The EIS of bare gold electrode exhibited a quite low electron-transfer resistance (Ret=0.5 kΩ, Figure 2a), indicating a very fast electron transfer. When polyA-P was immobilized onto the electrode surface, the EIS dramatically increased (Ret=9.2 kΩ, Figure 2b), due to an increased density of negative charge and consequently increased electrostatic repulsion for [Fe(CN)6]3-/4-



anions. Subsequently, the resulted electrode surface was treated with MCH, leading to an obvious decrease of the electron-transfer resistance (Ret=6.5 kΩ, Figure 2c), which was attributed to the competitive displacement of the unspecific adsorption of DNA molecules. Finally, the complex of target DNA and reporter probe was added to the polyA-P covered electrode, and accordingly, we observed that the electron-transfer resistance increased (Ret=8.3 kΩ, Figure 2d), indicating a fact that the hybridization brought higher density of negative charge. Interestingly, when the polyA-P modified gold electrode was treated with A5 instead of MCH, the electron-transfer resistance was even higher than polyA-P (Ret=11.0 kΩ, Figure 2e), probably because a more compact negatively charged monolayer was formed insulting the Fe(CN)6]3-/4- anions from the electrode surface with the addition of A5.

Figure 2. The Nyquist plot for electrochemical impedance measurements performed at different steps on gold electrode: (a) Bare gold, (b) after polyA30 capture probe


Page 10 of 30

Page 11 of 30 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


(polyA30-P) assembling, (c) after the MCH passivation (polyA-P/MCH), (d) after the addition of target DNA and reporter probe (polyA-P/MCH/Target/Reporter probe), (e) MCH was replaced with A5 in the passivation step (polyA-P/A5). All the experiments were performed in 5 mM K3[Fe(CN)6]/K4[Fe(CN)6] solution containing 0.1 M KCl. The concentration of the target DNA was 1 nM.

3.3 Construction of polyA-based SAM

Co-assembling of MCH for optimized eletron-transfer effect

In previously reported studies, polyA-DNA has shown the capability to precisely control its density, orientation and conformation on the surface of the nanogold particles (AuNPs), which greatly facilitates the hybridization with the target. However, when applied in the electrochemical analysis, the poor electron transfer effect was found to be a critical disadvantage toward a highly sensitive biosensor, maybe because the compact layer of DNA molecules (~2 nm) hindered the TMB substrate from penetrating the SAM and contacting the electrode surface. Thus, in our work, 2 different co-assembling molecules (MCH and A5) were tested and compared using different analysis methods for a better electron transfer effect:

CV investigation of different SAMs

When CV was performed, TMB exhibits two pairs of characteristic redox peaks on the bare gold electrode, however, when polyA-P was immobilized onto the gold electrode, the reduction peak at about 0.3 V decreased dramatically, indicating the fact



that the electron transfer was impeded (Figure 3A, blue line). Then a very similar electrochemical performance was also achieved when we immobilized A5 (3’-AAAAA-5’) together with the polyA-P on the electrode surface (polyA-P/A5) (Figure 3A, red line). In comparison, when the electrode was modified with a mixture of polyA-P and MCH, two pairs of well-defined peaks corresponding to the reduction and oxidation of TMB was observed (Figure 3A, black curve), probably because MCH competitively prevented or removed the unspecific adsorption on surface and helped the polyA probes to keep upright on the electrode surface, and thus improved the electron transfer efficiency on electrode surface (Figure 3D).

Figure 3. (A) CV curves of TMB on electrode covered with: Pure polyA-P (blue curve), polyA-P together with A5 (red curve) and polyA-P together with MCH (black curve); (B) I-t analysis results of 1 nM target DNA based on different SAMs. Error


Page 12 of 30

Page 13 of 30 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


bars represent standard deviation (SD) of three repetitive experiments; (C) Analysis results of 1 nM target DNA using different MCH deposition time; (D) Schematic illustration of the MCH co-assembling.

Electron transfer rate of different SAMs

The electron transfer rate of different SAMs in our research was then further investigated by CV in 10 mM K3Fe(CN)6 containing 0.1 M KCl. All the CV curves were shown in Figure S1. With the scan rate increased, the redox peak currents (ip) of the gold electrodes increased accordingly, accompanied by an enlarged peak-to-peak separation (∆Ep). With increased CV scan rate between (100~600) mV/s, the redox peak current increased linearly with the scan rate, indicating a typical surface-controlled electrode process. According to Laviron’s equation: ks=mnFv/RT 47, where m is a parameter related to the peak-to-peak separation, F is the Faraday constant, R is the gas constant, T is the temperature, and n is the number of electrons transferred, the electron transfer rate constant value ks was estimated to be 0.65 s-1 for bare gold electrode, 0.01 s-1 for pure polyA-P modified electrode, 0.07 s-1 for polyA-P/MCH modified electrode and 0.01 s-1 for polyA-P/A5 modified electrode, indicating the effect of MCH for an obviously optimized electron transfer rate, which is consistent with the CV curve analysis in last part.

