Bifunctional Phosphoramidite Reagents for the Introduction of Histidyl

The synthesis and characterization of reagents for the incorporation of histidyl residues into oligonucleotides by automated chemical synthesis is des...
0 downloads 0 Views 69KB Size
Download PDF
Bioconjugate Chem. 1999, 10, 647−652

647

Bifunctional Phosphoramidite Reagents for the Introduction of Histidyl and Dihistidyl Residues into Oligonucleotides Thomas H. Smith,* John V. LaTour, Dmitry Bochkariov, Grigoriy Chaga, and Paul S. Nelson Nucleic Acids Chemistry Division, CLONTECH Laboratories, Inc., 1020 East Meadow Circle, Palo Alto, California 94303 . Received January 11, 1999; Revised Manuscript Received March 16, 1999

The synthesis and characterization of reagents for the incorporation of histidyl residues into oligonucleotides by automated chemical synthesis is described. Automated oligonucleotide synthesis utilizing a bifunctional reagent for the incorporation of a dihistidyl residue into oligonucleotides is described. Oligonucleotides incorporating one to three dihistidyl residues were prepared and characterized. The interaction of these oligonucleotides with a metal chelating IMAC matrix was explored.

INTRODUCTION

Oligonucleotides containing imidazole residues are of potential biological interest for a number of reasons. The metal complexing property of imidazole rings offers a potential handle for the purification of imidazole-tagged oligonucleotides and nucleic acids. Histidine- or imidazole-containing oligonucleotides can act as artificial nucleases due to the ability of imidazole rings to complex metal ions and cleave nucleic acid chains (1, 2). IMAC (immobilized metal affinity chromatography) is a widely used technique for the purification of recombinant proteins tagged with metal-coordinating peptide sequences (3, 4) such as hexahistidine (5). Due to the binding strength and reversible nature of the imidazoletransition metal ion coordination, IMAC also has potential as a useful technique for nucleic acid applications. In 1995, Orum et al. reported the use of oligohistidinePNA chimeras to purify cDNAs via an IMAC process (6). In 1996, Min and Verdine (7) reported the use of IMAC in a DNA application. In their work, the metal-coordinating peptide sequence was replaced by a tag composed of six consecutive 6-histaminylpurine nucleotide residues Figure 1 (1). This tag was constructed via automated incorporation into the oligonucleotide of O6-phenyl-2′deoxyinosine residues via phosphoramidite chemistry followed by postsynthesis reaction of the resulting oligonucleotide with aqueous histamine. This tag was shown to allow selective retention of a DNA strand to a Ni2+NTA (nitrilotriacetic acid)-agarose chromatography matrix (8). The nature of the complex between the immobilized metal ion chromatography matrix and the polyhistine tag has never been fully understood. However, it has been shown that consecutive histidine residues are favored for optimal binding (8). With this in mind, we felt that the Min and Verdine structure 1, with a 24-atom spacer between the imidazole rings versus the 6-atom distance between the imidazoles in a dihistidine peptide fragment 2, may not be the optimal arrangement. We also wanted to introduce the metal-coordinating fragment in a single automated step on the DNA synthesizer without any * To whom correspondence should be addressed. Phone: (650) 424-8222 ext. 4452. Fax: (650) 858-1239. E-mail: toms@ clontech.com.

Figure 1. Structural comparison of IMAC active hexaimidazole fragment designed by Min and Verdine 1 with hexahistidine 2.

postsynthetic manipulations. Our goal therefore became the design, synthesis, and evaluation of a reagent which meets these criteria. Herein we report the results of this study. EXPERIMENTAL PROCEDURES

