Benzyl Isothiocyanate and Phenethyl Isothiocyanate Inhibit

Jun 5, 2019 - Decreasing intake of energy-rich food and increasing physical activity are ...... Lee, Y. M.; Choi, J. S.; Kim, M. H.; Jung, M. H.; Lee,...
0 downloads 0 Views 7MB Size
Download PDF
Article pubs.acs.org/JAFC

Cite This: J. Agric. Food Chem. 2019, 67, 7136−7146

Benzyl Isothiocyanate and Phenethyl Isothiocyanate Inhibit Adipogenesis and Hepatosteatosis in Mice with Obesity Induced by a High-Fat Diet Wei-Ting Chuang,† Yun-Ta Liu,† Chin-Shiu Huang,‡ Chia-Wen Lo,† Hsien-Tsung Yao,† Haw-Wen Chen,*,† and Chong-Kuei Lii*,†,‡ †

Department of Nutrition, China Medical University, Taichung 404, Taiwan Department of Health and Nutrition Biotechnology, Asia University, Taichung 413, Taiwan

Downloaded via UNIV OF SOUTHERN INDIANA on July 17, 2019 at 14:29:00 (UTC). See https://pubs.acs.org/sharingguidelines for options on how to legitimately share published articles.

‡

ABSTRACT: Benzyl isothiocyanate (BITC) and phenethyl isothiocyanate (PEITC) are organosulfur phytochemicals rich in cruciferous vegetables. We investigated the antiobesity and antihepatosteatosis activities of BITC and PEITC and the working mechanisms involved. C57BL/6J mice were fed a low-fat diet (LFD), a high-fat diet (HFD), or a HFD supplemented with 0.5 (L) or 1 g/kg (H) BITC or PEITC for 18 weeks. Compared with the HFD group, BITC or PEITC decreased the final body weight of mice in a dose-dependent manner [39.0 ± 3.1 (HFD), 34.4 ± 3.2 (BITC-L), 32.4 ± 2.8 (BITC-H), 36.2 ± 4.4 (PEITC-L), and 32.8 ± 2.9 (PEITC-H) g, p < 0.05], relative weight of epididymal fat [5.7 ± 0.4 (HFD), 4.7 ± 0.7 (BITC-L), 3.7 ± 0.3 (BITC-H), 4.4 ± 1.0 (PEITC-L), and 3.2 ± 0.6 (PEITC-H) %, p < 0.05], hepatic triglycerides [98.4 ± 6.0 (HFD), 81.0 ± 8.9 (BITC-L), 63.5 ± 5.6 (BITC-H), 69.3 ± 5.6 (PEITC-L), and 49.4 ± 2.9 (PEITC-H) mg/g, p < 0.05], and plasma total cholesterol [140 ± 21.3 (HFD), 109 ± 5.6 (BITC-L), 101 ± 11.3 (BITC-H), 126 ± 8.3 (PEITC-L), and 91.8 ± 12.7 (PEITC-H) mg/dL, p < 0.05]. Q-PCR and immunoblotting assays revealed that BITC and PEITC suppressed the expression of liver X receptor α, sterol regulatory element-binding protein 1c, stearoyl-CoA desaturase 1, fatty acid synthase, and acetyl-CoA carboxylase in both epididymal adipose and liver tissues. After a single oral administration of 85 mg/kg BITC or PEITC, the maximum plasma concentrations (Cmax) of BITC and PEITC were 5.8 ± 2.0 μg/mL and 4.3 ± 1.9 μg/mL, respectively. In 3T3L1 adipocytes, BITC and PEITC dose-dependently reduced adipocyte differentiation and cell cycle was arrested in G0/G1 phase. These findings indicate that BITC and PEITC ameliorate HFD-induced obesity and fatty liver by down-regulating adipocyte differentiation and the expression of lipogenic transcription factors and enzymes. KEYWORDS: benzyl isothiocyanate, phenethyl isothiocyanate, obesity, hepatosteatosis, pharmacokinetic receptors, signaling kinases, transcription factors, and enzymes.6 In the case of mouse 3T3-L1 preadipocytes, when stimulated by differentiation medium, cAMP response element-binding protein (CREB) is first phosphorylated by protein kinase A, and then activated CREB promotes CCAAT/enhancer-binding protein (C/EBP) β expression. C/EBPβ acquires DNA binding activity by dual phosphorylation via mitogen-activated protein kinase (MAPK) and glycogen synthase kinase (GSK) 3β. The dually phosphorylated C/EBPβ moves into the nuclei and upregulates the gene transcription of C/EBPα and peroxisome proliferator-activated receptor (PPAR) γ. Consequently, these lipogenic transcription factors up-regulate the expression of genes encoding a series of downstream target enzymes such as fatty acid synthase (FAS), stearoyl-CoA desaturase 1 (SCD1), acetyl-CoA carboxylase (ACC), and lipoprotein lipases, whose metabolic activity determines the adipocyte characteristics.6 Other transcription factors such as CEBPδ, sterol regulatory element-binding protein (SREBP) 1c, and liver X receptor (LXR) α are also known to regulate adipogenesis.7 In liver tissue, SREBP1c and LXRα are important in controlling

1. INTRODUCTION Excess energy intake and sedentary life style cause obesity, which in turn leads to increased systemic inflammation and a number of metabolic diseases including cardiovascular diseases, hypertension, hyperlipidemia, type 2 diabetes mellitus, and nonalcoholic fatty liver disease (NAFLD).1 The Global Health Observatory reported that the worldwide prevalence of obesity has more than doubled since 1980.2 In line with the rapid growth of obesity worldwide, the prevalence of NAFLD has accelerated as well. A recent meta-analysis of 86 studies from 22 countries indicated that the average global prevalence of NAFLD is 25.24% (95% CI: 22.10−26.85), with the highest incidence in the Middle East and South America, whereas the lowest incidence is in Africa.3 Hence, establishing effective strategies for preventing and reducing the rise in obesity is an uppermost public health issue. Decreasing intake of energy-rich food and increasing physical activity are the most effective ways to control body weight, although alternative treatments are also available. These include antiobesity drugs, such as phentermine, liraglutide, and orlistat (Xenical), and natural bioactive components of the diet such as dietary fiber.4,5 Obesity primarily results from increases in adipocyte number (hyperplasia) and adipocyte size (hypertrophy), a process named adipogenesis. Adipogenesis is a complex process that needs to be fine-tuned by a number of regulators including © 2019 American Chemical Society

Received: Revised: Accepted: Published: 7136

April 28, 2019 June 4, 2019 June 5, 2019 June 5, 2019 DOI: 10.1021/acs.jafc.9b02668 J. Agric. Food Chem. 2019, 67, 7136−7146

Article

Journal of Agricultural and Food Chemistry lipogenesis, cholesterogenesis, and cholesterol uptake as well.8 Dysregulation of the expression and activity of SREBP1c and LXRα is associated with a number of metabolic disorders in the liver. For example, patients with NAFLD have significantly higher expression of SREBP-1c than do healthy subjects.9 Phenethyl isothiocyanate (PEITC) and benzyl isothiocyanate (BITC) are two natural products generated from gluconasturtiin and glucotropaeolin, respectively, by the enzyme myrosinase.10 PEITC is rich in cruciferous vegetables, especially watercress, and BITC is rich in cabbage, papaya seed, and Alliaria petiolata.11,12 PEITC and BITC possess potent anticancer, anti-inflammatory, and antioxidant properties.13 They are reported to inhibit 4-(methylnitrosamino)-1-(3pyridyl)-1-butanone- and N-nitroso-benzylmethylamine-induced lung and esophagus tumorigenesis, respectively.14,15 BITC inhibits lipopolysaccharide and interferon γ-induced inflammatory responses in Raw264.7 macrophages and reduces 12-O-tetradecanoylphorbol-13-acetate-induced ear edema in mice.16 BITC and PEITC activate Nrf2 and up-regulate heme oxygenase 1, glutamate cysteine ligase, and glutathione Stransferase expression and activity, which help to protect against oxidant insult.17 To date, however, few studies have addressed the chemopreventive activity of BITC and PEITC on obesity and hepatosteatosis. These studies reported that PEITC suppresses adipocyte differentiation from adipose-derived stem cells18 and BITC given intraperitoneally reduces HFDinduced body weight gain, adipose tissue weight, and lipid contents in liver.19 However, the underlying mechanism of these antiobesity and anti-NAFLD effects has not yet been fully elucidated. In this study, we used an in vitro experiment with 3T3-L1 preadipocytes and a mouse model of HFD-induced obesity to examine the protective effect of BITC and PEITC on obesity and hepatic steatosis and the working mechanisms involved.

