Bioconlugete Chem. 1003, 4, 34-41
34
Bead-Based Sandwich Hybridization Characteristics of Oligonucleotide-Alkaline Phosphatase Conjugates and Their Potential for Quantitating Target RNA Sequences Jennifer K. Ishii and Soumitra S. Ghosh’ Life Sciences Research Laboratory, Baxter Diagnostics Inc., San Diego, California 92121. Received July 15, 1992
The hybridization characteristics of oligonucleotidealkalinephosphatase conjugateprobes were examined in bead-based sandwich hybridization reactions using single-stranded nucleic acid targets and oligonucleotide-polystyrene capture beads. Enzymatic activity was monitored using a chemiluminescent substrate and calibration plots of chemiluminescent signal versus conjugate concentration were used to estimate the sandwich hybridization efficiencies. Improved hybridization behavior was noted using glycerol as an additive and by increasing the length of the probe and alkyl spacer of the conjugates. The chemiluminescent assay is at least as sensitive as those employing 32P-labeledprobes and can detect as little as 10-20 amol of target RNA. The linear relationship of chemiluminescent signal versus target assayed provides a method for quantitating unknown target samples. A single human immunodeficiency virus type 1infected cell in a background of lo6 uninfected cells is facilely detected when this enzymebased detection assay is prefaced with a self-sustained sequence-replication amplification reaction.
During the past decade, nucleic acid hybridization techniques have become increasingly important for the clinical diagnosis of infectious diseases (1) and genetic disorders (2).The application of these methodologies have been immensely facilitated by the development of in vitro nucleic acid amplification procedures (3-5), which have dramatically improved the sensitivityof detection of target DNA or RNA sequences (6). Traditionally, radioisotopelabeled probes have been favored in hybridization methods because of their sensitivity and ease of quantitation, despite issues such as safety and short lifetimes. However, with the advent of a number of powerful nonisotopic detection systems (7)which rival 32Pin sensitivity, attention has been steadily shifting toward the use of these alternative detection methods. One such promising nonisotopic approach utilizes enzyme-linked oligonucleotideconjugate probes wherein signal amplification is achieved by rapid turnover of substrate to a colored, fluorescent, or chemiluminescent product (8-14). In particular, alkaline phosphatase has emerged as the reporter molecule of choice in such conjugates because of the exquisite sensitivity of detection possible using chemiluminescent (CL) dioxetane-based substrates (12-14). Recently, detection of as little as 0.001 amol of the enzyme have been reported using 4-methoxy-4-(3-phosphonophenyl)spiro[ 1,2-dioxetane3,2’-adamantanel (15,16). A current focus in viral diagnostics has been on developing quantitative hybridization methods for the detection of viral pathogens in clinical samples (17,18). Such assays are critical for assessing the viral load in an infected patient over the time span of the disease, following the expression of specific viral and host genes, and for ~
~
~~
* Author to whom correspondence should be addressed:
Life Sciences Research Laboratory, Baxter Diagnostics, Inc., 4245 Sorrento Valley Boulevard, San Diego, CA 92121. Phone: (619) 622-9726. FAX: (619) 597-2935. Abbreviations used: BBSH, bead-based sandwich hybridization;CL, chemiluminescent;HIV-1, human immunodeficiency virus type 1; SDS,sodium dodecyl sulfate; PVP, polyvinylpyrrolidone; D’IT, dithiothreitol; TEAC, triethylammonium acetate; EDTA, etylenediaminetetraacetic acid; HEPES, N(2-hydroxyethy1)piperazine-N’-ethanesulfonicacid; BSA, bovine serum albumin fraction V; 3SR, self-sustained sequence replication. 1043-1802/93/2904-0034$04.00/0
monitoring changes in viral titers to determine the efficacy of drug therapy regimens. Our choice of a sandwich hybridization approach (19-21) employing oligonucleotidealkaline phosphatase conjugates and oligonucleotide-linked polystyrene beads (22)was dictated by the following features: (1)the rapid kinetics of hybridization obtained by using short oligonucleotide probe sequences, (2) the approximation of the conditions of solution hybridization when capture oligonucleotidesare covalently end-attached, via spacer arms, to the solid support, (3) the enhanced specificity in target detection derived from two independent hybridization events of the nucleic acid analyte with the capture and detection oligonucleotides, and (4) the sensitivity of CL detection afforded by oligonucleotidealkaline phosphatase conjugates and the numerical readout of the CL signal for quantitative analysis. This paper describes the sandwich hybridization behavior of the conjugates in bead-based sandwich hybridization (BBSH) reactions with RNA targets (Figure l), parameters for improving its hybridization efficiencies, and the quantitative potential of the assay. The efficacy of this BBSH system is demonstrated in its abilityto detect RNA products generated by self-sustained sequence replication (3SR) amplification reactions (5) of samples containing low titers of human immunodeficiency virus type 1 (HIV-1). EXPERIMENTAL PROCEDURES
Calf intestine alkaline phosphatase (EC 3.1.3.1, enzyme immunoassay grade) was purchased from Boehringer Mannheim, and [ T - ~ ~ P I A Tand P [ T - ~ ~ P I C Twere P from ICN. T4 polynucleotide kinase was obtained from New England Biolabs. Sodium dodecyl sulfate (SDS),polyvinylpyrrolidone (PVP), and glycerol were from Sigma, and Ficoll was from Pharmacia. LumiPhos 530, a formulation of the dioxetane substrate 4-methoxy-4-(&phosphonophenyl)spiro[l,2-dioxetane-3,2’-adamantanel, was purchased from Lumigen, Inc., and CML latex beads (0.807 pm size) were obtained from Seradyn, Inc. Presiliconized Eppendorf tubes were obtained were Denville Scientific, Inc. Radioactivity was measured by Cerenkov counting 0 1993 American Chemical Soclety
Oligonucleotide-Alkaline Phosphatase Conjugates
Bioconjugate Chem., Vol. 4, No. 1, 1993 35
Figure 1. Scheme for enzyme-based BBSH detection. Table I. Sequences of HIV-1env-RegionOligonucleotide Probes and Primers8 86-272 5’TCTAATTACTACCTCTTCTTCTGCTAGACT3’ 86-273 YAGTCTACGAGAAGAAGAGGTAGTAATTAGA3’ 86-274 iS’TGTACTATTATGGTTTTAGCATTGTCTGTG3’ 86-275 5‘CACAGACAATGCTAAAACCATAATAGTACA3’ 88-211 VAATTTAATACGACTCACTATAGGGATCTATTG-
TGCCCCGCGGGTTTTGCGATTCTA3’ 88-297 88-347 89-255 90-066 90-374
5’TGGCCTAATTCCATGTGTACATTGTACTGT3’
VAATTTAATACGACTCACTATAGGGATGTACTATTATGGTTTTAGCATTGTCTGTGA3’ 5’TTATTGTGCCCCGGCTGGTTTTGCGATTCTA3’ 5’TTACAATTTCTGGGTCCCCTCCTGAGGA3’
VAATTTAATACGACTCACTATAGGGATTTTT-
CTTGTATTGTTGTTGGGTCTTGTAC3’ 90-422 5’AATTAGGCCAGTAGTATCAACTCAACTGCT3’ 90-673 5‘AGAAGAGGTAGTAATTAGATCTGCCAATTT3’ 90475 5’CATGGAATTAGGCCAGTAGTATCAACTCAACTGCT3’
Underlined bases in the oligonucleotide sequences denote the presence of a T7 promoter at the 5’ ends (5, 24). Transcription initiation sequences are in boldface.