General Methods. 2-Cyanoethoxy-N,N,N′,N′-tetraisopropylphosphoramidite was obtained from Dalton Laboratories (Toronto, Ontario). Tetrazole and diisopropylethylamine (DIPEA) were obtained from Chem-Impex (Wood Dale, IL). NR-Fmoc-Nim-Boc-L-histidine cyclohexylamine (CHA) salt was obtained from Nova Biochem (LaJolla, CA). All other reagents were obtained from Aldrich Chemical Co. (Milwaukee, WI). All reactions were carried out under an Ar atmosphere. Solvent extracts of aqueous solutions were dried over anhydrous Na2SO4. Solutions were concentrated under reduced pressure using a rotary evaporator. Thin-layer chromatography (TLC) was done on Analtech Silica Gel GF (0.25 mm) plates. Chromatograms were visualized with either UV light or sulfuric acid. All compounds reported were homogeneous by TLC. HPLC analyses were performed on a Rainin (Emeryville, CA) Rabbit HPX system using either C18 Microsorb (4.6 × 150 mm, 5 µm) reversedphase or Pharmacia (Piscataway, NJ) Mono Q HR 5/5 ion-exchange columns. UV measurements were obtained with a Perkin-Elmer Lambda 2 spectrophotometer

10.1021/bc990002c CCC: $18.00 © 1999 American Chemical Society Published on Web 05/14/1999

648 Bioconjugate Chem., Vol. 10, No. 4, 1999

equipped with a Peltier temperature controller and a six cell transport device. NMR spectra were obtained by Acorn NMR (Fremont, CA) at 360 MHz in CDCl3. Mass spectra were obtained on a MALDI time-of-flight mass spectrometer from Ciphergen Biosystems, Inc. (Palo Alto, CA). Elemental analyses were obtained from the Microanalytical Laboratory of the Department of Chemistry, University of California, Berkeley. N-(N r -Fmoc-N im -t-Boc- L -histidyl)-6-amino-2hydroxymethyl-1-hexanol Dimethoxytrityl Ether (7). NR-Fmoc-Nim-Boc-L-histidine CHA salt (35.0 g, 60.7 mmol) was placed in a separatory funnel containing EtOAc (800 mL) and 5% citric acid (800 mL) and shaken until the salt had fully dissolved. The organic layer was separated and the aqueous layer extracted with EtOAc (200 mL). The organic layers were combined, washed with water (200 mL) and brine (200 mL), dried, and evaporated to provide the free acid 5. Separately, 3 (34.0 g, 50.6 mmol) was dissolved in 20% (v/v) piperidine in toluene (600 mL) and stirred at 22 °C for 2 h. The reaction mixture was evaporated, azeotroped with toluene (100 mL), redissolved in EtOAc (300 mL), washed with brine (2 × 100 mL), dried, evaporated, and azeotroped with toluene (100 mL) to afford the crude amine 4. The residue was dissolved in DMF (80 mL) containing DIPEA (15 mL). The amino acid 5 from above was also dissolved in DMF (80 mL) containing DIPEA (16.7 mL) and combined with the solution of 4. 