histochemical staining. Ethical approval was obtained from the Institutional Animal Care and Use Committee of China Medical University (104−118-N) and mice were treated in accordance with the Minister of Science and Technology Guide for the Care and the Use of Laboratory Animals (Taipei, Taiwan). 2.3. Histological Examination. Liver and epididymal adipose tissues were fixed in 4% formaldehyde and embedded in paraffin, sectioned in thicknesses of 3 μm, and stained with hematoxylin and eosin (HE). Photos of tissue sections were taken under an OLYMPUS (IX71) microscope. 2.4. Biochemical Analysis. Plasma triglyceride, glutamatepyruvate transaminase (GPT), and total cholesterol concentrations were determined by use of Diasys kits (Holzheim, Germany); insulin levels were determined by use of Mercodia kits (Uppsala, Sweden); and glucose and nonesterified fatty acid (NEFA) contents were determined by use of Randox kits (Kearneysville, WV) according to the manufacturer’s instructions. 2.5. Cell Differentiation and Treatments. 3T3-L1 preadipocytes were cultured and differentiated as described previously.20 Briefly, 3T3-L1 preadipocytes were grown in basal medium (DMEM supplemented with 10% cosmic calf serum, 1.5 mg/mL sodium bicarbonate, 0.11 mg/mL sodium pyruvate, 100 units/mL penicillin, and 100 μg/mL streptomycin, pH 7.2) in a humidified atmosphere of 5% CO2. Cell differentiation was initiated 48 h after the cells had reached confluence by exposing the cells to basal medium containing 10 μg/mL insulin, 0.5 mM IBMX, and 0.25 μM dexamethasone (termed DMI) for 2 days, after which the medium was changed to the basal medium containing 10 μg/mL insulin (DMII) for additional 6 days. BITC and PEITC were prepared in DMSO, and cells were treated with each of isothiocyanates up to 10 μM for the time period indicated. Cells treated with 0.1% DMSO were used as controls. Cell viability was determined by the 3-(4,5-dimethylthiazol-2-yl)-2,5diphenyltetrazolim bromide (MTT) method and was greater than 90% when cells were treated with 10 μM BITC and PEITC for up to 8 days. 2.6. Cell Cycle Determination. Cells were washed with cold PBS twice, trypsinized with 0.25% trypsin-EDTA solution for 3 min, centrifuged at 1500 × g for 5 min, and fixed with 75% ethanol overnight. Thereafter, cells were treated with PBS containing 4 μg/mL propidium iodide (PI), 1% triton X-100, and 0.5 μg/mL RNase A for 30 min. The cellular DNA content following cell staining with PI was determined by using a flow cytometry (FACSCanto II, BeckmanCoulter) with excitation at 488 nm and emission at 600 nm. 2.7. Oil Red O Staining and Cellular Lipid Content Determination. Cellular lipid droplets were measured as previously described.20 After treatment, adipocytes were washed with PBS, fixed with 4% formaldehyde, and then stained by incubating with 5 μg/mL oil red O in 60% isopropanol solution for 15 min. After excess oil red O was washed with ddH2O, changes in intracellular lipid droplets were photographed under light microscopy. Afterward, oil red O was extracted with isopropanol, and the lipid contents were determined by measuring absorbance at 490 nm. In addition, cellular lipid contents were also examined by using AdipoRed (Lonza, Allendale, NJ) according to the manufacturer’s instructions. 2.8. SDS-PAGE and Immunoblotting. Cells were harvested in RIPA buffer containing 50 mM tris-HCl pH 7.4, 150 mM NaCl, 0.1% SDS, 1% NP-40 and 0.5% sodium deoxycholate, and proteinase inhibitor cocktail and phosphatase inhibitor cocktail 3 (SigmaAldrich), pH 7.4. Liver and epididymal adipose tissue were homogenized in ice-cold PBS containing protease inhibitor cocktail and phosphatase inhibitor cocktail 3 using the porous bead mill homogenizer (Jingxin, Shanghai, China). After centrifugation at 10 000 × g for 15 min, the protein contents of cell lysates and tissue homogenates were determined by using the Coomassie plus protein assay kit (Bio-Rad). Proteins were electrophoresed by SDS-PAGE and were then transferred to polyvinylidene fluoride membranes. After blocking in 5% skin milk solution, the membranes were hybridized with respective primary antibodies and horseradish peroxidaseconjugated secondary antibodies. Finally, the immunoreactive bands

2. MATERIALS AND METHODS 2.1. Chemicals. Insulin was from Calbiochem (Darmstadt, Germany). Dexamethasone, 3-isobutylmethoxylxanthine (IBMX), benzyl isothiocyanates (>98%), and phenethyl isothiocyanates (>99%) were from Sigma-Aldrich (St. Louis, MO). Dulbecco’s modified Eagle medium (DMEM), penicillin, and streptomycin were from Gibco Laboratory (Grand Island, NY). Cosmic calf serum was from Hyclone (Logan, UT). Antibodies against C/EBPα (sc-61) and LXRα (sc-1202) were from Santa Cruz (Santa Cruz, CA); SREBP1 (NB600−582) was from Novus (Littleton, CO); PPARγ (#2443), FAS (#3180), and ACC (#3676) were from Cell Signaling (Danvers, MA); C/EBPβ (ab52194) and SCD-1 (ab19862) were from Abcam (Cambridge, MA); GAPDH (#MAB374) was from Millipore (Billerica, MA); and α-tubulin (GTX628802) was from GeneTex (Irvine, CA). 3T3-L1 preadipocytes were purchased from Bioresources Collection and Research Center (BCRC, Hsin-Chu, Taiwan). 2.2. Animal and Diet Treatments. Male 4-week-old C57BL/6J mice were purchased from the National Laboratory Animal Center (Taipei, Taiwan) and were housed in the Animal Center of China Medical University. After a 1-week acclimation, mice were randomly assigned to six groups (n = 5). They were low-fat diet (LFD, 10% kcal from fat), HFD (60% kcal from fat), HFD supplemented with 0.5 g/kg BITC (BITC-L), HFD supplemented with 1 g/kg BITC (BITC-H), HFD supplemented with 0.5 g/kg PEITC (PEITC-L), and HFD supplemented with 1 g/kg PEITC (PEITC-H). Animals were allowed free access to their diet and drinking water. Body weight was monitored once a week. After 18 weeks of feeding, the mice were deprived of food overnight and blood samples were withdrawn by heart puncture. Liver tissue and epididymal and perirenal adipose tissue, and quadriceps tissue were removed, weighed, and stored at −80 °C. Part of the liver and adipose tissue was cut and fixed for later 7137

DOI: 10.1021/acs.jafc.9b02668 J. Agric. Food Chem. 2019, 67, 7136−7146

Article

Journal of Agricultural and Food Chemistry Table 1. Primers Used for Q-PCR Analysis gene

forward

reverse

C/EBPα (NM_001287523) PPARγ (NM_001308354) SREBP1c (NM_001313979.1) LXRα (NM_013839.4) FAS (NM_007988.3) SCD-1 (NM_009127.4) ACC (NM_133360.2) GAPDH (NM_001289726)

CTCGGTGCGTCTAAGATGA GTGCCAGTTTCGATCCGTAGA CGTCTGCACGCCCTAGG GCCTCAATGCCTGATGTTTC GCTGCGGAAACTTCAGGAAAT CCGGAGACCCCTTAGATCGA TGACAGACTGATCGCAGAGAAAG GCCTGGAGAAACCTGCCAAGTAG

AGTCTCTCGGTCTCAAGGA GGCCAGCATCGTGTAGATGA CTGGAGCATGTCTTCAAATGTG CTGCATCTTGAGGTTCTGTCTTC AGAGACGTGTCACTCCTGGACTT TAGCCTGTAAAAGATTTCTGCAAACC TGGAGAGCCCCACACACA GGGAGTTGCTGTTGAAGTCGCA