Optimization of MCH deposition time

Next, the MCH deposition time was further studied, to achieve optimized molecular ratio between the DNA probe and MCH on the electrode surface. In this



part, the analysis effect was evaluated by analyzing 1 nM target under different MCH modification time while all other experiment conditions were fixed. As shown in Figure 3C, when MCH was added to the surface with increased reaction time from 10 min to 60 min, the background decreased dramatically because MCH replaced most of the unspecific adsorption of DNA and enzyme, and meanwhile, the signal slight decreased after 10 min maybe because some polyA-Ps were replaced by MCH molecules. Finally, we obtained the highest S/N when the MCH reaction time was 30 min, which was then adopted as the optimized experiment condition during all the following research.

I-t analysis performance of different SAMs:

Finally, when 1 nM target DNA was analyzed utilizing I-t analysis with 3 different SAM (polyA-P/MCH, Pure polyA-P and polyA-P/A5), a significantly better S/N was achieved with polyA-P/MCH sensor, which was at least 15 folds higher than which from the other two SAMs (Figure 3B). This result suggested the better electrochemical performance of the MCH-modified SAM.

3.4 Optimization of the polyA-P assembling

The length of polyA tail

The surface density of the capture probe on the electrode is recognized as an important factor for the DNA hybridization efficiency, thus, in this work, the density of the polyA-P was systematically studied through varying the length of the polyA


Page 14 of 30

Page 15 of 30 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


block in the capture probes, towards an optimized performance of our biosensor.

The assembling density of the polyA-P on the gold electrode was determined using a reported method48. Exactly as expected, the surface density decreased from 2.1 pmol/cm2 to 0.4 pmol/cm2, when the length of the polyA block in the capture probe was increased from 5 bases to 40 bases (Figure S2), since more surface area was occupied by the polyA blocks of the capture probes on the electrode.

When a sample of 1 nM target DNA was utilized to investigate the analysis performance of the biosensor with the polyA length gradually increased from polyA5 to polyA30, the current signal increased accordingly, which is a result of the better hybridization efficiency due to lower surface density. On the other hand, the background signal roughly decreased with the length of the polyA tail increased (Figure 4A), and finally, the highest S/N value was achieved with polyA30.

Figure 4. (A) Analysis results of 1 nM target DNA and blank using polyA-P with different length of polyA block (5, 10, 20, and 30 nt respectively). (B) Analysis results of target DNA (100 pM) and blank using varied concentrations of polyA30 tailed



capture probes. Error bars are SD of three repetitive experiments using three different electrodes.

The concentration of polyA30 capture probe (polyA30-P)

Then, we studied the concentration of polyA30-P which affected the final amount of capture probes on the electrode. As shown in Figure 4B, when the concentration of polyA30-P was increased, with an inevitable result of increased surface density, the electrochemical signal decreased accordingly, which was highly consistent with the study above. Finally, the highest S/N value was achieved with 0.1 µM polyA30-P, thus, in the following experiments, 0.1 µM polyA30-P was employed as an optimized condition.

3.5 Detection performance of polyA-based DNA sensor

Sensitivity of the polyA-based DNA sensor

Under the optimum conditions described above, we investigated the sensitivity of our biosensor in the presence of different concentrations of target DNA. As shown in Figure 5 and Figure S3, the electrochemical current signal obviously increased with the increase of the target DNA concentration ranging from 10 fM to 1000 pM (6 orders of magnitude). The inset histogram in Figure 5 shows the signal gain for low-concentration targets: the electrochemical current signal has a good linear relationship with the logarithm of target DNA concentration from 0.01 pM to 1 pM, with a linear correlation coefficient (R2) of 0.988: y=26.4lgx+109.6, where the x is the


Page 16 of 30

Page 17 of 30 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


concentration of DNA and y is the electrochemical current signal. The limit of detection (LOD) was thus calculated to be 5 fM, when x=S0+3δ (S0=31.73 nA is the background signal, δ=5.56 nA is the SD of S0).

