Bait-and-Switch Supramolecular Strategy To Generate Noncationic

Subscriber access provided by Imperial College London | Library

Article

A Bait-and-Switch Supramolecular Strategy to Generate Non-cationic RNA-Polymer Complexes for RNA Delivery Ziwen Jiang, Wei Cui, Priyaa Prasad, Mollie A. Touve, Nathan C. Gianneschi, Jesse Mager, and S. Thayumanavan Biomacromolecules, Just Accepted Manuscript • DOI: 10.1021/acs.biomac.8b01321 • Publication Date (Web): 07 Dec 2018 Downloaded from http://pubs.acs.org on December 7, 2018

Just Accepted “Just Accepted” manuscripts have been peer-reviewed and accepted for publication. They are posted online prior to technical editing, formatting for publication and author proofing. The American Chemical Society provides “Just Accepted” as a service to the research community to expedite the dissemination of scientific material as soon as possible after acceptance. “Just Accepted” manuscripts appear in full in PDF format accompanied by an HTML abstract. “Just Accepted” manuscripts have been fully peer reviewed, but should not be considered the official version of record. They are citable by the Digital Object Identifier (DOI®). “Just Accepted” is an optional service offered to authors. Therefore, the “Just Accepted” Web site may not include all articles that will be published in the journal. After a manuscript is technically edited and formatted, it will be removed from the “Just Accepted” Web site and published as an ASAP article. Note that technical editing may introduce minor changes to the manuscript text and/or graphics which could affect content, and all legal disclaimers and ethical guidelines that apply to the journal pertain. ACS cannot be held responsible for errors or consequences arising from the use of information contained in these “Just Accepted” manuscripts.

is published by the American Chemical Society. 1155 Sixteenth Street N.W., Washington, DC 20036 Published by American Chemical Society. Copyright © American Chemical Society. However, no copyright claim is made to original U.S. Government works, or works produced by employees of any Commonwealth realm Crown government in the course of their duties.

Page 1 of 27 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biomacromolecules

A Bait-and-Switch Supramolecular Strategy to Generate Non-cationic RNA-Polymer Complexes for RNA Delivery Ziwen Jiang,1† Wei Cui,2,4,† Priyaa Prasad,1 Mollie A. Touve,5,6 Nathan C. Gianneschi,5,6 Jesse Mager,*2,4 S. Thayumanavan*1,3,4 1

Department of Chemistry, 2Department of Veterinary and Animal Sciences, 3Molecular and Cellular

Biology Program, 4Center for Bioactive Delivery at the Institute for Applied Life Sciences, University of Massachusetts, Amherst, Massachusetts 01003, United States 5

6

Department of Chemistry, Northwestern University, Evanston, Illinois 60208, United States

Department of Chemistry and Biochemistry, University of California San Diego, La Jolla, California 92093, United States

ACS Paragon Plus Environment

Biomacromolecules 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 2 of 27

ABSTRACT

RNA interference (RNAi) requires the intracellular delivery of RNA molecules to initiate the neutralization of targeted mRNA molecules, inhibiting the expression or translation of the targeted gene. Current polymers and lipids that are used to deliver RNA molecules are generally required to be positively charged, to achieve complexation with RNA and the cellular internalization. However, cationic surface charge has been implicated as the reason for toxicity in many of these systems. Herein, we report a novel strategy to generate non-cationic RNA-polymer complexes for RNA delivery with low cytotoxicity. We use an in situ electrostatic complexation using a methylated pyridinium group, which is simultaneously removed during the RNA binding step. The resultant complexes demonstrate successful knockdown in preimplantation mammalian embryos, thus providing a new approach for nucleic acid delivery.


Page 3 of 27 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biomacromolecules

Introduction Nucleic acid-based therapeutics provide a useful toolkit for gene knockdown and genome editing.1-3 Several technologies have been discovered and developed for gene therapy, including antisense therapy,4 RNA interference (RNAi),5 zinc-finger nucleases (ZFNs),6 transcription activator-like effector nucleases (TALEN),7 and CRISPR.8 From a therapeutic perspective, RNAi has attracted lots of attention since its discovery ~20 years ago,9 as evidenced by the more than twenty RNAi-based therapeutics in clinical trials for cancer therapy and genetic disorders.10-12 The process of RNAi starts with the introduction or expression of double-stranded RNA (dsRNA) within cells, followed by binding to the target messenger RNA (mRNA) in the cytosol, leading to the sequence-specific cleavage and degradation of the target mRNA and therefore achieving gene specific knockdown.13, 14 The bottleneck in translating this powerful approach to an effective therapeutic strategy involves the ability to efficiently deliver dsRNA into the cytosol.15, 16 Bare nucleic acids are too hydrophilic and charged to pass through the cellular membrane, in addition to their susceptibility to degradation by the nucleases.11, 17,18, 19 Physical methods, such as microneedle injection and electroporation, are efficient, but create defects on cellular membranes due to excessive force.20, 21 Among the non-physical methods, approaches can be broadly classified into viral and non-viral delivery systems. Viral vectors are highly efficient in delivering the nucleic acid cargo to the cytosol, whereas the possibility of immune responses has tempered the development of viable candidates.1, 17, 22-28 Synthetic delivery vehicles, such as lipids and polymers, have been designed as alternatives to minimize immune responses.29,

30

Electrostatic

interactions between the anionic backbone of the nucleic acids and the cationic charge in the polymers or lipids have been the primary mode of developing such nanoparticles.17 However, the overall cationic charge of these polyplexes or lipoplexes has been widely implicated in their cytotoxicity, as these cationic moieties could damage the integrity of cell membranes and mitochondrial membranes.31-34



Page 4 of 27

Scheme 1. Formation of the non-cationic RNA-polymer complex.