Figure 1. Changes in body weight. C57BL/6J mice were fed the low-fat diet (LFD), high-fat diet (HFD), or HFD supplemented with 0.5 (L) or 1 g/ kg (H) benzyl isothiocyanate (BITC) or phenylethyl isothiocyanate (PEITC) for 18 weeks. Body weight was monitored every other week. Values are mean ± SD, n = 5. ∗ versus LFD, p < 0.05. abValues without the same letter differ significantly, p < 0.05. were detected by using an enhanced chemiluminescence plus Western blotting detection reagent (Millipore, Billerica, MA). 2.9. Quantitative Real-Time Polymerase Chain Reaction (QPCR). Cellular RNA was prepared by TRIzol reagent (Invitrogen, Carlsbad, CA). An amount of 1 μg isolated RNA was reverse transcribed by use of 50 units of Moloney murine leukemia virus reverse transcriptase (Invitrogen) in the presence of 1X reverse transcribed buffer, 0.25 mM dNTP, 10 units RNase inhibitor, and 0.5 μM oligo(dT) in a final volume of 20 μL. Thereafter, cDNA was amplified in a thermocycler (MiniOpticon CFB-31, Bio-Rad) in a reaction volume of 20 μL containing 5 μL of cDNA, 2X SYBR Green PCR Master Mix (Bio-Rad), and primers (250 nM). Data were analyzed by the 2−ΔΔCt method using GAPDH mRNA as the internal control. The primer sequences used are listed in Table 1. The primers for Q-PCR were designed by using NCBI Primer-BLAST (https:// www.ncbi.nlm.nih.gov/tools/primer-blast/) with a length of 17−26 bases and a GC content of 40−60%. PCR conditions were as follows: a denaturation temperature of 95 °C for 5 s, an annealing temperature of 50 °C (C/EBPα), 60 °C (PPARγ), 55 °C (SREBP1c), 55 °C (LXRα), 60 °C (FAS), 55 °C (SCD-1), 60 °C (ACC), and 55 °C (GAPDH) for 30 s, and an extension temperature of 65 °C for 5 s. 2.10. Pharmacokinetic Study. Eight-week-old male C57BL/6J mice purchased from the National Laboratory Animal Center (Taipei, Taiwan) were fed a standard rat diet (Prolab 184 RMH500, LabDiet, St. Louis, MO) ad libitum. After a 3-week acclimation, mice were orally administered a single dose of 85 mg/kg BITC or PEITC (n = 5), which was estimated based on the amount of isothiocyanate ingested from diet supplemented with 1 g/kg. BITC and PEITC were prepared in 0.5% methyl cellulose (5 mL/kg). Blood samples were collected at 0, 0.25, 1, 2, 4, and 10 h after dosing, and heparin was used as an anticoagulant.

Plasma level of BITC and PEITC was determined by HPLC as described by Ye and colleagues.21 Briefly, 25 μL plasma was incubated with a reaction mixture containing 25 μL of 100 mM potassium phosphate buffer (pH 8.5) and 50 μL of 20 mM 1,2-benzenedithiol in acetonitrile at 65 °C for 2 h to allow BITC or PEITC and their metabolites, that is, mainly N-acetylcysteine conjugates, to be converted into 1,3-benzodithiole-2-thione. After centrifugation, 1,3benzodithiole-2-thione was determined by HPLC (Hitachi 2000) equipped with an Agilent poroshell HPH-C18 column (2.7 μm, 3.0 mm × 100 mm) and an UV detector (365 nm wavelength). The mobile phase composition was acetonitrile (solvent A) and ddH2O (solvent B). The following gradient systems were used: 50% A (0−1 min), 50% A to 90% A (1−18 min), 90% A (18−20 min), 90% A to 50% A (20−22 min), and 50% A (22−30 min). The flow rate was 0.3 mL/min, and sample injection volume was 10 μL. 1,3-Benzodithiole-2thione was eluted approximately at 9.5 min. Calibration standards of BITC and PEITC were prepared by serial dilution of each isothiocyanate stock solution with blank plasma, which yield final concentrations ranging from 0.1 to 100 μg/mL of plasma. 2.11. Statistical Analysis. Data are expressed as means ± SD. Statistical analysis was performed by using SPSS statistical software (Armonk, NY). The significance of differences among group means of mice fed the HFD and HFD supplemented with different amounts of BITC or PEITC as well as 3T3-L1 cells cultured with differentiated medium in the presence or absence of each isothiocyanate was determined by one-way ANOVA followed by Tukey’s test. For testing the difference between mice fed the LFD and HFD or 3T3-L1 cells treated with undifferentiated and differentiated medium, Student’s ttest was performed. P-values less than 0.05 were considered to be statistically significant. 7138

DOI: 10.1021/acs.jafc.9b02668 J. Agric. Food Chem. 2019, 67, 7136−7146

Article

Journal of Agricultural and Food Chemistry

Table 2. Effects of Benzyl isothiocyanate (BITC) and Phenylethyl isothiocyanate (PEITC) on Liver, Adipose, and Muscle Tissue Weight1 groups tissues

LFD

HFD

BITC-L

BITC-H

liver (g) liver (% bw) quadriceps (g) quadriceps (% bw) epididymal fat (g) epididymal fat (% bw) perinephric fat (g) perinephric fat (% bw)

1.07 ± 0.09 4.04 ± 0.23 0.44 ± 0.03 1.67 ± 0.06 0.53 ± 0.13 2.01 ± 0.49 0.15 ± 0.02 0.58 ± 0.07

0.98 ± 0.09 2.51 ± 0.17*b 0.43 ± 0.03 1.11 ± 0.06*b 2.25 ± 0.31*a 5.76 ± 0.40*a 1.08 ± 0.2*a 2.75 ± 0.33*a

0.95 ± 0.13 2.76 ± 0.23ab 0.45 ± 0.03 1.30 ± 0.07ab 1.64 ± 0.30bc 4.72 ± 0.71bc 0.72 ± 0.19ab 2.09 ± 0.51ab

0.93 ± 0.10 2.78 ± 0.11ab 0.43 ± 0.02 1.30 ± 0.09ab 1.24 ± 0.13bc 3.73 ± 0.34cd 0.66 ± 0.16b 1.95 ± 0.30bc

PEITC-L 0.92 2.55 0.44 1.22 1.98 4.38 0.77 2.11

PEITC-H

± 0.05 ± 0.19ab ± 0.02 ± 0.15ab ± 0.48ab ± 0.93bc ± 0.21ab ± 0.37abc

0.94 2.88 0.44 1.37 1.08 3.24 0.50 1.51

± 0.06 ± 0.25a ± 0.03 ± 0.22a ± 0.31c ± 0.63d ± 0.20b ± 0.51c

1

Mice were fed the low-fat diet (LFD), high-fat diet (HFD), or HFD supplemented with 0.5 (L) or 1 g/kg (H) BITC or PEITC for 18 weeks. Values are mean ± SD, n = 5. ∗ versus LFD, p < 0.05. abcdMeans without the same letter differ significantly, p < 0.05.

Figure 2. Isothiocyanates decrease adipocyte size and hepatic steatosis. C57BL/6J mice were fed the low-fat diet (LFD), high-fat diet (HFD), or HFD supplemented with 0.5 (L) or 1g/kg (H) benzyl isothiocyanate (BITC) or phenylethyl isothiocyanate (PEITC) for 18 weeks. (A) Representative HE-stained epididymal adipose tissue and quantification of adipocyte size. (B) HE-stained hepatic steatosis and content of triglycerides (TG). Values are mean ± SD, n = 5. ∗ versus LFD, p < 0.05. abcdValues without the same letter differ significantly, p < 0.05.