using a Beckman LS 7800 liquid scintillation system. Oligonucleotidesand their alkalinephosphatase conjugates were quantitated on the basis of their 260/280 absorbances using a Beckman DU 40 spectrophotometer. CL signals were measured with a Monolight 2010 luminometer (Advanced Luminescence Laboratory) equipped with a photon-countingdevicewith 20-11s resolution and a spectral sensitivityrange of 360-620 nm. Linear regresson analysis of the data was carried out using the KaleidaGraph program (Abelbeck Software). Reagent Preparation. ( a ) Selection and Synthesis of Oligonucleotides. The sequences (23)of the detection and capture oligonucleotidesused to detect the enu region of HIV-1 RNA and the 3SR primer oligonucleotides utilized in the 3SR amplification and T7 RNA polymerase transcription reactions are shown in Table I. Figure 2 illustrates the location of these sequences relative to the HIV-1 enu-region map. With the exception of primer oligonucleotide 89-255, the 3SR primer oligonucleotides 88-211*, 88-347*, and 90-374* contain a T7 promoter sequence at their 5‘ end (5,24) (asterisks denote presence of T7 promoters). Oligonucleotides were synthesized on an Applied Biosystems 380A DNA synthesizer. The detection oligonucleotide sequences 86-272T, 90-422T, and 90-675T contain a hexylthiol group at their 5‘ termini which was
incorporated using a C6 thiol-modifier phosphoramidite reagent (Amersham, Inc.) in the last coupling step of the synthesis. The capture oligonucleotides sequences 86273, 88-297, 90-673, and 86-275 contain a 5’ terminal aminohexyl group and were synthesized by using the Aminolink 2 reagent (AppliedBiosystems,Inc.) in the last coupling step of the automated synthesis. The tritylated oligonucleotides were purified as described elsewhere (25). Prior to their use, the purified tritylated thiol oligonucleotides were deprotected using a two-step Ag+/dithiothreitol (DTT) procedure (26). Crude deprotected 5’-aminohexyl oligonucleotideswere taken up in 0.1 M triethylammonium acetate (TEAC), pH 8.5, and purified by reverse-phase HPLC (C8 column, 1X 25 cm) using a gradient of 7-25 % acetonitrile in 0.1 M TEAC, pH 6.8. Following purification, all the oligonucleotides were stored in 0.2 M HEPES, pH 7.7, at -20 “C. The purified oligonucleotides migrated as single bands on a 15% denaturing polyacrylamide gel. Detection oligonucleotide sequences 86-272 and 90-422 were phosphorylated at the 5’ terminus using T4 polynucleotide kinase and cold ATP or [T-~~PIATP (27). Oligonucleotide Trisacryl (90-66) support was prepared according to the method described by Davis et al. (28). ( b ) Preparation of Oligonucleotide-Alkaline Phosphatase Conjugate Detection Probes. Calf intestine alkaline phosphatase was covalently attached to the oligonucleotides 86-272,90-422, or 90-675 by a thioether linkage as described elsewhere (8). The oligonucleotides in these conjugates are separated from the reporter enzyme by a two-carbon spacer. Conjugates with hexyl linkers were synthesized by the same method using the sequences 86-272T, 90-422T, and 90-6751‘. The conjugates are stable for at least 1year when stored at 4 “C. The conjugate concentrations were determined by spectrophotometric analysis ( 8 , I I ) . The two sets of conjugates, which differ in the length of the spacer, were equivalent in their sensitivity of detection of nitrocellulose-filter-bound complementary HIV-1 target using a dye precipitation assay (8) and in their specific activities. Prior to using the conjugates in sandwich hybridization assays, they were diluted in 50 mM NaC1,lO mM MgC12,0.1% gelatin, 0.1 M TrisHC1, pH 7.5 (dilution buffer), such that 10-100 fmol of each probe were delivered in a volume not exceeding 15 pL for the hybridization reaction.
Ishii and Ghosh
36 Bioconjugate Chem., Vol. 4, No. 1, 1993 89-255 88-297
HIV-1 e m
&Is0
86272-AP
6650
6550
-
90-422-AP
a6274
90-673 90-66
86273 9&675-AP
86275
Figure 2. Map of the enu region of HIV-1 illustrating the positions of detection and capture oligonucleotides as well as positions of oligonucleotideprimers. Sequence which are shown above the center line are complementaryto the sense strand of HIV-1 RNA, while those below the line are complementary to the antisense strand.