Figure 5. Detection results of target DNA using our DNA sensor. The inserted histogram is the analysis results of low concentration DNA, and a buffer solution was analyzed for the blank signal. Error bars are the SD across three repetitive experiments using three different electrodes.

Regeneration and stability of the polyA-based DNA sensor

Regenerability and stability are considered as important indicators for the practicability of a biosensor. To test the regeneration of our biosensor, an electrode, which has been used once for the analysis, was treated with urea solution (8 M) to



break the DNA duplexes on electrode surface and then applied again for the analysis of 1 nM target DNA sample, and the whole process was repeated and recorded for several times. As shown in Figure 6, we compared the results from each regeneration step, and two main results are worth noting: 1) equivalent level of current signal could be recovered for at least 4 times after every “urea-cleaning” and “re-hybridization” operation, which strongly proved the fact that the conformation and amount of the capture probes on electrode surface was perfectly maintained during the regeneration process. 2) The background signal decreased to lower than 15 nA which was even better than the blank signal before hybridization, indicating that the DNA duplex and HRP enzyme was adequately removed by conveniently incubating in urea solution.

For stability investigation, the polyA30-P /MCH modified electrode was stored in TE buffer under 4 °C for 7 days, and then applied it for the analysis of 1 nM target, the current signal was found to be impressively stable with only slight signal attenuation (less than 10%), and the SD of the group of electrodes after 7-day storage was only 120 nA (Figure 6B). Benefitting from the strong combination between polyA and the gold electrode and the optimized interface status of the SAM, we successfully achieved excellent stability and reproducibility of our biosensor, which is important for the reliability and economic cost.


Page 18 of 30

Page 19 of 30 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Figure 6. (A) Regenerability test results of the polyA-based DNA sensor with 1 nM target DNA: (1) first-round detection; (2) first-round regeneration; (3) second-round detection, (4) second-round regeneration, (5) third-round detection, (6) third-round regeneration, (7) fourth-round detection, (8) fourth-round regeneration. (B) Stability test results of the PolyA-based electrochemical DNA sensor with 1nM target DNA: the left column was the initial result, and the right column was the result from an electrode which has been stored for 7 days at 4 °C.

Analysis of the PCR product from the bacterial DNA

Finally, we investigated the practicability of our biosensor by detecting the PCR product, and the E. coli DH5α genomic DNA was used as the template. In this work, asymmetric PCR was employed to produce a 250 nt single-strand DNA (ssDNA) following a reported protocol49. As shown in Figure 7, when PCR amplicons from different level of genomic DNA template was analyzed by our biosensor, the current signal increased along with the increase of the template concentration, and as few as



0.2 pg/µL DNA template in 100 µL unpurified PCR product was successfully detected, which was at least 4 orders of magnitude lower than conventional electrophoresis (Figure S4). The results strongly demonstrated the promising potential in the fast analysis for pathogenic microorganism DNA.

Figure 7. Analysis result of PCR product from E. coli genomic DNA by using the polyA-based DNA sensor.

4. CONCLUSIONS

In summary, we constructed a novel electrochemical biosensor interface, based on the high adenine-gold adsorption affinity, which was successfully applied for the development of a simple, economical and sensitive electrochemical DNA biosensor. In a considerable number of reported studies, the polyA-based assembling process has been adopted on different analysis platforms, including X-ray photoelectron spectroscopy (XPS), colorimetric50, fluorescence51, electrochemiluminescent (ECL)52 and Raman methods53, but when applied for the electrochemical DNA analysis,


Page 20 of 30

Page 21 of 30 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


several critical issues were found. Firstly, different co-assembling molecules were systematically studied among polyA-P, A5 and MCH, towards an optimized electron transfer effect, through comparison of the CV curves, electron transfer rate and finally S/N ratio, the obvious superiority of the polyA-P/MCH SAM was strongly demonstrated, Secondly, by varying the numbers of polyA in the capture probe, we modulated the surface density on electrode, and successfully improved the hybridization efficiency.

Table 2. Comparison of similar DNA biosensors based on “sandwich-type” strategies.