Table 3. Changes in Blood Biochemical Parameters by Benzyl isothiocyanate (BITC) and Phenylethyl isothiocyanate (PEITC) in Obese Mice1 groups parameters

LFD

HFD

BITC-L

total cholesterol (mg/dL) triglyceride (mg/dL) NEFA (mM) glucose (mM) insulin (uIU/L) HOMA-IR GPT (U/L)

60.0 ± 15.4 31.8 ± 11.1 1.4 ± 0.4 4.5 ± 0.6 9.7 ± 2.8 1.9 ± 0.4 14.0 ± 5.6

140 ± 21.3* 82.0 ± 19.1* 1.9 ± 0.1*a 9.0 ± 1.2*a 13.4 ± 3.4 5.4 ± 1.7*a 27.3 ± 14.8 a

109 78.7 2.0 5.9 10.1 2.6 16.0

BITC-H

± 5.6 ± 4.9 ± 0.1a ± 0.3b ± 3.9 ± 1.0b ± 6.0

bc

PEITC-L

101 ± 11.3 75.3 ± 12.4 1.5 ± 0.3b 5.9 ± 0.8b 9.3 ± 0.5 2.4 ± 0.5b 12.3 ± 2.8

bc

126 79.0 1.5 5.1 12.7 2.9 20.0

± 8.3 ± 9.6 ± 0.2b ± 0.5b ± 3.5 ± 1.0b ± 4.8

ab

PEITC-H 91.8 ± 12.7c 61.7 ± 8.5 0.7 ± 0.2c 5.7 ± 0.8b 9.2 ± 1.9 2.4 ± 0.6b 23.6 ± 13.3

1

After 18 weeks feeding of the low-fat diet (LFD), high-fat diet (HFD), or HFD supplemented with 0.5 (L) or 1 g/kg (H) BITC and PEITC, mice were deprived of food overnight and plasma samples were prepared. Values are mean ± SD, n = 5. ∗ versus LFD, p < 0.05.abcMeans without the same letter differ significantly, p < 0.05. NEFA, nonesterified fatty acids; HOMA-IR = glucose (mmol/L) × insulin (μU/L)/22.5; GPT, glutamatepyruvate transaminase.

3. RESULTS

PEITC taken by each mouse were approximately 1.4 (BITC-L), 2.6 (BITC-H), 1.4 (PEITC-L), and 2.9 (PEITC-H) mg/day. After 8 weeks, the average body weight of mice fed the HFD was significantly higher than that of mice fed the LFD (p < 0.05, Figure 1). When the HFD was supplemented with 0.5 g/kg or 1 g/kg BITC or PEITC, body weight gain was attenuated dosedependently. Compared with mice fed the HFD alone, mice treated with the high dose of BITC or PEITC had significantly

3.1. BITC and PEITC Suppressed Body Weight Gain and Adipose Tissue Weight in HFD-Fed Mice. The average daily food intake of each mouse throughout the experimental period was 3.5 g (LFD), 2.8 g (HFD), 2.8 g (BITC-L), 2.6 g (BITC-H), 2.8 g (PEITC-L), and 2.9 g (PEITC-H), respectively. Accordingly, the absolute amounts of BITC and 7139

DOI: 10.1021/acs.jafc.9b02668 J. Agric. Food Chem. 2019, 67, 7136−7146

Article

Journal of Agricultural and Food Chemistry

Figure 3. Benzyl isothiocyanate (BITC) and phenylethyl isothiocyanate (PEITC) suppress (A) mRNA and (B) protein expression of lipogenic mediators in adipose tissue of mice with HFD-induced obesity. Mice were fed the low-fat diet (LFD), high-fat diet (HFD), or HFD supplemented with 0.5 (L) or 1 g/kg (H) BITC or PEITC for 18 weeks. Epididymal fat was prepared for Q-PCR and immunoblotting assay. Values are mean ± SD, n = 5. ∗ versus LFD, p < 0.05. abcValues without the same letter differ significantly, p < 0.05.

mitigated HFD-induced fasting plasma glucose levels and the HOMA-IR (p < 0.05). A decrease in plasma insulin was also noted, but this change was not significant. No changes in plasma GPT activity were found. 3.3. BITC and PEITC Inhibited the Expression of Lipogenic Mediators. We next examined changes in mRNA and protein levels of lipogenic transcription factors and enzymes in adipose and liver tissues. As shown in Figure 3A, mRNA expression of SREBP1c, PPARγ, LXRα, SCD-1, FAS, and ACC in epididymal adipose tissue was up-regulated in mice fed the HFD compared with the controls (p < 0.05), and this change was mitigated when the diet was supplemented with either 0.5 g/kg or 1 g/kg BITC or PEITC. As shown in immunoblots, the expression of SREBP1c, PPARγ, LXRα, FAS, ACC, and SCD-1 protein in epididymal fat was also suppressed in mice dosed with 1 g/kg BITC or PEITC (p < 0.05, Figure 3B). Although the expression of FAS and ACC mRNA was induced by the HFD, it is interesting to note that FAS and ACC protein levels were down-regulated in mice fed the HFD compared with the LFD-fed group (p < 0.05). In liver, changes in the expression of lipogenic mediators were similar to those observed in adipose tissue. Compared with the LFD, mice fed the HFD had higher hepatic SREBP1c, LXRα, FAS, ACC, and SCD-1 mRNA (Figure 4A) and higher SREBP1c, LXRα, and SCD-1 protein levels (Figure 4B) (p < 0.05). Again, the expression of hepatic FAS and ACC proteins was down-regulated in the HFD group (p < 0.05). With coadministration of 0.5 g/kg or 1 g/kg BITC or PEITC, HFD-

lower body weights after week 14 (p < 0.05). No significant differences in liver or quadriceps weight were found. However, the percentages of liver and quadriceps weight to body weight were reduced by feeding the HFD (p < 0.05), and this decrease was partially reversed by the high dose of PEITC (p < 0.05, Table 2). Regarding adipose tissues, the HFD significantly increased epididymal and perinephric fat weight and relative weight (p < 0.05). With both isothiocyanates, the HFD-induced gain in adipose tissue weight was dose-dependently attenuated (p < 0.05). In line with the changes in body weight and adipose tissue weight, the HFD significantly increased the cell size of epididymal adipocytes (Figure 2A) and the steatosis of liver tissue as well as the contents of hepatic triglycerides (Figure 2B). With coadministration of BITC and PEITC, the average diameter of adipocytes and hepatic lipid contents were significantly decreased (p < 0.05). 3.2. Effect of BITC and PEITC on Blood Biochemical Parameters. As shown in Table 3, after 18 weeks, the HFD significantly increased plasma total cholesterol, total triglycerides, NEFA, and glucose as well as the HOMA-IR (p < 0.05). With isothiocyanate treatment, the HFD-induced increase in the plasma total cholesterol concentration was dose-dependently reduced (p < 0.05). A dose-dependent decrease in plasma NEFA was also noted in PEITC-treated mice. Plasma NEFA levels, however, were reduced only in mice treated with 1 g/kg BITC (p < 0.05). Regarding indices of insulin resistance, both isothiocyanates at either 0.5 g/kg or 1 g/kg significantly 7140

DOI: 10.1021/acs.jafc.9b02668 J. Agric. Food Chem. 2019, 67, 7136−7146

Article

Journal of Agricultural and Food Chemistry

Figure 4. Benzyl isothiocyanate (BITC) and phenylethyl isothiocyanate (PEITC) inhibit the expression of hepatic lipid metabolism mediators. After 18 weeks of feeding of the low-fat diet (LFD), the high-fat diet (HFD), or the HFD supplemented with 0.5 (L) or 1 g/kg (H) BITC or PEITC, liver tissues were removed and prepared for (A) mRNA and (B) protein expression assay. Values are mean ± SD, n = 5. ∗ versus LFD, p < 0.05. abcdValues without the same letter differ significantly, p < 0.05.

Figure 5. Isothiocyanates reduce cellular lipid accumulation in 3T3-L1 adipocytes. 3T3-L1 preadipocytes were cultured with differentiation medium (DM) I for the first 2 days and DMII for the next 6 days in the absence or presence of various concentrations of benzyl isothiocyanate (BITC) and phenylethyl isothiocyanate (PEITC). (A) Cells were stained with oil red O and AdipoRed, and (B) cellular lipid contents were determined. Values are mean ± SD, n = 4. ∗ versus GM, p < 0.05. abcValues without the same letter differ significantly, p < 0.05.

induced expression of SREBP1c, LXRα, SCD-1, FAS, and ACC

expression of these lipogenic mediators was also decreased in

mRNA was significantly suppressed (Figure 4A). The protein

mice dosed with 1 g/kg BITC or PEITC (Figure 4B). 7141

DOI: 10.1021/acs.jafc.9b02668 J. Agric. Food Chem. 2019, 67, 7136−7146

Article

Journal of Agricultural and Food Chemistry

Figure 6. Isothiocyanates inhibit the expression of adipogenic mediators. (A) 3T3-L1 preadipocytes were cultured with differentiation medium (DM) I and II and time-dependent changes in the expression of adipogenic transcription factors were determined. (B, C) 3T3-L1 preadipocytes were left untreated or treated with DMI and II in the absence or presence of 5 or 10 μM benzyl isothiocyanate (BITC) and phenylethyl isothiocyanate (PEITC) for 16 h (C/EBPβ), 6 days (C/EBPα, PPARγ, SREBP1c, LXRα), or 8 days (FAS and SCD-1), and changes in (B) protein and (C) mRNA were measured. Values are mean ± SD, n = 4. ∗ versus GM, p < 0.05.abcValues without the same letter differ significantly, p < 0.05.