(c)Preparation of the Capture Oligonucleotide-Polystyrene Support. Sequences 86-273,88-297,90-673, and 86-275 5"ninohexyl oligonucleotides were covalently attached to carboxylated polystyrene beads using 1-ethyl3- [3-(dimethy1amino)propylldiimide hydrochlorideas the coupling reagent (22). The capture oligonucleotidepolystyrene beads were diluted in 5X SSC (27),5X PVP/ Ficoll, 0.5 % SDS, and 0.02 pg/pL calf thymus DNA prior to their use in the hybridization reaction. ( d )Preparation of RNA Transcripts. Some of the RNA transcripts used in the BBSH assays were obtained from single promoter 3SR reactions (29) using primers 89-255 and either 88-347* or 90-374*. The other RNA target was a product of a 3SR amplification reaction using the primer combination 88-211*/88-347*. All targets and transcripts were quantitated by BBSH using 32P-labeled oligonucleotide detection probes and Trisacryl-oligonucleotide supports (28). A T7 promoter-containing PCR product was synthesized using the primer pair 88-211* and 86-274. This PCR product was used as a template for a T7 RNA polymerase transcription reaction using 200 units of T7 RNA polymerase, 25 pM of unlabeled rCTP supplemented with 25 pCi of [ w ~ ~ P ] C Tand P , 0.4 mM of the other rNTPs in 100 pL of transcription buffer (40 mM TrisHCl, pH 8.1,8 mM MgC12,25 mM NaC1,2 mM spermidine, 5 mM DTT, and 80 mg of nuclease-free BSA). The reaction mixture was incubated at 37 "C, following which the transcript was separated from unincorporated nucleotides by passage through a G-50 spin column. Quantitation of the 32Plabeled transcript was based on the amount of label incorporated in the nucleic acid. The size and integrity of the transcript was evaluated by electrophoresis on a 6 % denaturing polyacrylamide gel. Bead-Based Sandwich Hybridization. Presiliconized Eppendorf tubes were used in the BBSH assays to minimize nonspecific binding of the conjugates to the reaction tubes. Prior to use, the tubes were washed with 70% ethanol and then dried at 55-60 "C for 30 min. RNase-mediated degradation of the target or control RNA was inhibited by preparing buffer solutions in diethyl pyrocarbonate-treated water (27). In a typical assay, oligonucleotide-polystyrene beads (50pg) were suspended in prehybridizationreaction buffer (5X SSC, 0.5% SDS, 0.02 pg/pL calf thymus DNA) and then pelleted by centrifugation for 5 min at 14 000 rpm. The supernatant was removed and a 25-pL aliquot of 2X optimized hybridization buffer (1OX SSC, 1% SDS, 0.04 pg/pL calf thymus DNA, 5% glycerol), prewarmed to 50 "C, was added to the pellet. The target or negative control RNA was diluted in TE buffer (10 mM TrisHCl, 1 mM EDTA, pH 8.1) so that a requisite amount of nucleic acid was delivered in 5-10 pL and added to the beads. The oligonucleotide-alkaline phosphatase conjugate probe was added to the beads in a volume ranging from 15 to 20 pL, resulting in a total reaction of 50 pL. The tubes were vortexed, and the hybridization reaction was allowed to proceed for 1h at 50 "C. After the incubation period, a
50-pL aliquot of wash solution (0.1X SSC, 0.1 % SDS) was added and the mixture was allowed to stand for 3 min at room temperature before centrifugation at 14 000 rpm for 5 min. The supernatant was removed and the bead pellet was washed two times with 50 pL each of wash solution before addition of the chemiluminescent substrate. Chemiluminescent Detection of the BBSH Complex. A 200-pL aliquot of Lumi-Phos 530 was added to the bead-target-probe complex from the BBSH reaction and gently vortexed. The alkaline phosphatase-catalyzed dephosphorylation of the dioxetane substrate was allowed to proceed in the dark for 1h at room temperature. The mixture was then transferred to a cuvette and the CL signal was measured by luminometer. RESULTS
Correlation Curves of CL Signal and Oligonucleotide-Alkaline Phosphatase Conjugate. Various amounts of the 86-272-alkaline phosphatase conjugate detection probe (86-272-AP), which is complementary to the sense strand of the HIV-1 enu region, were incubated at 42 or 50 "C for 1h in buffer containing 5X SSC, 5X PVP/Ficoll, 0.5 % SDS, and 0.02 pg/pL calf thymus DNA. The mixtures were diluted 100-fold, and then aliquots corresponding to amounts ranging from to mol of conjugate were assayed for enzymatic activity using the dioxetane substrate LumiPhos 530. As seen in Figure 3, increasing the incubation temperature from 42 to 50 "C resulted in a 34 % decrease in CL signal generated by the conjugate probe. The addition of 2.5% glycerol to the hybridization solution stabilized the conjugate, and the signal increase compensated for the enzyme activity lost with the increase in temperature. Calibration curves plotting measured CL signal versus conjugate concentration from data such as those obtained above were used to estimate bound conjugate in sandwich hybridization complexes (see below). It should be noted that the enzymatic activity of the conjugate was unaltered in the presence of 0.8-pm polystyrene beads (50 pg) in the assay. Optimization of BSSH Assays using Oligonucleotide-Alkaline Phosphatase Conjugates. ( a )Influence of Temperature on Hybridization Efficiencies. A range of concentrations of a 32P-labeled218 base length RNA target transcript (see Experimental Procedures) was assayed with 88-297-polystyrene beads and 86-272-AP conjugate probe at different hybridization temperatures. The hybridization buffer for these BBSH reactions contained 5X SSC, 5X PVP/Ficoll, 0.5% SDS, and 0.02 pg/pL calf thymus DNA. Calibration curves plotting CL signal versus conjugate concentrations (see previous section)were used to quantitate the conjugate probe bound in the sandwich complex and estimate the sandwich hybridization efficiencies. The efficiency of the capture step was determined from the amount of radiolabel associatedwith the beads. The results of the BBSH assays are summarized in Table 11. The signals obtained in assays performed at 50 "C were higher than those at 42 "C, a result of increased hybridization efficiency at 50 "C. When
Bioconjugate Chem., Vol. 4, No. 1, 1993 37
Ollgonucleottde-Alkaline Phosphatase Conjugates 42°C El 50°C El 50°C + 2.5% Glycerol 1o5
1o4
1o3
102
10 -16
10-17
Io-'*
1049
Moles of 86-272-AP
Figure 3. Effect of hybridization temperatures and glycerol on the enzymatic activity of 86-272-AP conjugate probe. The 86272-AP conjugate probe was subjectedto hybridizationconditions for 1hour at 42 "C (solid bar), 50 "C (striped bar), and 50 "C in the presence of 2.5% glycerol (dotted bar). Aliquots (in triplicates) of the conjugate corresponding to amounts ranging from 10-l6 to mol were then incubated for 1 hour at room temperature with the dioxetane substrate, and chemiluminescence was detected using a single photon counting device. The CL signal is reported in relative light units (RLU) and has been corrected for the CL value of the substrate alone (42 "C, 1009 RLU; 50 OC 845 RLU; 50 "C and glycerol, 1055 RLU).