While viruses present problems associated with potential immunogenicities, we were inspired by the fact that they do not use extensive positive charge density to encapsulate the nucleic acids. In fact, there are reports that suggest that the lack of charge compensation in nanoscopic space could be part of the “electrostatic pressure” driving force for the nucleic acids to be rapidly ejected from them into the host cells upon surface binding.35 Therefore, we were interested in exploring a strategy in which a nanoassembly could “incarcerate” RNA without the need for electrostatic compensation. Here, we report a strategy that uses electrostatic interactions temporarily in order to “trick” the nucleic acid to complex with the polymer, but remove the positive charge while retaining the nucleic acid in the nanoparticle (Scheme 1). Specifically, we use a methacrylate random copolymer P1 in which the comonomers are based on a cationic methylated pyridyl disulfide (MPDS) side chain moiety and a chargeneutral oligoethylene glycol (OEG) unit (Figure 1). The methylated version of the MPDS unit serves two


Page 5 of 27 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biomacromolecules

purposes – first, it bears a cationic charge and therefore provides charge complementarity. Second, we envisaged that the reactivity of this disulfide functionality to be similar to that of the unmethylated pyridyl disulfide unit, in that it will undergo a thiol-disulfide exchange to release the stable and unreactive Nmethyl-2-pyridothione byproduct. Since the methylated version does not present a thiol in the tautomer form, such a reaction might even be more efficient. We hypothesized that the combination of these two features offer the possibility of non-covalently trapping the nucleic acid into the nanoassembly, during the crosslinking reaction. Here, the polymer would bind with RNA via electrostatic interaction to form a polyelectrolyte complex. Such complex will be subsequently self-crosslinked through the addition of dithiothreitol (DTT),36 forming a disulfide-crosslinked polymer-RNA complex while concurrently eliminating most of the cationic moieties. Rather than partially maintaining the cationic moeities,37, 38 the resultant complex and should be non-cationic, has the dsRNA sterically trapped inside the nanoassembly. We present the syntheses, characterization, knockdown efficiency, and cytotoxicity of such a complex.

Experimental section General methods Materials and reagents were obtained from commercial sources without further purification. 1H NMR and 13C NMR spectra were obtained from a Bruker AdvanceIII 400 NMR spectrometer or a Bruker AvanceIII 500 NMR spectrometer. Gel permeation chromatography (GPC) was performed on an Agilent 1260 LC, using THF as the eluent. Molecular weights are versus polystyrene standards. Dynamic light scattering and zeta potential was measured on a Malvern Zetasizer Nano ZS. Absorption spectra were acquired on a Perkin Elmer Lambda 35 UV/Vis Spectrophotometer. The infrared spectra were collected on a Bruker Alpha FT-IR Spectrometer with a spectral range from 3500 cm−1 to 400 cm−1.



Page 6 of 27

Thermogravimetric analysis was performed under N2 flow from room temperature to 600 °C using a TA Instrument Q50 thermogravimetric analyzer. Bright-field microscope images were obtained from a Nikon Eclipse-Ti microscope. Mass spectral data were obtained at the University of Massachusetts Mass Spectrometry Center. The comparison between the experimental groups was performed with GraphPad Prism 7.00 (GraphPad Software, Inc., San Diego, CA) using unpaired T-test. Difference between groups was considered to be significant when P < 0.05. Cryogenic electron microscopy (CryoEM). CryoEM was performed on a FEI Sphera microscope operating at 200 keV. Before depositing the sample, CryoEM grids (Quantifoil R2/2 TEM grids) had previously been glow discharged using an Emitech K350 glow discharge unit and plasmacleaned for 90 s in an E.A. Fischione 1020 unit. After depositing 4 µL of sample onto the CryoEM grid, the grid was blotted with filter paper under high humidity to create thin films, then rapidly plunged into liquid ethane. The grids were transferred to the microscope under liquid nitrogen and kept at ˂ -175 °C while imaging. Images were recorded on a 2k × 2k Gatan CCD camera. N-methylation reaction of PEG-PDS random copolymers Pyridyl disulfide ethyl methacrylate (PDS) monomer was synthesized according to a previous report.39 Reversible addition-fragmentation chain-transfer (RAFT) polymerization for PEG-PDS random copolymers or PDS homopolymers were conducted following a previous report.36 Four PEG-PDS copolymers were synthesized: P1’, the average molecular weight of poly(ethylene glycol) methyl ether methacrylate is 300 g·mol-1; P2’, P3’, the average molecular weight of poly(ethylene glycol) methyl ether methacrylate is 500 g·mol-1. P1’, P2’, and P3’ were methylated using the following procedures, forming the methylated polymers: P1, P2, and P3, respectively.


Page 7 of 27 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biomacromolecules

The procedure of N-methylation reaction on PEG-PDS copolymers or PDS homopolymer was adapted from a previous report.40 Generally, 1.1 equiv. of methyl trifluoromethanesulfonate (vs. the moles of PDS group) was added to the dichloromethane solution of PEG-PDS copolymers or PDS homopolymers. After stirring for 2 hrs at room temperature, the solvent was evaporated in vacuo. The residue was dissolved in methanol and precipitated against diethyl ether for three times. The precipitated solid/oil was dried in vacuo. The molar ratio between two blocks was determined by integrating the methoxy proton (δ 3.3) in the polyethylene glycol unit and the aromatic proton in the pyridine. The characterization of polymers are available in the Supplementary Information. Preparation of dsRNA DNA template for T7-RNA polymerase mediated dsTuba1a was amplified from B6D2F1 mouse genomic DNA using primers containing T7 binding sequences followed by gene specific sequences for Tuba1a

(5′-TAATACGACTCACTATAGGGGCACTCTGATTGTGCCTTCA

and

5′-

TAATACGACTCACTATAGGGTGACATCTTTGGGAACCACA), and template sequence is: GCACTCTGATTGTGCCTTCATGGTAGACAATGAGGCCATCTATGATATCTGTCGTAGAAACCTCGACAT TGAGCGCCCAACCTACACTAACCTAAACAGGTTGATAGGTCAAATTGTGTCTTCCATCACTGCTTCCCT CAGATTTGATGGGGCCCTGAATGTTGATCTGACAGAATTCCAGACCAACCTGGTACCCTACCCTCGTAT CCACTTCCCTCTGGCCACTTATGCCCCTGTCATCTCTGCTGAGAAAGCCTACCACGAGCAGCTTTCTGT AGCAGAGATCACCAATGCCTGCTTTGAGCCAGCCAACCAGATGGTGAAATGTGACCCTCGCCATGGTAA ATACATGGCTTGCTGCCTGCTGTACCGTGGTGATGTGGTTCCCAAAGATGTCA. DNA template for T7-RNA polymerase mediated dsGFP was amplified from H2B-GFP plasmid (Addgene, #11680) using primers containing T7 binding sequences followed by gene specific sequences