Figure 7. Isothiocyanates inhibit mitotic clonal expansion. 3T3-L1 preadipocytes were cultured with differentiation medium (DM) I in the absence or presence of 5 or 10 μM benzyl isothiocyanate (BITC) and phenylethyl isothiocyanate (PEITC) for 16 h, and changes in the cell cycle were measured flow cytometry. Values are mean ± SD for n = 4. ∗ versus GM, p < 0.05. abcValues without the same letter differ significantly, p < 0.05.

3.4. BITC and PEITC Decreased Cellular Oil Contents in 3T3-L1 Adipocytes. We further investigated the mechanism of the antiobesogenic effect of BITC and PEITC in 3T3L1 preadipocytes. As shown by oil red O and AdipoRed staining (Figure 5A), 3T3-L1 cells appeared to have mature adipocyte morphology after 8 days of differentiation. Cellular

lipid contents were apparently increased as well (Figure 5B). In the presence of BITC or PEITC, adipocyte maturation and lipid accumulation were dose-dependently decreased (p < 0.05). 3.5. BITC and PEITC down-Regulated the Expression of Adipogenic Transcription Factors in 3T3-L1 Adipo7142

DOI: 10.1021/acs.jafc.9b02668 J. Agric. Food Chem. 2019, 67, 7136−7146

Article

Journal of Agricultural and Food Chemistry

Figure 8. Changes in plasma BITC or PEITC concentrations. Mice were orally given a single dose of 85 mg/kg BITC or PEITC. Blood samples were collected 0, 0.25, 1, 2, 4, 10 h, and plasma BITC and PEITC were determined by HPLC. Values are mean ± SD, n = 5.

cytes. In the presence of differentiation stimuli, C/EBPβ expression is induced which promotes the expression of lipogenic transcription factors. As shown in Figure 6A, the expression of C/EBPβ increased rapidly during the first 24 h in the 3T3-L1 adipocytes and then gradually declined. Following the change in C/EBPβ, the expression of C/EBPα, PPARγ, SREBP1c, and LXRα was time-dependently increased up to day 6. In the presence of 5 or 10 μM BITC or PEITC, protein levels of C/EBPβ, C/EBPα, PPARγ, SREBP1c, and LXRα as well as FAS and SCD-1 in 3T3-L1 adipocytes were inhibited in a dosedependent manner (Figure 6B). Similarly, the mRNA expression of C/EBPβ, C/EBPα, PPARγ, SREBP1c, LXRα, FAS, and SCD-1 was dose-dependently decreased (Figure 6C). 3.6. Isothiocyanates Suppressed Mitotic Clonal Expansion. Flow cytometry revealed that, after 16 h of differentiation induced by adding an IBMX/dexamethasone/ insulin cocktail, most cells entered the S phase and the proportion of cells at the G0/G1 phase decreased from 66.8 ± 5.1% to 31.5 ± 3.8% (Figure 7). In the presence of BITC and PEITC, the cell cycle was halted, and the percentage of cells arrested at the G0/G1 phase was dose-dependently increased. Compared with cells treated with the differentiation cocktail alone, the percentage of cells at G0/G1 increased from 31.5 ± 3.8% to 79.9 ± 2.9% and 85.2 ± 2.0% in cells treated with 10 μM BITC or PEITC (p < 0.05), respectively. These findings suggest that the inhibition of adipogenesis by the isothiocyanates is likely associated with halting MCE. 3.7. Pharmacokinetics of Isothiocyanates. After oral administration of 85 mg/kg BITC and PEITC, plasma BITC and PEITC were detected from the first blood sampling, that is, 15 min, and rapidly increased. The maximum concentration (Cmax) was observed at approximately 60 min. Thereafter, plasma contents of BITC and PEITC gradually decreased (Figure 8). The relevant pharmacokinetic parameters were presented in Table 4. The Cmax, area under the curve (AUC0−12 h), mean retention time (MRT), and half-life (T1/2) of BITC and PEITC were 5.8 ± 2.0 μg/mL (38.9 μM), 17.0 ± 6.8 μg/mL × h, 16.2 ± 8.2 h, 21.6 ± 11.3 h, and 4.3 ± 1.9 μg/mL (26.3 μM), 20.9 ± 12.6 μg/mL × h, 4.8 ± 1.9 h, and 7.2 ± 2.2 h.

Table 4. Pharmacokinetic Parameters of BITC and PEITC in Mice Orally Dosed with 85 mg/kg1 parameters Cmax, μg/mL Tmax, h AUC0−12 h, mg/L × h T1/2, h MRT, h

BITC 5.8 1.0 17.0 16.2 21.6

± 2.0 ± 0.0 ± 6.8 ± 8.2 ± 11.3

PEITC 4.3 1.0 20.9 4.8 7.2

± 1.9 ± 0.0 ± 12.6 ± 1.9 ± 2.2

Data are expressed as means ± SD (n = 5). AUC, area under the curve; Cmax, maximum concentration; Tmax, time to reach the maximum concentration; MRT, mean retention time; T1/2, plasma half-life of BITC or PEITC. 1

Natural products with antiadipogenic potency have attracted much attention recently and may be an alternative strategy for developing effective and safe antiobesity drugs.5 Isothiocyanates are one such target phytochemical.13 In this study, we demonstrate that BITC and PEITC are potent for ameliorating HFD-induced obesity and hepatic steatosis. Moreover, our study of 3T3-L1 adipocytes shows that the antiobesity effect of BITC and PEITC is partly attributed to their inhibition of the expression of C/EBPβ during the early stage of adipogenesis, which leads to arresting the cell cycle at the MCE and attenuating the C/EBPβ-driven transcription of downstream lipogenic transcription factors. In preadipocyte cell lines such as 3T3-L1 and 3T3-F442A cells, adipogenesis requires the cooperation of several transcription factors to promote the expression of lipogenic proteins as well as insulin receptors and glucose transporter 4, which leads to preadipocyte differentiation into lipid-laden and insulin-responsive adipocytes.22 Knocking out or silencing C/ EBPβ, PPARγ, LXRα, and SREBP1c damages adipocyte differentiation, which supports the critical role of these transcription factors in the development of adipose tissue.23−26 Therefore, natural products that inhibit the coordinated cascade, of which these lipogenic transcription factors are a part, can function as antiobesity agents. For example, quercetin and allyl isothiocyanate, analogues of BITC and PEITC, ameliorate HFD-induced obesity by suppressing the activation of CREB and the expression of C/EBPα, C/EBPβ, and PPARγ, thus inhibiting adipocyte differentiation.27,28 Andrographolide, a diterpenoid rich in Andrographis paniculata (Burm.f.) Nees., and berberine, an alkaloid in various traditional herbs such as Coptis chinensis and Berberis vulgaris, inhibit the differentiation of 3T3-L1 preadipocytes by inhibiting the CREB-C/EBPβPPARγ pathway.20,29 In this study, results clearly indicated that

4. DISCUSSION Energy imbalance caused by overconsumption and too little physical exercise leads to obesity and increases the risk of numerous metabolic disorders.4 Weight management is therefore one of the top challenges for public health worldwide. 7143