1-Hydroxybenzotriazole (HOBT) (8.20 g, 60.7 mmol) was added followed by benzotriazol-1-yloxytripyrrolidinophosphonium hexafluorophosphate (PyBOP) (31.6 g, 60.7 mmol). The solution was stirred for 0.5 h at 22 °C, diluted with EtOAc (800 mL), washed with 10% Na2CO3 (2 × 800 mL), water (800 mL), and brine (800 mL), dried, evaporated, and azeotroped with toluene (100 mL). The residue was flash chromatographed on silica gel (1100 g) and eluted with 99:1 to 98:2 DCM/MeOH to afford 32.5 g (71%) of 7 as a diastereomeric mixture. 1H NMR (CDCl3): δ 8.02 (singlets, 1H), 7.76 (doublets, 2H), 7.59 (d, 2H), 7.35-7.45 (m, 4H), 7.13-7.34 (m, 10H), 6.83 (m, 4H, DMT), 6.77 (singlets, 1H), 6.45 (br, 1H), 4.32-4.50 (m, 3H), 4.09 (t, 1H), 3.78 (singlets, 6H), 3.74 (dd, 1H), 3.62 (m, 2H), 2.903.30 (m, 6H), 1.75 (br, 1H), 1.60 (singlets, 9H, Boc), 1.131.50 (m, 6H). N-(Nr-Fmoc-Nim-t-Boc-L-histidyl)-6-amino-2-(ODMT-hydroxymethyl)-1-hexanol (2-Cyanoethoxy)N,N-diisopropylphosphoramidite (12). 7 (1.00 g, 1.1 mmol) was dissolved in dichloromethane (11 mL). Tetrazole (93 mg, 1.33 mmol) was added and the mixture stirred at 22 °C for 15 min. 2-Cyanoethoxy-N,N,N′,N′tetraisopropylphosphoramidite (398 mg, 1.32 mmol) was added and the mixture stirred an additional 10 min at 22 °C. The mixture was filtered and the precipitate washed with EtOAc (10 mL). The combined filtrate and washing were diluted to 50 mL with EtOAc, washed with 10% Na2CO3 (2 × 15 mL) and brine (15 mL), dried, evaporated, and azeotroped with toluene. The residue was flash chromatographed on silica gel (40 g) and eluted with 70:30:3 to 50:50:3 hexane/EtOAc/TEA to afford 945 mg (78%) of 12 as a diastereomeric mixture. 1H NMR (CDCl3): δ 8.01 (s, 1H, His), 7.77 (d, 2H, Fmoc), 7.59 (d, 2H), 7.40 (m, 5H), 7.23-7.33 (m, 7H), 7.19 (m, 3H), 6.81 (dt, 4H, DMT), 6.42 (br, 1H, NH), 4.40 (m, 3H, His, Fmoc), 4.22 (t, 1H, Fmoc), 3.70 (s, 6H, DMT), 3.71 (m, 3H), 3.48-3.67 (m, 3H), 3.05-3.20 (m, 5H), 2.95 (dd, 1H), 2.53 (q, 2H, CH2CN), 1.81 (septet, 1H), 1.57 (s, 9H, t-BOC), 1.30-1.42 (m, 4H), 1.60 (d, 8H), 1.11 (d, 6H). 31P NMR (CDCl3): δ 148.2 (singlets). Anal. Calcd for