for

GFP

(5′-TAATACGACTCACTATAGGGCACATGAAGCAGCACGACTT

Page 8 of 27

and

5′-

TAATACGACTCACTATAGGGTGCTCAGGTAGTGGTTGTCG), and template sequence is: CACATGAAGCAGCACGACTTCTTCAAGTCCGCCATGCCCGAAGGCTACGTCCAGGAGCGCACCATCTTC TTCAAGGACGACGGCAACTACAAGACCCGCGCCGAGGTGAAGTTCGAGGGCGACACCCTGGTGAACCGC ATCGAGCTGAAGGGCATCGACTTCAAGGAGGACGGCAACATCCTGGGGCACAAGCTGGAGTACAACTAC AACAGCCACAACGTCTATATCATGGCCGACAAGCAGAAGAACGGCATCAAGGTGAACTTCAAGATCCGC CACAACATCGAGGACGGCAGCGTGCAGCTCGCCGACCACTACCAGCAGAACACCCCCATCGGCGACGGC CCCGTGCTGCTGCCCGACAACCACTACCTGAGCA. PCR products were then purified by QIAquick PCR Purification Kit (Qiagen, Hilden, Germany). In vitro transcription (IVT) was performed using a MEGAscript T7 Kit (Ambion, Waltham, MA) following the manufacturer’s instructions and TURBO RNase-free DNase was added to IVT product to degrade the DNA template. The in vitro transcribed sense and antisense single-stranded RNAs anneal during IVT (which was performed at 37 °C) to form dsRNA. dsRNA was then passed through NucAway Spin Columns (Ambion, Waltham, MA) to remove salt and unincorporated nucleotides. dsRNA was extracted with phenol/chloroform (Sigma-Aldrich, St. Louis, MO) and precipitated with 70% ethanol and resuspended in RNase-free water (Integrated DNA Technologies, Coralville, IA). The quality of dsRNA was confirmed by electrophoresis both after IVT and after final precipitation. The dsRNA concentration was measured using NanoDrop (Thermo Scientific, Waltham, MA) and dsRNA was stored at −80 °C until use. RNA-polymer complexation and crosslinking The optimal dosage for the complexation between polymer (P1, P2, or P3) and dsRNA was based on the optimization of N/P ratio. For the calculation of N/P ratios, 325 Da was used as the average mass


Page 9 of 27 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biomacromolecules

per charge for double-stranded RNA. The average mass per charge for P1, P2, and P3 was 351 Da, 447 Da, and 429 Da, respectively. In each well, 100 ng dsRNA was added into phosphate buffer (5 mM, pH = 7.4). An increasing amount of polymer (P1, P2, or P3, 5 mg·mL-1 stock solution prepared in nucleasefree water) was added afterwards to increase the N/P ratio. The final volume of each polymer-RNA mixture solution was 30 µL. The mixture was incubated at room temperature for 30 min. The complexation between polymer and dsRNA was evaluated using electrophoresis on 2% agarose gel with 1x Tris-acetateEDTA (TAE) running buffer at 72 V for 25 min (Thermo Electron Corporation EC-105 Compact Power Supply). dsRNA was visualized with ethidium bromide. After obtaining the optimal N/P ratio (40/1) of P3, dithiothreitol (DTT)-induced crosslinking was also evaluated with gel electrophoresis. In particular, 10 µL DTT solution with an increasing equivalence (0.5 equiv. DTT ~ 1 equiv. methylated pyridyl group in P3) was added to the pre-formed 30 µL P3-dsRNA complex. The mixture was incubated at room temperature for 30 min and then evaluated with gel electrophoresis. Glutathione (GSH)-triggered dsRNA release The procedure for GSH-triggered dsRNA release was based on the formulation of crosslinked P3dsRNA complexes. With 1.5 equiv. DTT added, the 40 µL solution contains P3-dsRNA crosslinked complexes. To evaluate the redox-responsive capability of the complex, 10 µL GSH stock solution was added into the previous 40 µL solution to obtain a 50 µL solution, with the final GSH concentration at either 10 µM or 10 mM. The concentration of GSH was chosen within the previously reported extracellular or intracellular range.41, 42 Each sample was incubated at room temperature and 10 µL solution was collected at 2-hr, 12-hr, and 24-hr timepoint. The dsRNA release was evaluated using similar electrophoresis procedures as above. In Figure 2, “-” represents the absence of the corresponding substance. In such cases, phosphate buffer (5 mM, pH =7.4) was used to make sure that the total volume of each sample was same.



Page 10 of 27

General procedure for cell culture Cell culture. HeLa cells or primary mouse embryo fibroblasts were cultured in a humidified atmosphere (5% CO2) at 37 °C. The cells were grown and passaged in Dulbecco’s modified eagle’s medium (DMEM) supplemented with 10% fetal bovine serum (FBS) and 1% antibiotics (1x antibioticantimycotic solution, 3 µg·mL-1 gentamicin). Cell viability assay (AlamarBlue®). 15,000 HeLa cells, or primary mouse embryo fibroblasts were cultured in a 96-well plate for 24 hr prior to the experiment. To evaluate the cytotoxicity of the polymer, P3NEU was prepared by DTT-induced crosslinking P3 without the presence of dsRNA. After crosslinking, the sample was purified and concentrated with an Amicon Ultra centrifugal filter unit (MWCO 3 kDa). Different amount of P3NEU was diluted by DMEM containing 10% FBS and 1% antibiotics and incubated with the cells for 24 hr. After washing with phosphate buffer saline three times, the cells were incubated with 200 µL DMEM containing 10% alamarBlue® reagent for 1.5 h. Cell viability was calculated by measuring the fluorescence intensity of alamarBlue® at 590 nm, with an excitation wavelength at 535 nm. Embryo recovery and culture All animal experimental protocols were approved by the Institutional Animal Care and Use Committee of the University of Massachusetts, Amherst (approval No. 2013-009; 2016-0010). All procedures and methods were carried out in accordance with the approved guidelines and regulations. B6D2F1 female mice, 8 to 10 weeks old, were induced to superovulate with 5 IU pregnant mare serum gonadotropin (PMSG, Sigma-Aldrich, St. Louis, MO), followed 48 hr later by 5 IU human chorionic gonadotropin (hCG, Sigma-Aldrich, St. Louis, MO). After hCG injection, females were mated with B6D2F1 males and euthanized at 20 hr post-hCG injection for zygotes collection from the oviducts.