DOI: 10.1021/acs.jafc.9b02668 J. Agric. Food Chem. 2019, 67, 7136−7146

Article

Journal of Agricultural and Food Chemistry BITC and PEITC was first to suppress the expression of C/ EBPβ and then inhibited the expression of C/EBPα, PPARγ, SREBP1c, and LXRα as well as FAS and SCD-1 (Figure 6B,C). Consequently, the content of cellular lipids was inhibited (Figure 5A,B). According to the important role of CREB in promoting C/EBPβ gene transcription, a decrease in C/EBPβ expression indicates that protein kinase A-CREB signaling is likely to be inhibited by BITC and PEITC and abolishment of C/EBPβ-driven adipocyte differentiation results. In addition to inhibiting lipogenesis, enhanced lipolysis in adipocytes by BITC is recently reported.30 Twelve to sixteen hours after the initiation of adipocyte differentiation, G1-phase growth-arrested 3T3-L1 preadipocytes re-enter the cell cycle and undergo MCE.22 This is a necessary step for adipocyte differentiation, and inhibition of DNA replication or overexpression of cell cycle inhibitor p27 blocks adipocyte formation.22 In addition to acting as a key transcription factor in up-regulating the expression of C/EBPα and PPARγ important for terminal adipocyte differentiation, C/ EBPβ has also been reported to be a key regulator in the progression of MCE by promoting the expression of numerous cell cycle proteins including Cdc45l, Mcm3, Gins1, and Cdc25c.31,32 Knockout or knockdown of C/EBPβ, therefore, blocks the onset of MCE of 3T3-L1 cells.33 Recently, the antiadipogenic effects of the natural products carnosic acid and apigenein on inhibiting MCE were reported to be C/EBPβdependent.34,35 Although changes in the expression of cell cycle regulatory proteins were not determined in this study, C/EBPβ expression was suppressed by BITC and PEITC, and progression of the cell cycle at the stage of MCE was halted by the two isothiocyanates (Figure 7). This suggested that, in addition to acting on mediating lipid formation in differentiated adipocytes (hypertrophy), a decrease in C/EBPβ expression at the early stage of adipogenesis by BITC and PEITC might also be important in inhibiting adipocyte formation (hyperplasia). In the in vivo model, HFD-induced mRNA and protein expression of C/EBPα, PPARγ, SREBP1c, and SCD-1 as well as the mRNA expression of FAS and ACC was attenuated in mice administered BITC and PEITC (Figure 3A,B). Increases in body weight (Figure 1), epididymal and perinephric adipose tissue weight (Table 2), and adipocyte size (Figure 2A) induced by HFD feeding were inhibited by BITC and PEITC as well. Moreover, the plasma contents of NEFA and glucose and HOMA-IR were decreased (Table 3). Taken together, the results noted in 3T3-L1 cells and in HFD-induced obese mice clearly indicate that BITC and PEITC are potent for preventing obesity, and the antiobesity activity of two isothiocyanates is similar. This antiobesity activity of BITC and PEITC, therefore, ameliorates HFD-induced hyperglycemia and insulin resistance as noted in this study and by others.19 Impairment in Nrf2dependent antioxidant defense leads to insulin resistance in mice fed the HFD.36 Isothiocyanates are potent Nrf2 inducers, and PEITC protection against oxidant-induced insulin resistance in adipocytes has been shown to be Nrf2-dependent.37 This raises a possibility that Nrf2-driven cellular defense is likely to be one of the key factors in BITC and PEITC protection against HFD-induced hyperglycemia and insulin resistance. To unveil this possibility, further study is warranted. Obesity is one of the major risk factors of NAFLD.3 This explains that antiobestogenic natural products exhibit antihepatosteatosis activity as well. For example, after 12 weeks of feeding, ginger essential oil and its major active component citral ameliorate hepatic lipid accumulation and steatohepatitis

in HFD-induced obese mice by suppressing de novo lipid synthesis and enhancing antioxidant defense.38 Genistein decreases the severity of HFD-induced fatty liver by enhancing fatty acid oxidation and uncoupling protein expression.39 In this study, similar to the changes noted in adipose tissue, BITC and PEITC were also found to be effective for down-regulating hepatic SREBP1c, LXRα, SCD-1, FAS, and ACC mRNA and protein expression (Figure 4A,B). This explains, at least in part, why fatty liver was ameliorated (Figure 2B). LXRα plays a key role not only in fatty acid and triglyceride biosynthesis but also in cholesterol homeostasis and inflammation.8 Study of the structure−function relationship of natural products attracts a lot of attention. In the case of flavonoids, evidence indicates that the number and position of hydroxyl groups in the B ring are important determinants to inhibit inflammation and carcinogenesis.40,41 Different side chains of BITC and PEITC (benzyl vs phenethyl group) may alter the electrophilicity of the −NCS group and the lipophilicity of the molecule,42 which result in the different biological activities. The antimicrobial activity of BITC is reported to be better than that of PEITC.43 In addition, differential anticancer activity of BITC and PEITC has been reported.44 In this study, however, protections of BITC and PEITC against HFD-induced obesity and hepatosteatosis as well as inhibition of adipocyte formation were similar. In this study, it was interesting to note that changes as a result of the HFD differed between the protein expression of FAS and ACC and the mRNA levels. After 18 weeks of feeding, the expression of FAS and ACC mRNA in adipose and liver tissues was higher in mice fed the HFD than in those fed the LFD (Figures 3A and 4A); FAS and ACC protein levels, however, were lower (Figures 3B and 4B). This discrepancy in protein and mRNA expression suggests that a translation or posttranslation-mediated mechanism may be at work. ACC is responsible for carboxylating acetyl CoA and produces malonyl CoA. Then FAS uses malonyl CoA for fatty acid biosynthesis. Although the HFD increases obesity and hepatic steatosis, a negative feedback mechanism in mediating the mRNA and protein expression of several lipogenic enzymes, including FAS and ATP-citrate lyase, is reported in the adipose and liver tissues of HFD-fed mice.45−47 Moreover, this feedback inhibition is time-dependent. The expression of FAS is upregulated early in HFD feeding but is then down-regulated after 11 days on the diet.45 Proteomics and genomics approaches also reveal that such regulation occurs not only in lipogenic enzymes but also in those that participate in cholesterol synthesis and lipid transportation.47,48 Most of natural products in vegetables and fruits possess low absorption and rapid metabolism and excretion characteristics and, thus, pharmacokinetic studies are required to explore the absorption, distribution, metabolism, and excretion of any interesting compounds. In this study, the early detection and quick decrease of BITC and PEITC in the blood after oral dosing (Figure 8) indicate that the two isothiocyanates are quickly absorbed by enterocytes, entrance into the blood circulation, and distributed to the liver and peripheral tissues, where they are metabolized and excreted. Although no differences were noted in Cmax and Tmax, the higher T1/2 and MRT of BITC than those of PEITC (Table 4) suggest that difference in the side chain of the two isothiocyanates results in differences in the metabolism and excretion rate to some extent. Similar to our findings, a recent study reported that the Cmax and Tmax are 42.1 ± 11.4 μM and 2.0 ± 1 h after oral 7144

DOI: 10.1021/acs.jafc.9b02668 J. Agric. Food Chem. 2019, 67, 7136−7146

Article

Journal of Agricultural and Food Chemistry administration of 16.3 mg/kg PEITC in rats.49 It is interesting to know whether the efficacy obtained in in vitro is applicable to prevention and therapy in vivo. Giving an oral dosage equivalent to that of mice fed a diet supplemented with 0.1% BITC or PEITC, the Cmax of BITC (38.9 μM) and PEITC (26.3 μM) are close to or higher than the effective concentration used in 3T3L1 cells and other studies,16,17,37 indicating that the effective concentrations used in in vitro are likely physiologically achievable. It needs to be addressed that the amounts of BITC and PEITC in blood detected in this study include not only the parent isothiocyanates but also their metabolites because they are converted into 1,3-benzodithiole-2-thione before being detected. In conclusion, BITC and PEITC inhibit HFD-induced obesity and hepatic steatosis by suppressing the expression of PPARγ, SREBP1c, and LXRα and that of their downstream lipogenic enzymes. The activity of BITC and PEITC is partly attributed to their inhibition of C/EBPβ expression and their blocking of the onset of MCE in the early phase of adipocyte differentiation. BITC and PEITC may therefore have potential as chemotherapeutic agents for the treatment of obesity and obesity-related metabolic dysfunction.