Smith et al.

C63H77N6O10P: C, 68.21; H, 7.00; N, 7.58. Found: C, 68.33; H, 6.96; N, 7.80. N-(Nr-Fmoc-Nim-t-Boc-L,L-dihistidyl)-6-amino-2hydroxymethyl-1-hexanol Dimethoxytrityl Ether (9). 7 (1.37, 1.5 mmol) was dissolved in 20% (v/v) piperidine in toluene (15 mL) and stirred at 22 °C for 10 min. The reaction mixture was evaporated, azeotroped with toluene (15 mL), dissolved in EtOAc (100 mL), washed with brine (2 × 15 mL), dried, evaporated, and azeotroped with toluene (15 mL) to afford the crude amine 8. NR-Fmoc-Nim-Boc-L-histidine CHA salt (1.13 g, 2.25 mmol) was placed in a separatory funnel containing EtOAc (25 mL) and 5% citric acid (25 mL) and shaken until the salt had fully dissolved. The organic layer was separated, washed with water (25 mL) and brine (25 mL), dried, and evaporated to afford the free acid 5. This was dissolved in DMF (6.9 mL). DIPEA (1.0 mL) was added, and this solution was added to the residue of the crude free amine 8. When everything had been dissolved, PyBOP (1.02, 2.25 mmol) was added, and the solution was stirred at 22 °C for 30 min. The reaction mixture was diluted with EtOAc (50 mL), washed with 10% Na2CO3 (2 × 50 mL), water (50 mL), and brine (50 mL), dried and evaporated. The residue was flash chromatographed on silica gel (60 g) and eluted with 99:1 to 97.5:2.5 dichloromethane/MeOH to afford 1.35 g (78%) of 9 as a diastereomeric mixture. 1H NMR (CDCl3): 8.53 (br, 0.5H, NH), 8.40 (br, 0.5H), 7.98 (singlets, 1H), 7.76 (m, 3H), 7.59 (m, 3H), 7.13-7.44 (m, 14H), 6.82 (m, 4H), 6.75 (d, 1H), 6.58 (m, 1H), 4.71 (m, 1H, His), 4.26-4.44 (m, 3H), 4.22 (q, 1H, Fmoc), 3.78 (singlets, 6H, DMT), 3.70 (dt, 1H), 3.52-3.64 (m, 2H), 2.97-3.30 (m, 6H), 2.81 (m, 2H), 1.72 (m, 1H), 1.56 (singlets, 18H, t-BOC), 1.10-1.45 (m, 6H). N-(Nr-Fmoc-Nim-t-Boc-L, L-dihistidyl)-6-amino-2(O-DMT-hydroxymethyl)-1-hexanol (2-Cyanoethoxy)N,N-diisopropylphosphoramidite (13). 9 (1.27 g, 1.1 mmol) was dissolved in dichloromethane (11 mL). Tetrazole (93 mg, 1.33 mmol) was added and the mixture was stirred at 22 °C for 20 min. 2-Cyanoethoxy-N,N,N′,N′tetraisopropylphosphoramidite (398 mg, 1.32 mmol) was added, and the mixture stirred an additional 10 min at 22 °C. The mixture was filtered and the precipitate washed with EtOAc (10 mL). The combined filtrate and washing were diluted to 70 mL with EtOAc, washed with 10% Na2CO3 (2 × 50 mL) and brine (50 mL), dried, evaporated, and azeotroped with toluene. The residue was flash chromatographed on silica gel (40 g) and eluted with 50:50:3 to 30:70:3 hexane/EtOAc/TEA to afford 1.05 g (71%) of 13 as a diastereomeric mixture. 1H NMR (CDCl3): δ 8.28 (br d, 1H), 7.96 (s, 1H), 7.76 (d, 3H), 7.60 (t, 3H), 7.39 (t, 4H), 7.13-7.32 (m, 11H), 6.80 (d, 4H), 6.53 (br d, 1H), 4.69 (m, 1H), 4.35 (m, 3H), 3.22 (dd, 1H), 3.01-3.15 (m, 6H), 2.76 (m, 1H), 2.51 (q, 2H), 1.78 (m, 1H), 1.56 (d, 18H), 1.24-1.36 (m, 6H), 1.12 (doublets, 12H). 31P NMR (CDCl3): δ 148.0 (singlets). Anal. Calcd for C72H92N9O13P: C, 66.01; H, 6.89; N, 9.36. Found: C, 65.84; H, 6.93; N, 9.49. Nr-TFA-Nim-t-Boc-L-histidine (6). L-Histidine (15.0 g, 96.7 mmol) was suspended in MeOH (500 mL). Triethylamine (66 mL) was added followed by ethyl trifluoroacetate (68 mL) over 30 min. The mixture was stirred at 22 °C for 15 h. The solvent was evaporated and the residue suspended in DMF (500 mL). DIPEA (20 mL) and di-tert-butyl dicarbonate (24 mL) were added, and the mixture was stirred at 22 °C for 1 h. The reaction mixture was diluted with EtOAc (1.4 L), washed with cold 10% citric acid (1.4 L), water (1.4 L), and brine (1.4 L), dried, and evaporated. The residue was recrystallized