Page 11 of 27 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biomacromolecules

Oviductal ampullae were dissected to release zygotes, and cumulus cells were removed by pipetting in M2 medium containing hyaluronidase (EMD Millipore, Billerica, MA). Zygotes were then washed in M2 medium (EMD Millipore, Billerica, MA) and cultured in BSA-free KSOM medium (EMD Millipore, Billerica, MA) supplemented with different groups (Figure 4) according to the experimental design (dsRNA was at a final concentration of 0.8 ng·µL-1, polymer was at a final concentration of 42 ng·µL-1), at 37 °C in a humidified atmosphere of 5% CO2/5% O2 balanced in N2. All cultured embryos were observed daily. Real-time quantitative reverse transcription PCR (qRT-PCR) Total RNA extraction was performed with a High Pure RNA Isolation Kit (# 11828665001, Roche, Basel, Switzerland). cDNA was synthesized using iScript cDNA synthesis kit (Bio-Rad Laboratories, Hercules, CA, 170-8891). Quantitative PCR was performed on a Stratagene MX3005p using TaqMan Gene Expression Assays (Life Technologies, Carlsbad, CA) and PerfeCTa qPCR Mix with low ROX (Quanta Biosciences, Gaithersburg, MD)-based reactions. Quantification of Tuba1a expression between control and treatment groups was normalized to Gapdh. qRT-PCR reactions were run with a minimum of three replicates under the following conditions: 1 cycle of 50 °C for 30 sec; 1 cycle of 95 °C for 2 min; then 45 cycles of 15 sec at 95 °C and 30 sec at 60 °C. The TaqMan probes used were: Gapdh, 4352339E; and Tuba1a, Mm00846967_g1.

Results Quantitative N-methylation of pyridyldisulfide (PDS) moieties in polymer



Page 12 of 27

To synthesize the polymer P1, we first prepared polymer P1’ containing OEG units and pyridyldisulfide (PDS) moieties using reversible addition-fragmentation chain transfer (RAFT) polymerization [see SI for details]. N-Methylation of the PDS units in this polymer would convert this moiety to the targeted MPDS moiety in P1, which was accomplished by treating P1’ with 1.1 equivalents of methyl triflate,40 with respect to the PDS units (Figure 1a). The high conversion of P1’ to P1 was ascertained from the chemical shifts in the aromatic protons and the appearance of the new methyl peak in 1H NMR (Figure S1). The ratio of OEG and PDS units in this polymer was systematically varied. Each of these copolymers were further methylated using the same post-methylation protocol (Table S1).

Figure 1. (a) The methylation reaction of PEG-PDS random copolymer (P1-P3). (b) The optimization of N/P ratio for complete complexation between P3 and dsTuba1a. (c) Cryo-TEM image of P3-dsTuba1a crosslinked complex. The scale bar represents 100 nm. (d) Dynamic light scattering and (e) zeta potential results throughout the RNApolymer complex formulation process.


Page 13 of 27 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biomacromolecules

Dithiothreitol-induced crosslinking and in situ removal of cationic moieties Next, we evaluated the complexation between the methylated polymers and dsRNA. dsRNA of Tuba1a (dsTuba1a43) was used as the model nucleic acid. N/P ratio is generally used to represent the molar ratio between the positive charge on the MPDS units of the polymer and the negative charge on the phosphate groups of nucleic acid.44 To obtain the optimal dosage for RNA-polymer complexation, we varied the N/P ratio by increasing concentrations of cationic polymers. To achieve complete complexation with dsRNA, the dosage requirement for polymer decreased with increasing the positive charge density of the polymer (Figure 1b, Figure S2). P3, with an x:y of 88:12 in the polymer, was chosen for the following studies due to its smaller dosage requirement to complex with dsTub1a. To provide a covalent “cage” for RNA within the complex, the polyelectrolyte complex between P3 and dsTub1a was crosslinked via DTT-induced thiol-disulfide exchange reaction. We hypothesized that the cationic moieties would be eliminated during the crosslinking reaction. To test our hypothesis, the size and the surface charge of P3-dsTuba1a complexes at the optimal N/P ratio (40/1) were measured before and after the crosslinking reaction. From the size changes observed in dynamic light scattering (DLS) measurement (Figure 1d), the polyelectrolyte complex (Figure S3) between P3 and dsTuba1a was ~30 nm after DTT-induced crosslinking (Figure S4). Zeta potential measurements showed the corresponding change in charge throughout the complexation and crosslinking processes. Before complexing with nucleic acids, P3 was positively charged in water. At the optimal N/P ratio, the polyelectrolyte complex between P3 and dsTuba1a was neutral with minimal dosage of polymers required. Upon the DTT-induced crosslinking, the complex turned to negatively charged, presumably due to the phosphate groups on nucleic acids (Figure 1e). Extent of crosslinking in these processes was measured using the distinct



Page 14 of 27

spectroscopic signature that arise from the byproduct of the crosslinking reaction, N-methyl-2pyridinethione (Figure S5, S7, and S8). The thiol-disulfide exchange reaction between our methylated polymers and thiol-reactants was confirmed to be quantitative using 1H NMR (Figure S6). Disulfide crosslinks allow glutathione-triggered RNA release

Figure 2. Glutathione (GSH)-triggered release of dsTuba1a from P3-dsTuba1a crosslinked complex. “+” represents the addition of the corresponding substance, “-” represents the absence of the corresponding substance; “mM” represents 10 mM and “µM” represents 10 µM. RNA, dsTuba1a. DTT, dithiothreitol.