■

Meta-analytic assessment of prevalence, incidence, and outcomes. Hepatology 2016, 64, 73−84. (4) Heymsfield, S. B.; Wadden, T. A. Mechanisms, Pathophysiology, and Management of Obesity. N. Engl. J. Med. 2017, 376, 1492. (5) Mopuri, R.; Islam, M. S. Medicinal plants and phytochemicals with anti-obesogenic potentials: A review. Biomed. Pharmacother. 2017, 89, 1442−1452. (6) Mueller, E. Understanding the variegation of fat: novel regulators of adipocyte differentiation and fat tissue biology. Biochim. Biophys. Acta, Mol. Basis Dis. 2014, 1842, 352−7. (7) Le Lay, S.; Lefrere, I.; Trautwein, C.; Dugail, I.; Krief, S. Insulin and sterol-regulatory element-binding protein-1c (SREBP-1C) regulation of gene expression in 3T3-L1 adipocytes. Identification of CCAAT/enhancer-binding protein beta as an SREBP-1C target. J. Biol. Chem. 2002, 277, 35625−34. (8) Steffensen, K. R.; Gustafsson, J. A. Putative metabolic effects of the liver X receptor (LXR). Diabetes 2004, 53 (Suppl 1), S36−42. (9) Kohjima, M.; Higuchi, N.; Kato, M.; Kotoh, K.; Yoshimoto, T.; Fujino, T.; Yada, M.; Yada, R.; Harada, N.; Enjoji, M.; Takayanagi, R.; Nakamuta, M. SREBP-1c, regulated by the insulin and AMPK signaling pathways, plays a role in nonalcoholic fatty liver disease. Int. J. Mol. Med. 2008, 21, 507−11. (10) Luang-In, V.; Albaser, A. A.; Nueno-Palop, C.; Bennett, M. H.; Narbad, A.; Rossiter, J. T. Glucosinolate and Desulfo-glucosinolate Metabolism by a Selection of Human Gut Bacteria. Curr. Microbiol. 2016, 73, 442−51. (11) Wilson, E. A.; Ennahar, S.; Marchioni, E.; Bergaentzle, M.; Bindler, F. Improvement in determination of isothiocyanates using high-temperature reversed-phase HPLC. J. Sep Sci. 2012, 35, 2026−31. (12) Nakamura, Y.; Yoshimoto, M.; Murata, Y.; Shimoishi, Y.; Asai, Y.; Park, E. Y.; Sato, K.; Nakamura, Y. Papaya seed represents a rich source of biologically active isothiocyanate. J. Agric. Food Chem. 2007, 55, 4407−13. (13) Fofaria, N. M.; Ranjan, A.; Kim, S. H.; Srivastava, S. K. Mechanisms of the Anticancer Effects of Isothiocyanates. Enzymes 2015, 37, 111−37. (14) Morse, M. A.; Reinhardt, J. C.; Amin, S. G.; Hecht, S. S.; Stoner, G. D.; Chung, F. L. Effect of dietary aromatic isothiocyanates fed subsequent to the administration of 4-(methylnitrosamino)-1-(3pyridyl)-1-butanone on lung tumorigenicity in mice. Cancer Lett. 1990, 49, 225−30. (15) Stoner, G. D.; Morrissey, D. T.; Heur, Y. H.; Daniel, E. M.; Galati, A. J.; Wagner, S. A. Inhibitory effects of phenethyl isothiocyanate on N-nitrosobenzylmethylamine carcinogenesis in the rat esophagus. Cancer Res. 1991, 51, 2063−8. (16) Lee, Y. M.; Seon, M. R.; Cho, H. J.; Kim, J. S.; Park, J. H. Benzyl isothiocyanate exhibits anti-inflammatory effects in murine macrophages and in mouse skin. J. Mol. Med. (Heidelberg, Ger.) 2009, 87, 1251−61. (17) Huang, C. S.; Lin, A. H.; Liu, C. T.; Tsai, C. W.; Chang, I. S.; Chen, H. W.; Lii, C. K. Isothiocyanates protect against oxidized LDLinduced endothelial dysfunction by upregulating Nrf2-dependent antioxidation and suppressing NFkappaB activation. Mol. Nutr. Food Res. 2013, 57, 1918−30. (18) Ferrer-Lorente, R.; Bejar, M. T.; Badimon, L. Notch signaling pathway activation in normal and hyperglycemic rats differs in the stem cells of visceral and subcutaneous adipose tissue. Stem Cells Dev. 2014, 23, 3034−48. (19) Alsanea, S.; Liu, D. BITC and S-Carvone Restrain High-Fat Diet-Induced Obesity and Ameliorate Hepatic Steatosis and Insulin Resistance. Pharm. Res. 2017, 34, 2241−2249. (20) Chen, C. C.; Chuang, W. T.; Lin, A. H.; Tsai, C. W.; Huang, C. S.; Chen, Y. T.; Chen, H. W.; Lii, C. K. Andrographolide inhibits adipogenesis of 3T3-L1 cells by suppressing C/EBPbeta expression and activation. Toxicol. Appl. Pharmacol. 2016, 307, 115−122. (21) Ye, L.; Dinkova-Kostova, A. T.; Wade, K. L.; Zhang, Y.; Shapiro, T. A.; Talalay, P. Quantitative determination of dithiocarbamates in human plasma, serum, erythrocytes and urine: pharmacokinetics of

AUTHOR INFORMATION

Corresponding Authors

*E-mail: [email protected]. Phone: +886 4 22053366x7519. *E-mail: [email protected]. ORCID

Chong-Kuei Lii: 0000-0002-0501-7587 Funding

This work was supported in part by the Taiwan Ministry of Science and Technology Grant Nos. MOST 104-2320-B-039− 029-MY3 and MOST 106-2320-B-039−039-MY3 and by China Medical University Grant Nos. CMU103-ASIA-04 and CMU107-S-11. Notes

The authors declare no competing financial interest.

■

ABBREVIATIONS USED ACC,acetyl-CoA carboxylase; BITC,benzyl isothiocyanate; C/ EBP,CCAAT-enhancer-binding proteins; CREB,cAMP response element-binding protein; FAS,fatty acid synthase; GPT,glutamate-pyruvate transaminase; GSK,glycogen synthase kinase; HFD,high-fat diet; HOMA-IR,homeostatic model assessment-insulin resistance; IBMX,3-isobutylmethoxylxanthine; LXR,liver X receptor; MAPK,mitogen-activated protein kinase; MCE,mitotic clonal expansion; NAFLD,nonalcoholic fatty liver disease; NEFA,nonesterified fatty acids; PEITC,phenethyl isothiocyanate; PPAR,peroxisome proliferator-activated receptor; SCD,stearoyl-CoA desaturase; SREBP,sterol regulatory element-binding protein.

■

REFERENCES

(1) Xu, H.; Barnes, G. T.; Yang, Q.; Tan, G.; Yang, D.; Chou, C. J.; Sole, J.; Nichols, A.; Ross, J. S.; Tartaglia, L. A.; Chen, H. Chronic inflammation in fat plays a crucial role in the development of obesityrelated insulin resistance. J. Clin. Invest. 2003, 112, 1821−30. (2) World Health Organization. Obesity and overweight; WHO, 2018. http://www.who.int/mediacentre/factsheets/fs311/en/ (accessed February 16, 2018). (3) Younossi, Z. M.; Koenig, A. B.; Abdelatif, D.; Fazel, Y.; Henry, L.; Wymer, M. Global epidemiology of nonalcoholic fatty liver disease7145