Phosphoramidite Reagents for Introduction into Oligonucleotides

from acetone to afford 27.5 g (81%) of 6. mp 130-131 °C. 1 H NMR (DMSO-d6): δ 13.08 (s, 1H), 9.65 (d, 1H), 8.12 (s, 11H), 7.24 (s, 1H), 4.55 (td, 1H), 3.05 (dd, 1H), 2.96 (dd, 1H), 1.54 (s, 9H). Anal. Calcd for C13H16F3N3O5: C, 44.45; H, 4.59; N, 11.96. Found: C, 44.54; H, 4.65; N, 11.94. N-(Nr-TFA-Nim-t-Boc-L,L-dihistidyl)-6-amino-2-hydroxymethyl-1-hexanol Dimethoxytrityl Ether (11). Method 1. 9 (2.9 g, 2.5 mmol) was dissolved in 20% (v/v) piperidine in toluene (25 mL) and stirred at 22 °C for 10 min. The reaction mixture was evaporated, azeotroped with toluene (15 mL), dissolved in EtOAc (100 mL), washed with brine (2 × 15 mL), dried, evaporated, and azeotroped with toluene (15 mL) to afford the crude amine 10. The residue was dissolved in dichloromethane (13 mL). Triethylamine (1.8 mL) and ethyl trifluoroacetate (1.5 mL) were added, and the solution was stirred at 22 °C for 16 h. Water (10 mL) was added, and stirring was continued for 1 h. The reaction mixture was diluted with EtOAc (20 mL) and 10% Na2CO3 (20 mL). The organic layer was separated, washed with 10% Na2CO3 (10 mL) and brine (10 mL), dried, evaporated, and azeotroped with toluene (10 mL). The residue was flash chromatographed on silica gel (90 g) and eluted with 99:1 to 95:5 dichloromethane/MeOH to afford 1.85 g (72%) of 11 as a diastereomeric mixture. Method 2. 7 (20 g, 22 mmol) was dissolved in 20% (v/ v) piperidine in toluene (220 mL) and stirred at 22 °C for 10 min. The reaction mixture was evaporated, azeotroped with toluene (150 mL), dissolved in EtOAc (500 mL), washed with brine (2 × 100 mL), dried, evaporated, and azeotroped with toluene (100 mL) to afford the crude amine 8. Separately, 6 (9.27 g, 26.4 mmol) was dissolved in 5.5:1 dichloromethane/DMF (130 mL). N-Hydroxysuccinimide (NHS) (6.08 g, 52.8 mmol) was added and the mixture was cooled in an ice bath. Dicyclohexylcarbodiimide (DCC) (5.45 g, 26.4 mmol) was added, and the mixture stirred at 0 °C for 15 min. To this mixture was added a solution of 8 (prepared above) in dichloromethane (35 mL). This was stirred at 0 °C for 20 min. DIPEA (9 mL) was added, and stirring at 0 °C was continued for 10 min. The reaction mixture was filtered, and the filtrate concentrated to approximately 100 mL. This was diluted with EtOAc (400 mL) and washed with 10% Na2CO3 (2 × 100 mL). The carbonate washings were combined and extracted with EtOAc (200 mL). The organic layers were combined, washed with brine (100 mL), dried, evaporated, and azeotroped with toluene (50 mL). The residue was flash chromatographed on silica gel (1 kg) and eluted with 99:1 to 96:4 dichloromethane/MeOH to afford 16.1 g (72%) of 11 as a diastereomeric mixture. 1H NMR: δ 8.52-8.72 (m, 2H, NH), 7.94 (doublets, 2H, His), 7.47 (br t, 1H, NH), 7.40 (m, 1H), 7.14-7.31 (m, 9H), 6.83 (m, 4H, DMT), 6.74 (d, 1H), 4.66 (m, 2H, His), 3.79 (singlets, 6H, DMT), 3.73 (m, 1H), 3.54-3.64 (m, 2H), 3.00-3.30 (m, 6H), 2.75 (m, 2H), 1.73 (m, 1H), 1.61 (singlets, 18H), 1.12-1.48 (m, 6H). N-(Nr-TFA-Nim-t-Boc-L, L-dihistidyl)-6-amino-2-(ODMT-hydroxymethyl)-1-hexanol (2-Cyanoethoxy)N,N-diisopropylphosphoramidite (14). 11 (14.2 g, 14 mmol) was dissolved in dichloromethane (140 mL). Tetrazole (1.17 g, 16.7 mmol) was added and the mixture stirred at 22 °C for 20 min. 2-Cyanoethoxy-N,N,N′,N′tetraisopropylphosphoramidite (5.57 g, 18.5 mmol) was added, and the mixture stirred an additional 10 min at 22 °C. The mixture was filtered and the precipitate washed with EtOAc (100 mL). The combined filtrate and washing were diluted to 600 mL with EtOAc, washed with 10% Na2CO3 (2 × 400 mL) and brine (400 mL),