the hybridization mixture was supplemented with 2.5 % glycerol, a further improvement in sensitivitywas observed. In the presence of the additive, the conjugate probe was capable of detecting 20 am01 of the RNA target with a 4:l signal/negative controlratio when the assay was performed at 50 "C. (b) Effect of Reaction Components on Sandwich Hybridizations. The influence of the varioushybridization reaction buffer components was examined in BBSH reactions of 86-273-polystyrene beads and 90-422-AP conjugate with a 236-base, antisense HIV-1 enu-region RNA target. An antisense HIV-1 pol 3SR-generated product was used as a negative control for these reactions. Exclusion of SDS from reaction buffer resulted in a 35fold increase in nonspecific binding, as seen in the hybridization reaction of the probe with the noncomplementary pol target (Figure 4A) thus obscuring the hybridization signal obtained in hybridization of the probe to the enu target. Removal of PVP/Ficoll had little effect on the signal obtained in hybridization of the probe to the enu target or in nonspecific hybridization of the probe to the pol target. However, removal of SDS/PVP/Ficoll resulted in a marked increase in the signal generated in the hybridization reaction with the negative control pol target. (c) Effect of Time on BBSHReactions. The optimal time for sandwich hybridization of 90-422-AP conjugate probe and 86-273-polystyrene beads to the 236-base enuregion RNA target was investigated. The hybridization reactions were performed at 50 "C in optimized buffer (5X SSC, 0.5% SDS, 0.2 pg/pL calf thymus DNA, 2.5% glycerol). Figure 4B shows that the maximum CL signal was observed when the hybridization period was between 60 and 90 min. The signal/negative control ratio was not
significantly enhanced by increasing the time of hybridization beyond 60 min. It should be noted that a 10% loss of enzymatic activity was observed when the incubation time of the conjugate in the hybridization reaction buffer was increased from 60 to 120 min, and a 40% loss after 150 min (data not shown). (d) Influence of Conjugate Probe Concentration on BBSHDetection. A constant amount of a 236-base,HIV-1 enu-region RNA target (1fmol) was assayed under the BBSH conditions with 86-273-polystyrene beads and 10100fmol of 90-422-AP probe. Figure 4C shows that there was an increase in CL signal with increasing amounts of detection probe, up to approximately 50 fmol of 90-422AP. (e) Influence of Length of Alkyl Spacer in Conjugate on BBSH Detection. The maleimide-thiol coupling reaction (8) was used to synthesize two sets of oligonucleotide-alkaline phosphatase conjugates, in which the enzyme moiety was separated from the nucleic acid by ethylene and hexylene spacers. The conjugates of oligonucleotide sequence 86-272 were complementary to the sense strand of enu HIV-1 RNA, whereas the 90-422-AP conjugates were specific probes for the antisense strand of enu HIV-1 RNA. As shown in Figure 5A, a two-fold increase in signal-to-background ratio was observed for the detection of the sense strand with 86-272T-AP probe, which has a six-carbonspacer between the oligonucleotide and the enzyme. The same trend was observed with the 90-422-AP probes, where a 3-fold increase in signal-tobackground ratio was obtained upon increasingthe length of the spacer. (f) Effect of Probe Length on BBSH Detection. Conjugate probes 90-422-AP and 90-675-AP having sixcarbon spacers were used in combination with 86-273-, 90-673- or 86-275-polystyrene beads to detect a 268 base length antisense, enu-region HIV-1 RNA target in BBSH assays. Conjugate probe 90-675-AP were identical in sequence to 90-422, but had an additional five bases complementary to the target sequence appended at the 5' end. Oligonucleotides 90-673 and 86-275 were shifted 11 bases and 41 bases downstream from 86-273, respectively. Figure 5B illustrates a uniform trend of increased signalto-background ratios using 90-675-AP probe with all beads compared to 90-422-AP conjugate with the same beads. However, extending the spatial distance between the detection and capture probes, as in the case with 86-275 polystyrene beads, was found to be detrimental for hybridization. Comparisonof Sensitivitiesof Chemiluminescence and 32P-DetectionSystems. Various amounts of sense, 3SR-amplified, HIV-1 enu-region product were detected by BBSH using 86-297-polystyrene beads and 86-272AP probe. A parallel set of experiments was conducted with 32P-labeled86-272 oligonucleotide as probe under the same hybridization conditions. Figure 6a shows that enzyme-based chemiluminescence detection was equivalent in sensitivity to 32Pdetection. However, when a similar comparison was made in BBSH assays of antisense HIV-1 enu-region RNA transcripts using 86-273-polystyrene beads and 90-422 detection probes, the CL assay was 10-foldmore sensitive than 32Pdetection (Figure 6B). Correlation of CL Signal to Amount of 3SRAmplified Antisense HIV RNA Target. Figure 6A shows a plot of CL signal versus HIV-1 enu-region RNA target obtained from BBSH assays of a range of target concentrations with 90-422-AP probe and 86-273-polystyrene beads. Linear regression analysis of the data indicate a direct correlation of the signal with target amounts ranging between and mol (see Figure 7A inset). The deviation from linearity observed in the