Note that the DTT-induced crosslinking reaction results in disulfide crosslinks, facilitating redoxresponsive features in the polymer-RNA complex. Glutathione (GSH) is an essential tripeptide, the average intracellular concentration (2-10 mM) of which is ~100 to 1000 times higher than that in extracellular fluids (2-20 µM).41,42 The possibility of GSH-triggered release was monitored by agarose gel electrophoresis (Figure 2). Since polymer-RNA complex does not migrate in an agarose gel, the


Page 15 of 27 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biomacromolecules

appearance of dsTuba1a band from the complex sample indicates the release of nucleic acid. Over 24hour incubation, dsTuba1a release was clearly observed in the presence of 10 mM GSH, while the dsTuba1a release was negligible in the presence of 10 µM GSH during the same time period (Figure S9). As a control, the crosslinked polymer-RNA complex was stable without the presence of GSH. In contrast, though P3-dsTuba1a polyelectrolyte without crosslinking was stable in the initial 2 hours, dsTuba1a eventually released from the complex by 12 hours, indicating that disulfide crosslinks play a key role in the stability of the complex.

Eliminating positive charges significantly reduces cytotoxicity of delivery vehicles The cytotoxicity of the polymeric material is hypothesized to be significantly reduced, because of the non-cationic nature of the assembly. Lipofectamine 2000 is a commonly used commercial transfection reagent, facilitating the intracellular delivery of nucleic acids.45 The formulation of Lipofectamine 2000 is based on cationic liposomes. Previous studies have shown that the non-cationic feature of delivery vehicles indeed have reduced cytotoxicity comparing to cationic lipids at the same dosage.46, 47We compared the cytotoxicity of P3 after the cleavage of cationic moieties (P3Neu) with Lipofectamine 2000. First, we evaluated the viability of HeLa cells in the presence of varied concentrations of P3Neu and Lipofectamine 2000, respectively (Figure 3a). More than 80% HeLa cell viability was observed in P3Neu ranging from 0.1 µg·mL-1 to 100 µg·mL-1. In contrast, the cell viability was reduced to ~50% in the presence of 10 µg·mL-1 of Lipofectamine 2000. At 100 µg·mL-1 dosage of Lipofectamine 2000, HeLa cells were not viable after 24-hour incubation. To further validate the reduced cytotoxicity of P3Neu, we compared the cytotoxicity of P3Neu and Lipofectamine 2000 on primary mouse embryo fibroblasts (Figure 3b). A similar cytotoxicity profile was observed. The cell death caused by cationic liposomes has been



Page 16 of 27

demonstrated to primarily occur through apoptosis.48 Other than cell death, multiple cytotoxic effects can also be induced by cationic materials, including cell shrinking, reduced number of mitosis, and cytoplasmic vacuolation.33 For long-term biological fate, as the major component of the complex, methacrylate-derivatized PEG moieties are expected to have a slow hydrolytic49 and oxidative50 degradation in vivo.

Figure 3. The cytotoxicity comparison between P3 after the cleavage of cationic moieties (P3Neu) and Lipofectamine 2000 on (a) HeLa cell line, (b) primary mouse embryo fibroblasts. Error bars represent the standard deviation of a minimum of three replicates.

Non-cationic RNA-polymer complexes achieve efficient RNA interference Next, to evaluate the RNAi efficiency and toxicity of our system, we employed the mouse preimplantation embryo model. It has been well established that mammalian embryo development is more sensitive to perturbations than in vitro cultured cell lines.51, 52 Previous study has introduced a non-cationic lipid gene delivery system into chicken embryos via microinjection.53 In our study, we chose to target Tuba1a and evaluate if culturing with our RNA-polymer complex can result in blastocyst failure phenotype.43 As shown in Figures 4a and 4b, the crosslinked complex between P3 and dsTuba1a caused


Page 17 of 27 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biomacromolecules

significantly lower embryo development, including delays in 4/8 cell stage, embryo compaction during morula stage as well as cavitation during blastocyst stage. This result is similar to our previous microinjection-mediated RNAi phenotype.43, 54 In comparison to the control groups, supplementation of either P3Neu or dsTuba1a into culture medium (KSOM) did not affect the development of embryos to the blastocyst stage. Similarly, in the control groups (P3NEU alone, dsTuba1a alone, scrambled dsRNA sequence in the form of P3-dsGFP complex), nearly all embryos reached blastocyst stage after 4 days, further confirming that the cytotoxicity of non-cationic polymer is negligible. Meanwhile, the result also indicated that negatively charged dsRNA alone cannot enter cells to induce RNAi phenotype (KSOM + dsTuba1a condition). To rule out the possibility that the detected phenotype was due to unexpected factors from the RNA-polymer complexes, dsGFP (dsRNA for GFP) was used as the scrambled dsRNA for complexation and crosslinking with P3. Since there is no inherent GFP-encoding gene in the mouse embryos involved in the experiment, no phenotype should be observed from P3-dsGFP complexes. As shown in Figure 4a, the embryo development from P3-dsGFP group was similar to other control groups. Lipofectamine was also attempted as a control group to evaluate with mouse preimplantation embryos. However, before accessing its knockdown efficiency with dsRNA, significant morula and blastocyst failure was observed after incubating with different dosage of Lipofectamine (Figure S10). Taken together, these results clearly demonstrated that the phenotype was due to successful delivery of dsTuba1a into the embryos. We hypothesize that the uptake of such RNA-polymer complex attributes to scavenger receptors, a subgroup of receptors that recognize negatively charged surfaces.55



Page 18 of 27

Figure 4. (a) Embryo development in KSOM media at different preimplantation stages in the presence of P3, dsTuba1a, P3-dsTuba1a complex or P3-dsGFP control complex. The scale bar in each figure represents 100 µm. (b) The development rate at different preimplantation stage examined. (c) Quantitative analysis of Tuba1a mRNA following the treatment of corresponding P3-dsRNA crosslinked complex. In each figure, error bars represent the standard deviation of a minimum of three replicates. *, P < 0.01.