Bioconjugate Chem., Vol. 10, No. 4, 1999 649

dried, evaporated, and azeotroped with toluene. The residue was flash chromatographed on silica gel (500 g) and eluted with 50:50:3 to 30:70:3 hexane/EtOAc/TEA to afford 13.4 g (79%) of 14 as a diastereomeric mixture. 1H NMR (CDCl ): δ 8.57 (s, 1H, NH), 8.50 (d, 1H, NH), 3 7.94 (s, 1H, His), 7.90 (s, 1H, His), 7.40 (m, 3H), 7.127.33 (m, 9H, DMT), 6.80 (dt, 4H, DMT), 4.64 (m, 2H, His), 3.78 (s, 6H, DMT), 3.69 (m, 3H), 3.54 (m, 3H), 3.22 (d, 1H), 3.05 (m, 4H), 2.68 (dd, 1H), 2.52 (q, 2H, CH2CN), 1.78 (m, 1H), 1.58 (singlets, 18H, t-BOC), 1.25-1.35 (m, 6H), 1.12 (singlets, 12H). 31P NMR: δ 148.1 (singlets). Anal. Calcd for C61H81F3N9O12P: C, 60.04; H, 6.69; N, 10.33. Found: C, 59.81; H, 6.72; N, 10.30. Oligonucleotide Synthesis. Phosphoramidites were used as 0.1 M solutions in acetonitrile in automated DNA synthesis using an Applied Biosystems 394 DNA/RNA synthesizer according to the manufacturer’s suggested DNA synthesis protocols on a 1 µmol scale. Coupling efficiencies were measured by using the dimethoxytrityl cation concentration. Deprotection was accomplished with concentrated ammonium hydroxide at 55 °C for 16 h. Purification was accomplished using OPEC columns (CLONTECH Laboratories, Inc.) according to recommended procedures. Oligonucleotides were analyzed by gel electrophoresis (20% PAGE-denaturing) and ionexchange HPLC (Mono Q column) and in every case demonstrated single band purity. Ion-Exchange HPLC Analysis. The 5′-modified (T)7 oligonucleotides 15a-c synthesized from phosphoramidite 14 were analyzed by ion-exchange HPLC on a Pharmacia Mono Q HR 5/5 column (5 mm × 5 cm). The mobile phases employed were A ) 50 mM Tris (pH 7.5) and B ) 800 mM NaCl, 50 mM Tris (pH 7.5). A gradient of 5-45% B over 40 min at a flow rate of 1 mL/min was used. RESULTS AND DISCUSSION

Reagent Design. A number of factors need to be taken into consideration in the design of an optimal labeling reagent to permit IMAC purification of DNA fragments. Several methods have been reported for the synthesis of oligonucleotide-peptide conjugates (9). However, we sought to avoid approaches which required both peptide and oligonucleotide couplings to prepare the desired conjugate. Therefore, we have designed a reagent which incorporates the peptidelike moiety in a form that can be directly utilized in oligonucleotide synthesis. Since introduction during the standard automated synthesis process without extraneous synthetic operations is clearly desirable, the reagent needs to be in the form of a suitably protected phosphoramidite. The nature of the chemical “backbone” which supports the labeling moiety must also be considered. While a 5′-labeling reagent based on 6-aminohexanol or a similar molecule would probably be suitable for many applications, added flexibility would be attained by a bifunctional scaffold which permitted multiple incorporations. For this purpose, we selected the 2-(4-aminobutyl)-1,3-propanediol backbone (10), although structures such as allonic acid (11, 12) and others (13, 14) could be considered. The number of imidazole moieties per reagent molecule is yet another issue. While a hexahistidine fragment is popular, and probably optimal (5), for protein purification, it has not been shown that the entire fragment is absolutely necessary. It is also unclear whether the optimal tag for protein purification would be the best choice for nucleic acid applications. Also, the molecular weight of a phosphoramidite reagent incorporating a suitably protected hexahistidine fragment

650 Bioconjugate Chem., Vol. 10, No. 4, 1999

Smith et al.