Number

Probes

Detection platform

Dynamic range

LOD

1

Amino-modified probe54

Electrochemi -luminescence (ECL)

2 nM-16 nM

0.6 nM

2

SH DNA probe on gold nanorod55

UV–vis spectra

0.25 nM-20 nM

/

3

SH DNA probe on gold electrode32

Electrochemistry

1pM-10 nM

1 pM

4

SH DNA probe on gold nanoparticle-modified graphene oxide56

Electrochemistry

0.37 nM-10 nM

160 pM

5

DNA nanostructural probe57

Electrochemistry

10 fM-10 nM

/

6

Amino-modified probe on silver deposited gold nanoparticles58

Electrochemistry

1.0 pM-70 pM

0.3 pM

7

SH DNA probe on gold nanoparticles59

Electrochemistry

1 pM-100 nM

1 pM

8

SH DNA probe on HRP-functionalized Fe3O4 nanoparticles60

Electrochemistry

50 pM-500 nM

7.1 pM

9

Label-free DNA probe on gold electrode (Our work)

Electrochemistry

10 fM-10 nM

5 fM



Importantly, several critical experiment conditions were optimized, including the reaction time of MCH and the concentration of the capture probe. Finally, excellent biosensor performance was obtained for the polyA-based electrochemical biosensor. Our polyA-based electrochemical biosensor successfully achieved an LOD as low as 5 fM which is quite competitive in electrochemical DNA biosensors using similar “sandwich-type” strategies (Table 2), and excellent practicability was demonstrated by analyzing a PCR product from E. coli genome with the template level of 0.2 pg/µL, and we believe the analysis capability could be further improved through introducing signal amplification strategies including nanomaterials and RCA probes. Based on the ideal electrochemical interface, our polyA-based biosensor exhibited excellent reproducibility and stability, which we believe endow the strategy with great potential for on-site analysis.

ASSOCIATED CONTENT Supporting Information：： The supporting information is available free of charge on the ACS Publications website at DOI: Corresponding authors: *Jiang Li, E-mail: [email protected]. Tel: +86 21 39194611 *Yanli Wen, E-mail: [email protected]. Tel: +86 21 38839800 *Gang Liu, E-mail: [email protected]. Tel: +86 21 38839800

NOTES


Page 22 of 30

Page 23 of 30 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


The authors declare no competing financial interest. ACKNOWLEDGMENTS This work was financially supported by the National Quality Infrastructure Program of China (2017YFF0204605), National Natural Science Foundation of China (No. 21775104, 21775102, 21675167, 21505148, U1532119 and Shanghai Rising-Star Program

(16QB1403100).

17ZR1412100

The

15ZR1448400.

Natural National

Science Key

Foundation

R&D

of

Program

Shanghai of

China

(2016YFA0400900), the Key Research Program of Frontier Sciences, CAS, Grant NO.QYZDJ-SSW-SLH031. Ali Aldalbahi would like to extend his sincere appreciation to the Deanship of Scientific Research at King Saud University for funding this work (RG-1436-005).

REFERENCES (1) Zeng, D.; Wang, Z.; Meng, Z.; Wang, P.; San, L.; Wang, W.; Aldalbahi, A.; Li, L.; Shen, J.; Mi, X. DNA Tetrahedral Nanostructure-Based Electrochemical miRNA Biosensor for Simultaneous Detection of Multiple miRNAs in Pancreatic Carcinoma. ACS Appl. Mater. Interfaces 2017, 9, 24118-24125. (2) Yang, C.; Shi, K.; Dou, B.; Xiang, Y.; Chai, Y.; Yuan, R. In Situ DNA-Templated Synthesis of Silver Nanoclusters for Ultrasensitive and Label-Free Electrochemical Detection of MicroRNA. ACS Appl. Mater. Interfaces 2015, 7, 1188-1193. (3) Dong, S.; Zhao, R.; Zhu, J.; Lu, X.; Li, Y.; Qiu, S.; Jia, L.; Jiao, X.; Song, S.; Fan, C.; Hao, R.; Song, H. Electrochemical DNA Biosensor Based on a Tetrahedral Nanostructure Probe for the Detection of Avian Influenza A (H7N9) Virus. ACS Appl. Mater. Interfaces 2015, 7, 8834-8842. (4) Hou, T.; Li, W.; Liu, X. J.; Li, F. Label-Free and Enzyme-Free Homogeneous Electrochemical Biosensing Strategy Based on Hybridization Chain Reaction: A Facile, Sensitive, and Highly Specific MicroRNA Assay. Anal. Chem. 2015, 87, 11368-11374.