In order to further show that the degradation of endogenous mRNA was triggered by crosslinked complex-mediated RNAi and to quantify these effects, we performed real-time quantitative reverse transcription PCR (qRT-PCR) on 4/8-cell embryos and morula embryos to quantify the amount of endogenous Tuba1a mRNA. qRT-PCR results revealed that the crosslinked P3-dsTuba1a complexes can significantly decrease the amount of Tuba1a mRNA (by ~65% at the 4-cell stage and ~50% at the morula stage) when compared with P3-dsGFP complex (Figure 4c), confirming the phenotype was indeed due to specific knockdown of Tuba1a gene via intracellular dsRNA delivery.


Page 19 of 27 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biomacromolecules

Conclusions In summary, a supramolecular strategy in which electrostatic interactions have been used to initially complex RNA molecules, but are removed during the self-crosslinking reaction. The crosslinking-based steric barrier serves to retain the RNA molecules in the polymer nanoassembly, while the assembly does not exhibit cationic character. This non-cationic nature presumably contributes to its substantially reduced cytotoxicity, compared to classical cationic delivery vehicles such as Lipofectamine. The crosslinkinginduced generation of disulfide bonds also renders the nanoassembly responsive to glutathione. The utility of this feature has been tested in achieving RNAi during mouse embryo development. Our results show that the knockdown is quite efficient and target-specific for the polymer-RNA complex. The current work thus demonstrates that this system works exceptionally well in early mammalian embryos. However, it is understood that long dsRNA elicits a strong immune response56, 57 in most somatic cell types and therefore the use of small interfering RNAs (siRNAs) has become a standard practice.58 Current experiments in our laboratories are focused on applying this new paradigm in order to robustly deliver siRNAs (Figure S11), the length of which is smaller. Overall, the new strategy opens up a previously unexplored avenue for translating RNA interference using synthetic vehicles with minimal cytotoxicity, providing potentially promising scaffolds for nucleic acid delivery in general.

Supporting Information The Supporting Information is available free of charge on the ACS Publications website. Characterization of each random polymer, analysis of the crosslinking reaction, toxicity of Lipofectamine in mouse embryos, spectral data.



Page 20 of 27

Corresponding Authors * Emails: [email protected] (J. M.); [email protected] (S. T.). Author Contributions † Z.J. and W.C. contributed equally to this work. S.T. conceived the molecular design. Z.J., W.C., J.M., and S.T. planned the project. Z.J. and W.C. conducted all the experiments and analyzed the results, with the help from M.A.T. and N.C.G. for cryo-EM characterization. P.P. optimized the initial conditions for the polymer syntheses. All authors reviewed the manuscript. Notes The authors declare no competing interest. Acknowledgements We thank the support from the U.S. Army Research Office (W911NF-15-1-0568). Support from Lalor Foundation (postdoctoral fellowship to W.C.) and AFOSR-NDSEG (graduate fellowship to M.A.T.) are gratefully acknowledged.

References 1.

Kay, M. A., State-of-the-art gene-based therapies: the road ahead. Nat. Rev. Genet. 2011, 12 (5),

316-328. 2.

Naldini, L., Gene therapy returns to centre stage. Nature 2015, 526 (7573), 351-360.

3.

Fang, X.; Tan, W., Aptamers Generated from Cell-SELEX for Molecular Medicine: A Chemical

Biology Approach. Acc. Chem. Res. 2010, 43 (1), 48-57. 4.

Gleave, M. E.; Monia, B. P., Antisense therapy for cancer. Nat. Rev. Cancer 2005, 5 (6), 468-479.


Page 21 of 27 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biomacromolecules

5.

Hannon, G. J., RNA interference. Nature 2002, 418 (6894), 244-251.

6.

Urnov, F. D.; Rebar, E. J.; Holmes, M. C.; Zhang, H. S.; Gregory, P. D., Genome editing with

engineered zinc finger nucleases. Nat. Rev. Genet. 2010, 11 (9), 636-646. 7.

Boch, J., TALEs of genome targeting. Nat. Biotechnol. 2011, 29 (2), 135-136.

8.

Wright, Addison V.; Nuñez, James K.; Doudna, Jennifer A., Biology and Applications of CRISPR

Systems: Harnessing Nature’s Toolbox for Genome Engineering. Cell 2016, 164 (1), 29-44. 9.

Fire, A.; Xu, S.; Montgomery, M. K.; Kostas, S. A.; Driver, S. E.; Mello, C. C., Potent and specific

genetic interference by double-stranded RNA in Caenorhabditis elegans. Nature 1998, 391 (6669), 806811. 10.

Davidson, B. L.; McCray, P. B., Current prospects for RNA interference-based therapies. Nat. Rev.

Genet. 2011, 12 (5), 329-340. 11.

Burnett, J. C.; Rossi, J. J., RNA-Based Therapeutics: Current Progress and Future Prospects. Chem.

Biol. 2012, 19 (1), 60-71. 12.

Bobbin, M. L.; Rossi, J. J., RNA Interference (RNAi)-Based Therapeutics: Delivering on the

Promise? Annu. Rev. Pharmacool. Toxicol. 2016, 56, 103-122. 13.

Tuschl, T.; Zamore, P. D.; Lehmann, R.; Bartel, D. P.; Sharp, P. A., Targeted mRNA degradation

by double-stranded RNA in vitro. Genes Dev. 1999, 13 (24), 3191-3197. 14.

Scherer, L. J.; Rossi, J. J., Approaches for the sequence-specific knockdown of mRNA. Nat.

Biotechnol. 2003, 21 (12), 1457-1465. 15.

Vasir, J. K.; Labhasetwar, V., Biodegradable nanoparticles for cytosolic delivery of therapeutics.

Adv. Drug Del. Rev. 2007, 59 (8), 718-728. 16.

Jensen, S. A.; Day, E. S.; Ko, C. H.; Hurley, L. A.; Luciano, J. P.; Kouri, F. M.; Merkel, T. J.;

Luthi, A. J.; Patel, P. C.; Cutler, J. I.; Daniel, W. L.; Scott, A. W.; Rotz, M. W.; Meade, T. J.; Giljohann,



Page 22 of 27

D. A.; Mirkin, C. A.; Stegh, A. H., Spherical Nucleic Acid Nanoparticle Conjugates as an RNAi-Based Therapy for Glioblastoma. Sci. Transl. Med. 2013, 5 (209), 209ra152. 17.