DOI: 10.1021/acs.jafc.9b02668 J. Agric. Food Chem. 2019, 67, 7136−7146

Article

Journal of Agricultural and Food Chemistry broccoli sprout isothiocyanates in humans. Clin. Chim. Acta 2002, 316, 43−53. (22) Tang, Q. Q.; Lane, M. D. Adipogenesis: from stem cell to adipocyte. Annu. Rev. Biochem. 2012, 81, 715−36. (23) Tanaka, T.; Yoshida, N.; Kishimoto, T.; Akira, S. Defective adipocyte differentiation in mice lacking the C/EBPbeta and/or C/ EBPdelta gene. EMBO J. 1997, 16, 7432−43. (24) Rosen, E. D.; Sarraf, P.; Troy, A. E.; Bradwin, G.; Moore, K.; Milstone, D. S.; Spiegelman, B. M.; Mortensen, R. M. PPAR gamma is required for the differentiation of adipose tissue in vivo and in vitro. Mol. Cell 1999, 4, 611−7. (25) Seo, J. B.; Moon, H. M.; Kim, W. S.; Lee, Y. S.; Jeong, H. W.; Yoo, E. J.; Ham, J.; Kang, H.; Park, M. G.; Steffensen, K. R.; Stulnig, T. M.; Gustafsson, J. A.; Park, S. D.; Kim, J. B. Activated liver X receptors stimulate adipocyte differentiation through induction of peroxisome proliferator-activated receptor gamma expression. Mol. Cell. Biol. 2004, 24, 3430−44. (26) Kim, J. B.; Spiegelman, B. M. ADD1/SREBP1 promotes adipocyte differentiation and gene expression linked to fatty acid metabolism. Genes Dev. 1996, 10, 1096−107. (27) Lo, C. W.; Chen, C. S.; Chen, Y. C.; Hsu, Y. A.; Huang, C. C.; Chang, C. Y.; Lin, C. J.; Lin, C. W.; Lin, H. J.; Liu, F. T.; Wan, L. Allyl Isothiocyanate Ameliorates Obesity by Inhibiting Galectin-12. Mol. Nutr. Food Res. 2018, 62, e1700616. (28) Moon, J.; Do, H. J.; Kim, O. Y.; Shin, M. J. Antiobesity effects of quercetin-rich onion peel extract on the differentiation of 3T3-L1 preadipocytes and the adipogenesis in high fat-fed rats. Food Chem. Toxicol. 2013, 58, 347−54. (29) Zhang, J.; Tang, H.; Deng, R.; Wang, N.; Zhang, Y.; Wang, Y.; Liu, Y.; Li, F.; Wang, X.; Zhou, L. Berberine Suppresses Adipocyte Differentiation via Decreasing CREB Transcriptional Activity. PLoS One 2015, 10, e0125667. (30) Okulicz, M.; Hertig, I. Benzyl isothiocyanate disturbs lipid metabolism in rats in a way independent of its thyroid impact following in vivo long-term treatment and in vitro adipocytes studies. J. Physiol. Biochem. 2013, 69, 75−84. (31) Guo, L.; Li, X.; Tang, Q. Q. Transcriptional regulation of adipocyte differentiation: a central role for CCAAT/enhancer-binding protein (C/EBP) beta. J. Biol. Chem. 2015, 290, 755−61. (32) Guo, L.; Li, X.; Huang, J. X.; Huang, H. Y.; Zhang, Y. Y.; Qian, S. W.; Zhu, H.; Zhang, Y. D.; Liu, Y.; Liu, Y.; Wang, K. K.; Tang, Q. Q. Histone demethylase Kdm4b functions as a co-factor of C/EBPbeta to promote mitotic clonal expansion during differentiation of 3T3-L1 preadipocytes. Cell Death Differ. 2012, 19, 1917−27. (33) Zhang, Y. Y.; Li, X.; Qian, S. W.; Guo, L.; Huang, H. Y.; He, Q.; Liu, Y.; Ma, C. G.; Tang, Q. Q. Transcriptional activation of histone H4 by C/EBPbeta during the mitotic clonal expansion of 3T3-L1 adipocyte differentiation. Mol. Biol. Cell 2011, 22, 2165−74. (34) Gaya, M.; Repetto, V.; Toneatto, J.; Anesini, C.; Piwien-Pilipuk, G.; Moreno, S. Antiadipogenic effect of carnosic acid, a natural compound present in Rosmarinus officinalis, is exerted through the C/ EBPs and PPARgamma pathways at the onset of the differentiation program. Biochim. Biophys. Acta, Gen. Subj. 2013, 1830, 3796−806. (35) Kim, M. A.; Kang, K.; Lee, H. J.; Kim, M.; Kim, C. Y.; Nho, C. W. Apigenin isolated from Daphne genkwa Siebold et Zucc. inhibits 3T3-L1 preadipocyte differentiation through a modulation of mitotic clonal expansion. Life Sci. 2014, 101, 64−72. (36) Liu, Z.; Dou, W.; Ni, Z.; Wen, Q.; Zhang, R.; Qin, M.; Wang, X.; Tang, H.; Cao, Y.; Wang, J.; Zhao, S. Deletion of Nrf2 leads to hepatic insulin resistance via the activation of NF-kappaB in mice fed a high-fat diet. Mol. Med. Rep. 2016, 14, 1323−31. (37) Nagami, M.; Ito, Y.; Nagasawa, T. Phenethyl isothiocyanate protects against H2O2-induced insulin resistance in 3T3-L1 adipocytes. Biosci., Biotechnol., Biochem. 2017, 81, 2195−2203. (38) Lai, Y. S.; Lee, W. C.; Lin, Y. E.; Ho, C. T.; Lu, K. H.; Lin, S. H.; Panyod, S.; Chu, Y. L.; Sheen, L. Y. Ginger Essential Oil Ameliorates Hepatic Injury and Lipid Accumulation in High Fat Diet-Induced Nonalcoholic Fatty Liver Disease. J. Agric. Food Chem. 2016, 64, 2062−71.

(39) Lee, Y. M.; Choi, J. S.; Kim, M. H.; Jung, M. H.; Lee, Y. S.; Song, J. Effects of dietary genistein on hepatic lipid metabolism and mitochondrial function in mice fed high-fat diets. Nutrition 2006, 22, 956−64. (40) Chen, D.; Chen, M. S.; Cui, Q. C.; Yang, H.; Dou, Q. P. Structure-proteasome-inhibitory activity relationships of dietary flavonoids in human cancer cells. Front. Biosci., Landmark Ed. 2007, 12, 1935−45. (41) Lotito, S. B.; Frei, B. Dietary flavonoids attenuate tumor necrosis factor alpha-induced adhesion molecule expression in human aortic endothelial cells. Structure-function relationships and activity after first pass metabolism. J. Biol. Chem. 2006, 281, 37102−10. (42) Nakamura, T.; Abe-Kanoh, N.; Nakamura, Y. Physiological relevance of covalent protein modification by dietary isothiocyanates. J. Clin. Biochem. Nutr. 2018, 62, 11−19. (43) Ko, M. O.; Kim, M. B.; Lim, S. B. Relationship between Chemical Structure and Antimicrobial Activities of Isothiocyanates from Cruciferous Vegetables against Oral Pathogens. J. Microbiol. Biotechnol. 2016, 26, 2036−2042. (44) Wang, X.; Di Pasqua, A. J.; Govind, S.; McCracken, E.; Hong, C.; Mi, L.; Mao, Y.; Wu, J. Y.; Tomita, Y.; Woodrick, J. C.; Fine, R. L.; Chung, F. L. Selective depletion of mutant p53 by cancer chemopreventive isothiocyanates and their structure-activity relationships. J. Med. Chem. 2011, 54, 809−16. (45) Gregoire, F. M.; Zhang, Q.; Smith, S. J.; Tong, C.; Ross, D.; Lopez, H.; West, D. B. Diet-induced obesity and hepatic gene expression alterations in C57BL/6J and ICAM-1-deficient mice. Am. J. Physiol Endocrinol Metab 2002, 282, E703−13. (46) Jiang, L.; Wang, Q.; Yu, Y.; Zhao, F.; Huang, P.; Zeng, R.; Qi, R. Z.; Li, W.; Liu, Y. Leptin contributes to the adaptive responses of mice to high-fat diet intake through suppressing the lipogenic pathway. PLoS One 2009, 4, e6884. (47) Kim, S.; Sohn, I.; Ahn, J. I.; Lee, K. H.; Lee, Y. S.; Lee, Y. S. Hepatic gene expression profiles in a long-term high-fat diet-induced obesity mouse model. Gene 2004, 340, 99−109. (48) Moraes, R. C.; Blondet, A.; Birkenkamp-Demtroeder, K.; Tirard, J.; Orntoft, T. F.; Gertler, A.; Durand, P.; Naville, D.; Begeot, M. Study of the alteration of gene expression in adipose tissue of diet-induced obese mice by microarray and reverse transcription-polymerase chain reaction analyses. Endocrinology 2003, 144, 4773−82. (49) Ji, Y.; Kuo, Y.; Morris, M. E. Pharmacokinetics of dietary phenethyl isothiocyanate in rats. Pharm. Res. 2005, 22, 1658−66.

7146

DOI: 10.1021/acs.jafc.9b02668 J. Agric. Food Chem. 2019, 67, 7136−7146