(5) Gai, P. P.; Gu, C. C.; Li, H. Y.; Sun, X. Z.; Li, F. Ultrasensitive Ratiometric Homogeneous Electrochemical MicroRNA Biosensing via Target-Triggered Ru(III) Release and Redox Recycling. Anal. Chem. 2017, 89, 12293-12298. (6) Pei, H.; Liang, L.; Yao, G.; Li, J.; Huang, Q.; Fan, C. Reconfigurable Three-Dimensional DNA Nanostructures for the Construction of Intracellular Logic Sensors. Angewandte Chemie 2012, 51, 9020-9024. (7) Lapierre, M. A.; O'Keefe, M.; Taft, B. J.; Kelley, S. O. Electrocatalytic Detection of Pathogenic DNA Sequences and Antibiotic Resistance Markers. Anal. Chem. 2003, 75, 6327-6333. (8) Yang, F.; Zuo, X.; Li, Z.; Deng, W.; Shi, J.; Zhang, G.; Huang, Q.; Song, S.; Fan, C. A Bubble-Mediated Intelligent Microscale Electrochemical Device for Single-Step Quantitative Bioassays. Adv. Mater. 2014, 26, 4671-4676. (9) Ge, Z. L.; Pei, H.; Wang, L. H.; Song, S. P.; Fan, C. H. Electrochemical Single Nucleotide Polymorphisms Genotyping on Surface Immobilized Three-Dimensional Branched DNA Nanostructure. Sci. China-Chem. 2011, 54, 1273-1276. (10) Wan, Y.; Wang, P.; Su, Y.; Wang, L.; Pan, D.; Aldalbahi, A.; Yang, S.; Zuo, X. Nanoprobe-Initiated Enzymatic Polymerization for Highly Sensitive Electrochemical DNA Detection. ACS Appl. Mater. Interfaces 2015, 7, 25618-25623. (11) Yao, G.; Pei, H.; Li, J.; Zhao, Y.; Zhu, D.; Zhang, Y.; Lin, Y.; Huang, Q.; Fan, C. Clicking DNA to Gold Nanoparticles: Poly-Adenine-Mediated Formation of Monovalent DNA-Gold Nanoparticle Conjugates with Nearly Quantitative Yield. NPG Asia Mater. 2015, 7, e159. (12) Lapierre-Devlin, M. A.; Asher, C. L.; Taft, B. J.; Gasparac, R.; Roberts, M. A.; Kelley, S. O. Amplified Electrocatalysis at DNA-Modified Nanowires. Nano Lett. 2005, 5, 1051-1055. (13) Kelley, S. O.; Boon, E. M.; Barton, J. K.; Jackson, N. M.; Hill, M. G. Single-Base Mismatch Detection Based on Charge Transduction Through DNA. Nucleic Acids Res. 1999, 27, 4830-4837. (14) Fan, C. H.; Plaxco, K. W.; Heeger, A. J. Electrochemical Interrogation of Conformational Changes as A Reagentless Method for the Sequence-Specific ACS Paragon Plus Environment

Page 24 of 30

Page 25 of 30 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Detection of DNA. Proc. Natl. Acad. Sci. U. S. A. 2003, 100, 9134-9137. (15) Lin, M.; Wen, Y.; Li, L.; Pei, H.; Liu, G.; Song, H.; Zuo, X.; Fan, C.; Huang, Q. Target-Responsive, DNA Nanostructure-Based E-DNA Sensor for MicroRNA Analysis. Anal. Chem. 2014, 86, 2285-2288. (16) Liu, G.; Lao, R. J.; Xu, L.; Xu, Q.; Li, L. Y.; Zhang, M.; Shen, H.; Mathur, S.; Fan, C. H.; Song, S. P. Detection of Single-Nucleotide Polymorphism on uidA Gene of Escherichia coli by a Multiplexed Electrochemical DNA Biosensor with Oligonucleotide-Incorporated Nonfouling Surface. Sensors 2011, 11, 8018-8027. (17) Liu, G.; Lao, R. J.; Xu, L.; Xu, Q.; Li, L. Y.; Zhang, M.; Song, S. P.; Fan, C. H. Single-nucleotide