Ishll and Ghosh
38 Bioconlugate Chem.. Vol. 4, No. 1, 1993
Table 11. Influence of Temperature on BBSH Efficiencies g2P-labeled transcript (mo1)a.b 5.0 x 10-15 1.0x 1 0 4 5 1.0 x 10-16 5.0 x 10-17 2.0 x 10-17
signalcsd 400 695 63 924
42 "C BBSH efficiency (%) 3.4 2.5
50 OC BBSH efficiency (%)
signalcsd 885 863 201 511 24 273
50 "C + glycerol: BBSH efficiency (%) over range 27.0 29.7 31.5 35.2
signalctd over rangee 690 826 70 264 36 609 14 548
11.2
13.1 17.3
0 A 32P-labeled,218 base HIV-1 envelope region RNA transcript was used as target, and was generated from a T-7 RNA polymerase C Tone P of the substrates. The target was quantitated by transcription reaction of a T-7 promoter-containing PCR product using [ C ~ - ~ ~ P ] as correlating the radioactivity incorporated in the RNA transcript with the specific activity of [CY-~~PICTP. The primers used in the PCR reaction were 88-211* and 86-274 (see Table I and Figure 1 for sequences and locations). * Capture efficiencies for the target were as follows: at 42 "C,5fmol(29.2%),1fmo1(21.9%);at5O0C,5fmo1(67.6%), 1fmol(67.5%);at5O0Cwith2.5% glycerol, 1fmol(69.8%). Thedataispresented as the averages of triplicates in relative light units, and is corrected for the substrate background (at 42 "C, 1ooO; at 50 "C, 850; at 50 "C with 2.5% glycerol, 1260). d The averaged background signals for the pol-region HIV-1 RNA transcript were as follows: at 42 "C, 4262; at 50 "C, 1527; at 50 "C with 2.5% glycerol, 4458. e The signal was above the dynamic range of the instrument.
IO6
A.
200
;::::
r!
0
r
Gm
3
lo5
a: -
3
m
m v)
6
io4
125'
i
1o3
4-
+
1 I
- I + I
+ I -
-
400
B.
g-
200:
m
0) ._
-I
v)
.
0
75 50
/@--*\*/*
3
-
1
C.
r
.e 100 -
v)
0
SDS PVPiFicoll
'
/-"T
"
'
'
30
-
calibration curve for higher target concentrations arises because the target is in excessof the 90-422-AP conjugate probe used in the assay. Detection of HIV-1 (LAV) Infected CEM Cells. Serial dilutions of HIV-1 (LAV) infected CEM cells in a background of 106 uninfected PBMCs were lysed using guanidinium isothiocyanate, and the HIV-1 RNA was isolated by affinity purification using oligonucleotide Trisacryl (90-66) support (28). The RNA was then amplified in the presence of the capture beads using the 3SR reaction, and the products were detected by BBSH using 86-273-polystyrene beads and 90-422T-AP conjugate probe. The amplified products were quantitated by correlation of the CL signal to a calibration curve generated with known amounts of HIV-1 enu-region RNA (see Figure 7A inset). Figure 7B shows that the conjugate probe easily detects one HIV-1-infected CEM cell when the BBSH assay is prefaced with a 3SR amplification reaction. DISCUSSION
The hybridization characteristics of oligonucleotidealkaline phosphatase conjugates in BBSH reactions were investigated using a CL detection format. Single photon counting luminometers afforded exquisite sensitivities and wide dynamic range in the measurement of the emitted light signals and as little as 60 000 molecules of oligonucleotide-alkaline phosphatase conjugate were facilely
,
"
60
I
90
'
"
120
Time (minutes)
"
I
150
'
'
100-
0 0
,
"
20
1
'
40
'
"
'
60
80
100
fmoles probe
detected (Figure 3). Calibration curve plotting CL signal versus conjugate spanning four log concentrations were generated and used to quantitate conjugate associated in a sandwich complex after a BBSH reaction (Table 11). The BBSH reaction with target RNA was more efficient at 50 OC than at 42 O C , presumably because the secondary structures of both the probe and the target nucleic acids are more relaxed at the elevated temperature (Table 11). Although the conjugate's enzymatic activity was depressed at 50 OC, inclusion of glycerolin the hybridization solution was found to restore the enzymatic activity (Figure 3). The stabilization of the conjugate in the presence of glycerolonly partially accounted for the increase in signal for BBSH reactions at 50 "C, since there was also an unexpected improvement in hybridization efficiency in the presence of the additive (Table 11). The nature of the effect of glycerol in the BBSH reaction is at present unknown. A critical requirement in the BBSH assay was the inclusion of SDS in the hybridization buffer, as this reagent was extremely effective in reducing nonspecific hybridization of the conjugate probe (Figure 4A). It was noted that the sandwich hybridization efficiencies for S2P-labeledprobes were significantly higher than those obtained with conjugates, and approached 60% for the detection of unlabeled RNA target with the 86-272188297 BBSH detection system (results not shown). It was reasoned that the lower BBSH efficiencies observed for the conjugates (Table 11)may be due to unfavorable steric
OligonucleotMe-Alkaline Phosphatase Conjugates
Bloconjugate Chem., Vol. 4, No. 1, l9Q3 90
1001
El mc' 32P U
$
m
I
1000
Y
m n
2
100
0) C .-01
-
n: 0
.e
C
10
c
o 30
1
2.8
20
1.4
0.28
0.028
Target RNA (fmoles)
10 1
0
0
0
0
u
86-272-AP
90-422-AP
B.