Miyata, K.; Nishiyama, N.; Kataoka, K., Rational design of smart supramolecular assemblies for

gene delivery: chemical challenges in the creation of artificial viruses. Chem. Soc. Rev. 2012, 41 (7), 25622574. 18.

Semple, S. C.; Akinc, A.; Chen, J. X.; Sandhu, A. P.; Mui, B. L.; Cho, C. K.; Sah, D. W. Y.;

Stebbing, D.; Crosley, E. J.; Yaworski, E.; Hafez, I. M.; Dorkin, J. R.; Qin, J.; Lam, K.; Rajeev, K. G.; Wong, K. F.; Jeffs, L. B.; Nechev, L.; Eisenhardt, M. L.; Jayaraman, M.; Kazem, M.; Maier, M. A.; Srinivasulu, M.; Weinstein, M. J.; Chen, Q. M.; Alvarez, R.; Barros, S. A.; De, S.; Klimuk, S. K.; Borland, T.; Kosovrasti, V.; Cantley, W. L.; Tam, Y. K.; Manoharan, M.; Ciufolini, M. A.; Tracy, M. A.; de Fougerolles, A.; MacLachlan, I.; Cullis, P. R.; Madden, T. D.; Hope, M. J., Rational design of cationic lipids for siRNA delivery. Nat. Biotechnol. 2010, 28 (2), 172-176. 19.

Wang, J.; Lu, Z.; Wientjes, M. G.; Au, J. L. S., Delivery of siRNA Therapeutics: Barriers and

Carriers. AAPS J. 2010, 12 (4), 492-503. 20.

Wells, D. J., Gene therapy progress and prospects: Electroporation and other physical methods.

Gene Ther. 2004, 11 (18), 1363-1369. 21.

Ibraheem, D.; Elaissari, A.; Fessi, H., Gene therapy and DNA delivery systems. Int. J. Pharm.

2014, 459 (1–2), 70-83. 22.

Robbins, P. D.; Ghivizzani, S. C., Viral Vectors for Gene Therapy. Pharmacol. Ther. 1998, 80 (1),

35-47. 23.

Kay, M. A.; Glorioso, J. C.; Naldini, L., Viral vectors for gene therapy: the art of turning infectious

agents into vehicles of therapeutics. Nat. Med. 2001, 7 (1), 33-40.


Page 23 of 27 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

24.

Biomacromolecules

Mingozzi, F.; High, K. A., Therapeutic in vivo gene transfer for genetic disease using AAV:

progress and challenges. Nat. Rev. Genet. 2011, 12 (5), 341-355. 25.

Kotterman, M. A.; Schaffer, D. V., Engineering adeno-associated viruses for clinical gene therapy.

Nat. Rev. Genet. 2014, 15 (7), 445-451. 26.

Medina-Kauwe, L. K., Endocytosis of adenovirus and adenovirus capsid proteins. Adv. Drug Del.

Rev. 2003, 55 (11), 1485-1496. 27.

Assessment of adenoviral vector safety and toxicity: Report of the National Institutes of Health

Recombinant DNA Advisory Committee. Hum. Gene Ther. 2002, 13 (1), 3-13. 28.

Thomas, C. E.; Ehrhardt, A.; Kay, M. A., Progress and problems with the use of viral vectors for

gene therapy. Nat. Rev. Genet. 2003, 4 (5), 346-358. 29.

Yin, H.; Kanasty, R. L.; Eltoukhy, A. A.; Vegas, A. J.; Dorkin, J. R.; Anderson, D. G., Non-viral

vectors for gene-based therapy. Nat. Rev. Genet. 2014, 15 (8), 541-555. 30.

Draghici, B.; Ilies, M. A., Synthetic Nucleic Acid Delivery Systems: Present and Perspectives. J.

Med. Chem. 2015, 58 (10), 4091-4130. 31.

Mastrobattista, E.; van der Aa, M. A. E. M.; Hennink, W. E.; Crommelin, D. J. A., Artificial viruses:

a nanotechnological approach to gene delivery. Nat. Rev. Drug Discov. 2006, 5 (2), 115-121. 32.

Goodman, C. M.; McCusker, C. D.; Yilmaz, T.; Rotello, V. M., Toxicity of Gold Nanoparticles

Functionalized with Cationic and Anionic Side Chains. Bioconjugate Chem. 2004, 15 (4), 897-900. 33.

Lv, H.; Zhang, S.; Wang, B.; Cui, S.; Yan, J., Toxicity of cationic lipids and cationic polymers in

gene delivery. J. Controlled Release 2006, 114 (1), 100-109. 34.

Hunter, A. C., Molecular hurdles in polyfectin design and mechanistic background to polycation

induced cytotoxicity. Adv. Drug Del. Rev. 2006, 58 (14), 1523-1531.



35.

Page 24 of 27

Molineux, I. J.; Panja, D., Popping the cork: mechanisms of phage genome ejection. Nat. Rev.

Microbiol. 2013, 11 (3), 194-204. 36.

Ryu, J.-H.; Chacko, R. T.; Jiwpanich, S.; Bickerton, S.; Babu, R. P.; Thayumanavan, S., Self-

Cross-Linked Polymer Nanogels: A Versatile Nanoscopic Drug Delivery Platform. J. Am. Chem. Soc. 2010, 132 (48), 17227-17235. 37.

Miyata, K.; Kakizawa, Y.; Nishiyama, N.; Harada, A.; Yamasaki, Y.; Koyama, H.; Kataoka, K.,

Block Catiomer Polyplexes with Regulated Densities of Charge and Disulfide Cross-Linking Directed To Enhance Gene Expression. J. Am. Chem. Soc. 2004, 126 (8), 2355-2361. 38.

Matsumoto, S.; Christie, R. J.; Nishiyama, N.; Miyata, K.; Ishii, A.; Oba, M.; Koyama, H.;

Yamasaki, Y.; Kataoka, K., Environment-Responsive Block Copolymer Micelles with a Disulfide CrossLinked Core for Enhanced siRNA Delivery. Biomacromolecules 2009, 10 (1), 119-127. 39.