Polymorphism

Genotyping

Using

a

Novel

Multiplexed

Electrochemical Biosensor with Nonfouling Surface. Biosens. Bioelectron. 2013, 42, 516-521. (18) Ricci, F.; Lai, R. Y.; Heeger, A. J.; Plaxco, K. W.; Sumner, J. J. Effect of Molecular Crowding on the Response of An Electrochemical DNA Sensor. Langmuir : the ACS journal of surfaces and colloids 2007, 23, 6827-6834. (19) Su, S.; Cao, W. F.; Liu, W.; Lu, Z. W.; Zhu, D.; Chao, J.; Weng, L. X.; Wang, L. H.; Fan, C. H.; Wang, L. H. Dual-Mode Electrochemical Analysis of MicroRNA-21 Using Gold Nanoparticle-Decorated MoS2 Nanosheet. Biosens. Bioelectron. 2017, 94, 552-559. (20) Su, S.; Sun, H.; Cao, W.; Chao, J.; Peng, H.; Zuo, X.; Yuwen, L.; Fan, C.; Wang, L. Dual-Target Electrochemical Biosensing Based on DNA Structural Switching on Gold Nanoparticle-Decorated MoS2 Nanosheets. ACS Appl. Mater. Interfaces 2016, 8, 6826-6833. (21) Wen, Y. L.; Liu, G.; Pei, H.; Li, L. Y.; Xu, Q.; Liang, W.; Li, Y.; Xu, L.; Ren, S. Z.; Fan, C. H. DNA Nanostructure-based Ultrasensitive Electrochemical microRNA Biosensor. Methods 2013, 64, 276-282. (22) Wen, Y.; Pei, H.; Wan, Y.; Su, Y.; Huang, Q.; Song, S.; Fan, C. DNA Nanostructure-Decorated Surfaces for Enhanced Aptamer-Target Binding and Electrochemical Cocaine Sensors. Ana.l Chem. 2011, 83, 7418-7423. (23) Wen, Y.; Wang, L.; Xu, L.; Li, L.; Ren, S.; Cao, C.; Jia, N.; Aldalbahi, A.; Song, ACS Paragon Plus Environment


Page 26 of 30

S.; Shi, J.; Xia, J.; Liu, G.; Zuo, X. Electrochemical Detection of PCR Amplicons of Escherichia Coli Genome Based on DNA Nanostructural Probes and PolyHRP Enzyme. Analyst 2016, 141, 5304-5310. (24) Shi, X. M.; Fan, G. C.; Shen, Q.; Zhu, J. J. Photoelectrochemical DNA Biosensor Based on Dual-Signal Amplification Strategy Integrating Inorganic-Organic Nanocomposites Sensitization with lambda-Exonuclease-Assisted Target Recycling. ACS Appl. Mater. Interfaces 2016, 8, 35091-35098. (25) Kou, B. B.; Zhang, L.; Xie, H.; Wang, D.; Yuan, Y. L.; Chai, Y. Q.; Yuan, R. DNA Enzyme-Decorated DNA Nanoladders as Enhancer for Peptide Cleavage-Based Electrochemical Biosensor. ACS Appl. Mater. Interfaces 2016, 8, 22869-22874. (26) Zhang, J.; Song, S.; Wang, L.; Pan, D.; Fan, C. A Gold Nanoparticle-based Chronocoulometric DNA Sensor for Amplified Detection of DNA. Nat. Protoc. 2007, 2, 2888-2895. (27) Choi, J. H.; Kim, H.; Choi, J. H.; Choi, J. W.; Oh, B. K. Signal Enhancement of Silicon Nanowire-Based Biosensor for Detection of Matrix Metalloproteinase-2 Using DNA-Au Nanoparticle Complexes. ACS Appl. Mater. Interfaces 2013, 5, 12023-12028. (28) Chen, P.; Pan, D.; Fan, C.; Chen, J.; Huang, K.; Wang, D.; Zhang, H.; Li, Y.; Feng, G.; Liang, P.; He, L.; Shi, Y. Gold Nanoparticles for High-Throughput Genotyping of Long-Range Haplotypes. Nat. Nanotechnol. 2011, 6, 639-644. (29) Gui, A. L.; Luais, E.; Peterson, J. R.; Gooding, J. J. Zwitterionic Phenyl layers: Finally, Stable, Anti-Biofouling Coatings That Do Not Passivate Electrodes. ACS Appl. Mater. Interfaces 2013, 5, 4827-4835. (30) Liu, G.; Wan, Y.; Gau, V.; Zhang, J.; Wang, L.; Song, S.; Fan, C. An Enzyme-Based E-DNA Sensor for Sequence-Specific Detection of Femtomolar DNA Targets. J. Am. Chem. Soc. 2008, 130, 6820-6825. (31) Das, J.; Ivanov, I.; Sargent, E. H.; Kelley, S. O. DNA Clutch Probes for Circulating Tumor DNA Analysis. J. Am. Chem. Soc. 2016, 138, 11009-11016. (32) Zhang, J.; Lao, R.; Song, S.; Yan, Z.; Fan, C. Design of An Oligonucleotide-Incorporated