W -90-422-AP W -90-675-AP 30
T T
15
10
5
1
0.5
0.1
0.05
Target RNA (fmoles)
86-273
90-673 86-275 Capture Oligobeads
Figure 5. (A) Effect of alkyl spacer length in oligonucleotideAP conjugate probes on BBSH detection of target RNA. 86272-AP probe and 88-297-polystyrene beads were used to detect 0.25 fmol of 218-base, sense HIV-1 enu-region RNA, while 90422-AP conjugate probe and 86-273-polystyrene beads were used to detect 2.5 fmol of 236-base,antisense HIV-1 enu-region RNA. The conjugateprobes were synthesizedusing ethylene (2C,striped bar) and hexylene (6C, solid bar) linkers, respectively. The 218base sense RNA target was generated from a 3SR amplification reaction using primers 88-211* and 86-274. The hybridization reactions were carried out in triplicate. The CL value obtained with substrate alone was subtracted from the test values. The background signals (RLU) generated from nontarget samples were as follows: 86-272-AP (6C), 1137-1421; 86-272-AP (2C), 485-1070; 90-422-AP (6C),755-1471; 90-422-AP (2C), 191-238. (B) Effect of probe length and spatial distance between the capture and detection probes on BBSH detection. 90-422-AP (solid bar) or 90-675-AP (striped bar) conjugate probe, each having a six-carbon spacer, was used in combination with 86273;-, 90-673-, and 86-275-polystyrene beads for detecting 1 fmol of 268-base, antisense HIV-1 env-region RNA target, generated from 3SR amplification of HIV-1using the primer pair 89-255 and 90-374*. The hybridization reactions were carried out in triplicate. The 90-675 sequence has an extra five bases appended to the 5' end of the 90-422 sequence. The CL value obtained with substrate alone was substracted from the test values. interactions. This could arise d u e to t h e inadequate length of t h e ethylene spacer between alkaline phosphatase and t h e oligonucleotide in t h e conjugate, as well as t h e proximity of t h e conjugate to t h e immobilized capture oligonucleotide (see Figures 1 and 2). Therefore, t h e
Figure 6. Direct comparison of CL and 32Pdetection in a BSSH format. A range of concentrations of 3SR-amplified, sense and antisense HIV-1 enu-region RNA were assayed using alkaline phosphatase conjugate and 32P-radiolabeled oligonucleotide probes. An antisense HIV-1 pol-region RNA was used as a negative control. The CL value obtained with substrate alone was subtracted from the test values. Figure A shows signal-tobackground ratios for detecting 3SR-amplified, 218-base, sense HIV-1 env-region RNA using 86-272-AP (solid bar) or 32P-86272 (striped bar) detection probe (specific activity: 6 X 108cpm/ pmol) and 88-297-polystyrene beads. The asterisk on solid bar indicates estimate since signal was over range. The hybridization reactions were carried out in duplicate. Figure B shows signalto-background ratios for detecting 3SR-amplfied, 236-base, antisense RNA with 90-422-AP (solid bar) or 32P-90-422(striped bar) detection probe (specificactivity: 2.5 X lo6 cpm/pmol)and 86-273-polystyrene beads. influence of t h e following variables was investigated to further characterize the behavior of a conjugate-based BBSH system: (1)probe concentrations in the hybridization reaction, (2) alkyl spacer length in the conjugates, (3) length of probe sequence, and (4) the spatial distance between t h e capture and detection probes. A concomitant increase in signal was observed upon increasing t h e probe concentration in the BBSH reaction (Figure 4C). This suggested that increasing the probe/ target ratio drives the kinetics of duplex formation and results in higher hybridization efficiencies of t h e conjugate with ita RNA target. From these observations and other similar assays, 50 fmol was found to be the optimal amount of conjugate for assaying 10 fmol or less of target. It was envisioned that increasing t h e spatial separation between the nucleic acid and alkaline phosphatase would minimize the steric interference of t h e enzyme moiety in the hybridization reaction of t h e oligonucleotide compon e n t with its complementary target. This hypothesis was borne out by the t r e n d of elevated signal-to-background ratios observed with conjugates which had a six-carbon spacer between t h e oligonucleotide and alkaline phosphatase (Figure 5A).
~
40
Bloconjugate Chem., Vol. 4, No. 1, 1993
Ishll and Ghosh
102
0001
,001
01
.1
10
1
100
Amplified HIV-1 RNA (fmoles)
8oo
1T
1000.0
B.
100.0
10.0
1.0
(-) Control
HIV-1infected CEM cells
Figure 7. (A) Plot of CL signal versus quantitated amounts of 3SR-amplified target RNA. A range of concentrations of 3SRamplified, antisense HIV-1 enu-region RNA generated using primers 89-255 and 88-347' was assayed with 10 fmol of 90422-AP conjugate probe and 86-273-polystyrene beads. Inset: linear portion of the curve spanning 10-17-10-14mol of target. (B) Detection and quantitation of HIV-1-infected cells using a coupled 3SR/BBSH assay. HIV-1 (LAV) infected CEM cells in a background of 10" uninfected PBMCs were lysed in 6 M guanidinium isothiocyanate/O.l M P-mercaptoethanoland then added to 20 mg of 90-66-Trisacryl oligobeads (28) for capture of the HIV-1 RNA at room temperature for 90 min. The oligobeads were washed three times each with 1 mL of 0.3 M NaCl followed by two times with 1 mL each of 3SR reaction buffer. Amplification of the enu region was performed in the presence of the oligobeads using primers 88-211*/88-347' in a 3SR reaction. The resulting products were detected by BBSH in duplicate reactions using 90-422-AP conjugate probe and 86273-polystyrene beads. The 3SR-amplified products were quantitated by correlating the observed CL signals with the linear segment of a calibration curve described above, and reported as fmol/pL of 3SR amplified product. The 3SR-amplified products were also independently quantitated using a BBSH assay employing 32P-labeled 90-422 detection probe and 86-273Trisacryl oligobeads. On the basis of specific activity of the detection probe (2.5 X lo6cpm/pmol),456.0,117.0,29.0, and 21.0 fmol/pL of 3SR product were obtained from 1000,100, 10, and 1 HIV-1-infected cell samples, respectively.