Ghosh, S.; Basu, S.; Thayumanavan, S., Simultaneous and Reversible Functionalization of

Copolymers for Biological Applications. Macromolecules 2006, 39 (17), 5595-5597. 40.

Stander-Grobler, E.; Schuster, O.; Heydenrych, G.; Cronje, S.; Tosh, E.; Albrecht, M.; Frenking,

G.; Raubenheimer, H. G., Pyridine-Derived N-Heterocyclic Carbenes: An Experimental and Theoretical Evaluation of the Bonding in and Reactivity of Selected Normal and Abnormal Complexes of Nickel(II) and Palladium(II). Organometallics 2010, 29 (22), 5821-5833. 41.

Pastore, A.; Federici, G.; Bertini, E.; Piemonte, F., Analysis of glutathione: implication in redox

and detoxification. Clin. Chim. Acta 2003, 333 (1), 19-39. 42.

Cheng, R.; Feng, F.; Meng, F.; Deng, C.; Feijen, J.; Zhong, Z., Glutathione-responsive nano-

vehicles as a promising platform for targeted intracellular drug and gene delivery. J. Controlled Release 2011, 152 (1), 2-12.


Page 25 of 27 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

43.

Biomacromolecules

Cui, W.; Dai, X. P.; Marcho, C.; Han, Z. B.; Zhang, K.; Tremblay, K. D.; Mager, J., Towards

Functional Annotation of the Preimplantation Transcriptome: An RNAi Screen in Mammalian Embryos. Sci. Rep. 2016, 6. 44.

Mehrotra, S.; Lee, I.; Chan, C., Multilayer mediated forward and patterned siRNA transfection

using linear-PEI at extended N/P ratios. Acta Biomater. 2009, 5 (5), 1474-1488. 45.

Dalby, B.; Cates, S.; Harris, A.; Ohki, E. C.; Tilkins, M. L.; Price, P. J.; Ciccarone, V. C.,

Advanced transfection with Lipofectamine 2000 reagent: primary neurons, siRNA, and high-throughput applications. Methods 2004, 33 (2), 95-103. 46.

Kapoor, M.; Burgess, D. J., Efficient and safe delivery of siRNA using anionic lipids: Formulation

optimization studies. Int. J. Pharm. 2012, 432 (1), 80-90. 47.

Somiya, M.; Yamaguchi, K.; Liu, Q.; Niimi, T.; Maturana, A. D.; Iijima, M.; Yoshimoto, N.;

Kuroda, S. i., One-step scalable preparation method for non-cationic liposomes with high siRNA content. Int. J. Pharm. 2015, 490 (1), 316-323. 48.

Aramaki, Y.; Takano, S.; Tsuchiya, S., Induction of apoptosis in macrophages by cationic

liposomes. FEBS Lett. 1999, 460 (3), 472-476. 49.

Browning, M. B.; Cereceres, S. N.; Luong, P. T.; Cosgriff-Hernandez, E. M., Determination of the

in vivo degradation mechanism of PEGDA hydrogels. J. Biomed. Mater. Res. A 2014, 102 (12), 42444251. 50.

Ulbricht, J.; Jordan, R.; Luxenhofer, R., On the biodegradability of polyethylene glycol,

polypeptoids and poly(2-oxazoline)s. Biomaterials 2014, 35 (17), 4848-4861. 51.

Prasad, P.; Molla, M. R.; Cui, W.; Canakci, M.; Osborne, B.; Mager, J.; Thayumanavan, S.,

Polyamide Nanogels from Generally Recognized as Safe Components and Their Toxicity in Mouse Preimplantation Embryos. Biomacromolecules 2015, 16 (11), 3491-3498.



52.

Page 26 of 27

Wang, H.; Dey, S. K., Roadmap to embryo implantation: clues from mouse models. Nat. Rev.

Genet. 2006, 7 (3), 185-199. 53.

Longmuir, K. J.; Haynes, S. M.; Dickinson, M. E.; Murphy, J. C.; Willson, R. C.; Waring, A. J.,

Optimization of a Peptide/Non-cationic Lipid Gene Delivery System for Effective Microinjection into Chicken Embryo in Vivo. Mol. Ther. 2001, 4 (1), 66-74. 54.

Cui, W.; Pizzollo, J.; Han, Z. B.; Marcho, C.; Zhang, K.; Mager, J., Nop2 is required for

mammalian preimplantation development. Mol. Reprod. Dev. 2016, 83 (2), 124-131. 55.

Patel, P. C.; Giljohann, D. A.; Daniel, W. L.; Zheng, D.; Prigodich, A. E.; Mirkin, C. A., Scavenger

Receptors Mediate Cellular Uptake of Polyvalent Oligonucleotide-Functionalized Gold Nanoparticles. Bioconjugate Chem. 2010, 21 (12), 2250-2256. 56.

Alexopoulou, L.; Holt, A. C.; Medzhitov, R.; Flavell, R. A., Recognition of double-stranded RNA

and activation of NF-κB by Toll-like receptor 3. Nature 2001, 413, 732. 57.

Balachandran, S.; Roberts, P. C.; Brown, L. E.; Truong, H.; Pattnaik, A. K.; Archer, D. R.; Barber,

G. N., Essential Role for the dsRNA-Dependent Protein Kinase PKR in Innate Immunity to Viral Infection. Immunity 2000, 13 (1), 129-141. 58.

Elbashir, S. M.; Harborth, J.; Lendeckel, W.; Yalcin, A.; Weber, K.; Tuschl, T., Duplexes of 21-

nucleotide RNAs mediate RNA interference in cultured mammalian cells. Nature 2001, 411 (6836), 494498.


Page 27 of 27 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biomacromolecules

For Table of Contents Use Only

A Bait-and-Switch Supramolecular Strategy to Generate Non-cationic

RNA-Polymer

Complexes

for

RNA

Delivery Ziwen Jiang,1† Wei Cui,2,4,† Priyaa Prasad,1 Mollie A. Touve,5,6 Nathan C. Gianneschi,5,6 Jesse Mager,*2,4 S. Thayumanavan*1,3,4


Bait-and-Switch Supramolecular Strategy To Generate Noncationic

Recommend Documents