Nonfouling

Surface


and

Its

Application

in

Page 27 of 30 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Electrochemical DNA Sensors for Highly Sensitive and Sequence-Specific Detection of Target DNA. Anal. Chem. 2008, 80, 9029-9033. (33) Zhang, J.; Wang, L. H.; Pan, D.; Song, S. P.; Fan, C. H. DNA Hybridization "turns on'' Electrocatalysis at Gold Electrodes. Chem. Commun. (Cambridge, U. K.) 2007, 1154-1156. (34) Herne, T. M.; Tarlov, M. J. Characterization of DNA Probes Immobilized on Gold Surfaces. J. Am. Chem. Soc. 1997, 119, 8916-8920. (35) Lao, R.; Song, S.; Wu, H.; Wang, L.; Zhang, Z.; He, L.; Fan, C. Electrochemical Interrogation of DNA Monolayers on Gold Surfaces. Anal. Chem. 2005, 77, 6475-6480. (36) Schreiner, S. M.; Shudy, D. F.; Hatch, A. L.; Opdahl, A.; Whitman, L. J.; Petrovykh, D. Y. Controlled and Efficient Hybridization Achieved with DNA Probes Immobilized Solely through Preferential DNA-Substrate Interactions. Anal. Chem. 2010, 82, 2803-2810. (37) Opdahl, A.; Petrovykh, D. Y.; Kimura-Suda, H.; Tarlov, M. J.; Whitman, L. J. Independent Control of Grafting Density and Conformation of Single-Stranded DNA Brushes. Proc. Natl. Acad. Sci. U. S. A. 2007, 104, 9-14. (38) Koo, K. M.; Sina, A. A. I.; Carrascosa, L. G.; Shiddiky, M. J. A.; Trau, M. DNA-Bare Gold Affinity Interactions: Mechanism and Applications in Biosensing. Anal. Methods 2015, 7, 7042-7054. (39) Koo, K. M.; Sina, A. A. I.; Carrascosa, L. G.; Shiddiky, M. J. A.; Trau, M. DNA-bare Gold Affinity Interactions: Mechanism and Applications in Biosensing. Anal. Methods 2015, 7, 7042-7054. (40) Liu, P.; Wang, D. D.; Zhou, Y. L.; Wang, H. Y.; Yin, H. S.; Ai, S. Y. DNA Methyltransferase Detection based on Digestion Triggering the Combination of Poly Adenine DNA with Gold Nanoparticles. Biosens. Bioelectron. 2016, 80, 74-78. (41) Kimura-Suda, H.; Petrovykh, D. Y.; Tarlov, M. J.; Whitman, L. J. Base-dependent Competitive Adsorption of Single-stranded DNA on Gold. J. Am. Chem. Soc. 2003, 125, 9014-9015. (42) Pei, H.; Li, F.; Wan, Y.; Wei, M.; Liu, H. J.; Su, Y.; Chen, N.; Huang, Q.; Fan, C. ACS Paragon Plus Environment


H. Designed Diblock Oligonucleotide for the Synthesis of Spatially Isolated and Highly Hybridizable Functionalization of DNA-Gold Nanoparticle Nanoconjugates. J. Am. Chem. Soc. 2012, 134, 11876-11879. (43) Wu, C. T.; Zhou, C. Y.; Wang, E. K.; Dong, S. J. A Label-free and Enzyme-free System for Operating Various Logic Devices Using Poly(thymine)-templated CuNPs and SYBR Green I as Signal Transducers. Nanoscale 2016, 8, 14243-14249. (44) Wang, C. G.; Zhang, H.; Zeng, D. D.; Sun, W. L.; Zhang, H. L.; Aldalbahi, A.; Wang, Y. S.; San, L. L.; Fan, C. H.; Zuo, X. L.; Mi, X. Q. Elaborately Designed Diblock Nanoprobes for Simultaneous Multicolor Detection of MicroRNAs. Nanoscale 2015, 7, 15822-15829. (45) Yang, X.; Li, J.; Pei, H.; Zhao, Y.; Zuo, X.; Fan, C.; Huang, Q. DNA-gold Nanoparticle Conjugates-based Nanoplasmonic Probe for Specific Differentiation of Cell Types. Anal. Chem. 2014, 86, 3227-3231. (46) Chen, N.; Wei, M.; Sun, Y.; Li, F.; Pei, H.; Li, X.; Su, S.; He, Y.; Wang, L.; Shi, J.; Fan, C.; Huang, Q. Self-assembly of Poly-adenine-tailed CpG Oligonucleotide-gold Nanoparticle Nanoconjugates with Immunostimulatory Activity. Small 2014, 10, 368-375. (47) Laviron, E. General Expression of the Linear Potential Sweep Voltammogram in the Case of Diffusionless Electrochemical Systems. J. Electroanal. Chem. 1979, 101, 19-28. (48) Steel, A. B.; Herne, T. M.; Tarlov, M. J. Electrochemical Quantitation of DNA Immobilized on Gold. Anal. Chem. 1998, 70, 4670-4677. (49) Lai, R. Y.; Lagally, E. T.; Lee, S. H.; Soh, H. T.; Plaxco, K. W.; Heeger, A. J. Rapid, Sequence-specific Detection of Unpurified PCR Amplicons via a Reusable, Electrochemical Sensor. Proc. Natl. Acad. Sci. U. S. A. 2006, 103, 4017-4021. (50) Chen, L. Z.; Chao, J.; Qu, X. M.; Zhang, H. B.; Zhu, D.; Su, S.; Aldalbahi, A.; Wang, L. H.; Pei, H. Probing Cellular Molecules with PolyA-Based Engineered Aptamer Nanobeacon. ACS Appl. Mater. Interfaces 2017, 9, 8014-8020. (51) Zhou, C. Y.; Wu, C. T.; Liu, Y. Q.; Wang, E. K. Effective Construction of a AuNPs-DNA System for the Implementation of Various Advanced Logic Gates. RSC ACS Paragon Plus Environment