The oligonucleotide sequence of 90-422-AP conjugate was extended to ascertain if the extra bases of the resulting 90-675-AP conjugate would enhance its efficiency of hybridization with its complementary target. Further, the conjugates were used in combination with different capture beads to examine the effect of greater spatial distance between the capture and detection probes. An improvement in overall hybridization efficiency was observed using longer detection probes (Figure 4B). However, increasing the distance between the capture and
detection sequences did not afford higher signal-tobackground ratios. This unexpected result may reflect poor capture efficiency of the 86-275-polystyrene beads due to a higher degree of secondary structure of the RNA target near its region of homology. From the studies discussed above, the accessibility of the probe-complementary regions of the RNA target emerges as a critical factor and is dependent on the secondary structure adopted by the target under the pseudosolution hybridization conditions of the BBSH reaction. It is likely that the differences observed in the sensitivity of detection of the two RNA targets using either conjugates or 32P-labeledoligonucleotides (Figures 5A, 6) arise from differences in the complexity of the secondary structure of the targets. Further, local secondary structure may account for differences observed in the sensitivity of detection of a common RNA target with different capture bead/conjugate probe combinations (Figure 5B). The effect of secondary structure is minimized in filter-based assays these probes, since the target is immobilized in denatured form. While temperatures higher than 50 "C facilitate denaturation of target, such conditions would be detrimental to the enzymatic activity of the conjugates in BBSH assays. The conjugate-based detection system is at least as sensitive as 32Pdetection in BBSH assays (Figure 6). Typically, a manual assay employing 18 tubes requires 3 h for assay setup, hybridization reaction, and centrifugation steps, followed by detection. The CL BBSH assay for experiments performed in quadruplicate is quite reproducible and the variability, expressed by percent ratio of standard deviation/signal, is typically 10% or less. However, the day-to-day variability appears to be somewhat higher (-15%) (data not shown). Due to the inherent variability of the detection system and the dayto-day variability, an alternate approach was adopted for quantitation of unknown target using standard curves plotting BBSH signal against known amounts of target HIV-1 RNA (Figure 7A). Such calibration curves were utilized for reliable quantitation of products from 3SR amplification reactions. Following target amplification using the 3SR reaction, the BBSH assay is easily capable of detection one HIV-1 (LAV)infected CEM cell ina background of 106uninfected cells (Figure 7B). A calibration curve (Figure 7A) was used to quantitate the CL signals obtained in the BBSH assays of the 3SR amplified products. As seen in Figure 7B, there was no correlation of 3SR product detected with the number of HIV-1-infected cells present in the samples. In particular, equivalent amounts of 3SR amplification product were detected by the CL assay for the 10- and one-infected-cell samples, which was also noted in BBSH assays using 32Pdetection (see legend for Figure 7). This lack of correlation is presumably due to the variability associated with sample preparation step, as well as differences in amplification efficiencies of the 1 h 3SR reaction with the extracted target RNA. It has been shown that between 20 and 35 min of the 3SR reaction, there is a linear relationship between 3SR-generated product and amount of initial target nucleic acid for target amounts ranging from lo2to lo4molecules (30). Beyond this time interval, the product accumulation curves converge and the linear relationship no longer holds when total 3SR product synthesized exceeds approximately 50 fmolIpL. Thus, meaningful quantitation of HIV-1 present in infected-cell samples requires reproducible and efficient sample preparation, and BBSH detection of 3SR-generated products which are obtained at reaction timepoints where the efficiency of amplification is independent of starting target amounts. Our current efforts are directed
Ollgonucleotlde-Alkaline Phosphatase Conjugates
toward addressing these issues in order to successfully apply the 3SR/enzyme-based BBSH system for quantitative DNA diagnostics. ACKNOWLEDGMENT
We are grateful to K. Blumeyer,K. Fearon, L. Beninsig, K. Stringer, L. DiMichele, and W. Walker, for technical assistance,and to G. Davis, D. Kwoh, and T. Gingeras,for critical reading of the manuscript. This work was supported by funds from Baxter Diagnostics, Inc. LITERATURE CITED (1) Landry, M. L. (1990) Nucleic acid hybridization in viral diagnosis. Clin. Biochem. 23, 267-277. (2) Dawson, D. B. (1990) Use of nucleic acid probes in genetic tests. Clin. Biochem. 23, 279-285. (3) Saiki, R. K., Scharf, S., Faloona, F. A., Mullis, K. B., Horn, C. T., Erlich, H. A., and Arnheim, N. (1985) Enzymatic amplification of @-globingenomic sequences and restriction site analysis for diagnosis of sickle cell anemia. Science 230, 1350-1354. (4) Barany, F. (1991) Genetic disease detection and RNA amplification using cloned thermostable ligase. Proc. Natl. Acad. Sci. U.S.A. 88, 189-193. (5) Guatelli, J. C., Whitfield, K. M., Kwoh, D. Y., Barringer, K. J., Richman, D. D., and Gingeras, T. R. (1990) Isothermal in vitro amplification of nucleic acids by a multienzyme reaction modeled after retroviral replication. Proc. Natl. Acad. Sci. U.S.A. 87, 1874-1878. (6) Bej, A. K., Mahbubani, M. H., and Atlas, R. M. (1991) Amplification of nucleic acids by polymerase chain reaction (PCR) and other methods and their applications. Crit. Reu. Biochem. Mol. Biol. 26 (3/4), 301-334. (7) Matthews, J. A., and Kricka, L. J. (1988) Analyticalstrategies for the use of DNA probes. Anal. Biochem. 169, 1-25. (8) Ghosh, S. S., Kao, P. M., McCue, A. W., and Chappelle, H. L. (1990) Use of maleimide-thiol coupling chemistry for efficient syntheses of oligonucleotide-enzyme conjugate hybridization probes. Bioconjugate Chem. I, 71-76. (9) Ghosh, S. S., Kao, P. M., and Kwoh, D. Y. (1989) Synthesis of 5’-oligonucleotide hydrazide derivatives and their use in preparation of enzyme-nucleic acid hybridization probes. A n d . Biochem. 178, 43-51. (10) Jablonski, E., Moomaw, E. W., Tullis, R. H., and Ruth, J. L. (1986) Preparation of oligodeoxynucleotide-alkalinephosphatase conjugates and their use as hybridization probes. Nucleic Acids Res. 14, 6115-6128. (11) Li, P., Medon, P. P., Skingle,D.C., Lanser, J. A.,and Symons, R. H. (1987) Enzyme-linked synthetic oligonucleotideprobes: Non-radioactive detection of enterotoxigenic Escherichia coli in faecal specimens. Nucleic Acids Res. 15, 5275-5287. (12) Urdea, M. S., Kolberg, J., Clyne,J., Running, J. A., Bessemer, D., Warner, B., and Sanchez-Pescador, R. (1989) Application of a rapid non-radioisotopic nucleic acid analysis system to the detection of sexually transmitted disease-causingorganisms and their associated antimicrobial resistances. Clin. Chem. 35, 1571-1575. (13) Bronstein, I., Voyta, J. C., and Edwards, B. (1989) A comparison of chemiluminescent and colormetric substrates in a hepatitisB virusDNA hybridizationassay. Anal. Biochem. 180,95-99. (14) Pollard-Knight, D., Simmonds, A. C., Schaap, A. P., Akhavan, H. and Brady, M. A. (1990) Nonradioactive DNA detection on Southern blots by enzymaticallytriggered chemiluminescence. Anal. Biochem. 185, 353-358. (15) Schapp, A. P., Akhavan, H. and Romano, L. J. (1989) Chemiluminescent substrates for alkaline phosphatase: ap-
Bioconjusmte Chem., Vol. 4, No. 1, 1993 41
plication to ultrasensitive enzyme-linked immunoassays and DNA probes. Clin. Chem. 35, 1863-1864. (16) Bronstein, I., Edwards, B., and Voyta, J. C. (1988) Novel chemiluminescent enzyme substrates and their applications in immunoassays [Abstract]. J . Biolumin. Chem. 2, 186. (17) Thompson, J. D., and Gillespie,D. (1990) Current concepts in quantitative molecular hybridization. Clin. Biochem. 23, 261-266. (18) Kwoh, D. Y., and Gingeras, T. R. (1991) The use of transcription-based amplification systems in the diagnosis of HIV-1 infections. App. Virol. Res. (in press). (19) Ranki, M., Palva, A., Virtanen, M., Laaksonen, M., and Soderland, H. (1983) Sandwich hybridization as a convenient method for detection of nucleic acids in crude samples. Gene 21, 77-85. (20) Kwoh, D. Y., Davis, G. R., Whitfield, K. M., Chappelle, H. L., DiMechele,L. J., and Gingeras, T. R. (1989) Transcriptionbased amplification system and detection of amplified human immunodeficiency virus type 1 with a bead-based sandwich hybridization format. Proc. Natl. Acad. Sci. U.S.A.86,11731177. (21) DahlBn, P. O., Iitia, A. J., Skagius, G., Frostell, A., Nunn, M. F., and Kwiatkowski, M. (1991) Detection of human immunodeficiencyvirus type 1 by using the polymerase chain reaction and a time-resolved fluorescence-basedhybridization assay. J . Clin. Microbiol. 29, 798-804. (22) Bush, C. E., Donovan, R. M., Peterson, W. R., Jennings, M. B., Bolton, V., Sherman, D. G., Vanden Brink, K. M., Beninsig, L. A., and Godsey, J. H. (1992) Detection of human immunodeficiency virus type 1 RNA in plasma from high-risk pediatric patients by using the self-sustained sequence replication reaction. J . Clin. Microbiol. 30, 281-286. (23) GenBank Release Notes 67.0. Accession KO2013 (IntelliGenetics, Inc.). (24) Bailey, J. N., Klement, J. F., and McAllister, W. T. (1983) Relationship between promoter structure and template specificities exhibited by the bacteriophage T3 and T7 RNA polymerases. Proc. Natl. Acad. Sci. U.S.A. 80, 2814-2818. (25) Ghosh, S. S., and Musso, G. M. (1987) Covalent attachment of oligonucleotides to solid supports. Nucleic Acids Res. 15, 5353-5372. (26) Connolly,B. A., and Rider, P. (1985) Chemical synthesis of oligonucleotides containing a free sulfhydryl group and subsequent attachment of thiol specific probes. Nucleic Acid Res. 13,4485-4502. (27) Sambrook, J., Fritsch, E. F., and Maniatis, T. (1989) Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor. (28) Davis, G. R., Blumeyer, K., DiMichele, L. J., Whitfield, K. M., Chappelle, H., Riggs, N., Ghosh, S. S., Kao, P. M., Fahy, E., Kwoh, D. Y., Guatelli, J. C., Spector, S. A., Richman, D. D., and Gingeras, T. R. (1990) Detection of human immunodeficiency virus type 1 in AIDS patients using amplification mediated hybridization analysis: Reproducibility and quantitative limitations. J . Infect Dis. 162, 13-20. (29) Fahy, E., Kwoh, D. Y., and Gingeras, T. R. (1991) Selfsustained sequence replication (3SR): An isothermal transcription-based amplification system alternative to PCR. PCR Methods Appl. I, 25-33. (30) Gingeras, T. R., and Kwoh, D. Y. (1992) In vitro nucleic acid target amplification techniques: issues and benefits. Jahrbuch Biotechnologie Band 4 (P. Prave, M. Schlingmann, K. Esser, R. Thauer, and F. Wagner, Eds.) pp 403-429. Registry No. Alkaline phosphatase, 9001-78-9; glycerol, 5681-5; polystyrene, 9003-53-6.