Page 28 of 30

Page 29 of 30 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Adv. 2016, 6, 106641-106647. (52) Guillou, F.; Porcari, G.; Yibole, H.; van Dijk, N.; Bruck, E. Taming the first-order transition in giant magnetocaloric materials. Adv. Mater. 2014, 26, 2671-2675. (53) Hu, C. Y.; Shen, J. L.; Yan, J.; Zhong, J.; Qin, W. W.; Liu, R.; Aldalbahi, A.; Zuo, X. L.; Song, S. P.; Fan, C. H.; He, D. N. Highly Narrow Nanogap-containing Au@Au Core-shell

SERS

Nanoparticles:

Size-dependent

Raman

Enhancement

and

Applications in Cancer Cell Imaging. Nanoscale 2016, 8, 2090-2096. (54) Spehar-Délèze, A.-M.; Gransee, R.; Martinez-Montequin, S.; Bejarano-Nosas, D.; Dulay, S.; Julich, S.; Tomaso, H.; O’Sullivan, C. K. Electrochemiluminescence DNA Sensor Array for Multiplex Detection of Biowarfare Agents. Anal. Bioanal. Chem. 2015, 407, 6657-6667. (55) Parab, H. J.; Jung, C.; Lee, J.-H.; Park, H. G. A Gold Nanorod-based Optical DNA Biosensor for the Diagnosis of Pathogens. Biosens. Bioelectron. 2010, 26, 667-673. (56) Saeed, A. A.; Sánchez, J. L. A.; O'Sullivan, C. K.; Abbas, M. N. DNA Biosensors Based on Gold Nanoparticles-modified Graphene Oxide for the Detection of Breast Cancer Biomarkers for Early Diagnosis. Bioelectrochemistry 2017, 118, 91-99. (57) Wen, Y.; Wang, L.; Xu, L.; Li, L.; Ren, S.; Cao, C.; Jia, N.; Aldalbahi, A.; Song, S.; Shi, J.; Xia, J.; Liu, G.; Zuo, X. Electrochemical Detection of PCR Amplicons of Escherichia Coli Genome Based on DNA Nanostructural Probes and PolyHRP Enzyme. Analyst (Cambridge, U. K.) 2016, 141, 5304-5310. (58) Zhang, Y.; Geng, X.; Ai, J.; Gao, Q.; Qi, H.; Zhang, C. Signal Amplification Detection of DNA using a Sensor Fabricated by One-step Covalent Immobilization of Amino-terminated Probe DNA onto the Polydopamine-modified Screen-printed Carbon Electrode. Sens. Actuators, B 2015, 221, 1535-1541. (59) Liu, J.; Tian, M.; Liang, Z. DNA Analysis Based on the Electrocatalytic Amplification of Gold Nanoparticles. Electrochim. Acta 2013, 113, 186-193. (60) Dong, X.-Y.; Mi, X.-N.; Wang, B.; Xu, J.-J.; Chen, H.-Y. Signal Amplification for DNA Detection Based on the HRP-functionalized Fe3O4 Nanoparticles. Talanta 2011, 84, 531-537. ACS Paragon Plus Environment


Table of Contents (TOC) graphic


Page 30 of 30

Bacterial Analysis Using an Electrochemical DNA Biosensor with Poly

Recommend Documents