Scheme 1a

a Reagents: (a) 20% piperidine in toluene; (b) 5, PyBOP, HOBt, DMF; (c) 6, NHS, DCC, DCM; (d) EtOCOCF , TEA, DCM; (e) 3 NC(CH2)2OP(N(i-Pr)2)2, tetrazole, DCM.

would be rather high, making its performance on the synthesizer and its cost-effective preparation questionable. The synthesis of a reagent incorporating one imidazole moiety should be fairly straightforward. However, in terms of mimicking the possible importance of consecutive histidines in transition metal coordination, such a reagent would offer no advantage over the method developed by Min and Verdine (7). We felt that a dihistidine fragment would best address these issues. The benefit of consecutive histidines is retained, and multiple couplings can be used to achieve the optimal number of histidine residues. Chemistry. The chemistry utilized to prepare the tagging reagents used in this study is outlined in Scheme 1. A major chemical challenge in this problem is the identification of a suitable method for protection of the imidazole nitrogen. The protection of the imidazole ring has long been problematic in synthetic peptide chemistry (15). In addition to meeting the needs of peptide synthesis, suppression of side reactions, and racemization, the desired protecting group in this application must survive the conditions of phosphoramidite and oligonucleotide synthesis and yet be removable under mild conditions, preferably without requiring additional operations, after the completion of oligonucleotide synthesis. After considerable experimentation, t-butoxycarbonyl (BOC) was found to meet these criteria and appeared to be the best choice for our purposes. It survives the phosphoramidite and oligonucleotide synthesis conditions, and yet it is readily removed during the standard ammonium hydroxide cleavage and deprotection operation. Other possible protecting groups considered included fluorenylmethoxy-

carbonyl (Fmoc) and 2,4-dinitrophenyl (DNP) which were found to be too labile, and the trityl series which were either too labile as in the case of dimethoxytrityl or too difficult to remove as in the case of trityl. The Fmoc group of the 2-(4-aminobutyl)-1,3-propanediol synthon 3 (9) was removed with piperidine and the resulting amine 4 coupled to NR-Fmoc-Nim-Boc-L-His (5) via the BOP/HOBT procedure to afford 7 in 71% yield. Phosphitylation of this material with 2-cyanoethoxyN,N,N′,N′-tetraisopropylphosphoramidite and tetrazole afforded the monoHis reagent 12 in 78% yield. 7 also serves as an intermediate in the preparation of the diHis reagents. Piperidine treatment to provide 8 followed by BOP-mediated coupling of 5 afforded 9 in 78% yield. Phosphitylation of 9 provided the diHis reagent 13. Occasionally, we have observed instability with Fmocprotected alkylamino oligonucleotide synthesis reagents. Such problems can be avoided by the use of N-trifluoroacetyl protection. Therefore, we designed 14, the N-TFA protected version of the diHis reagent 13. Exchange of the protecting group of 9 was readily achieved via piperidine Fmoc cleavage followed by reaction of the resulting amine 10 with ethyl trifluoroacetate to afford 11. Phosphitylation of 11 provided the desired N-TFAprotected diHis reagent 14. Alternatively, 11 can be obtained in good yield via NHS/DCC mediated coupling of 6 with 8. The preparation of the protected histidine 6 was straightforward, involving sequential reaction of histidine with ethyl trifluoroacetate followed by di-t-butyl dicarbonate. The BOP-mediated coupling, which was successful with 5, failed using 6 as substrate resulting in extensive racemization. This is not particularly sur-

Phosphoramidite Reagents for Introduction into Oligonucleotides

Bioconjugate Chem., Vol. 10, No. 4, 1999 651

Figure 2. Polyacrylamide gel electrophoresis analysis of oligonucleotides 16a-c prepared with dihistidyl phosphoramidite 14. Lane 1: standard 24-mer. Lane 2: 5′-GGCTCTCCAGAACATCCCTGC-3′. Lane 3: 5′-(2H) GGCTCTCCAGAACATCCCTGC3′ (16a). Lane 4: 5′-(2H)2 GGCTCTCCAGAACATCCCTGC-3′ (16b). Lane 5: 5′-(2H)3 GGCTCTCCAGAACATCCCTGC-3′ (16c). Table 1. Summary of Ion-Exchange HPLC and MALDI-TOF Mass Spectroscopy Results oligonucleotide

HPLC retention time (min)

mol. wt. calcd

mol. wt. actual

(T)7 15a 15b 15c

22.8 19.8 20.5 21.3

2549.9 3033.4 3516.9

2547.7 3032.2 3515.8

prising in view of the known propensity of TFA-protected amino acids to undergo racemization during coupling (15). Racemization when using 6 as a substrate was suppressed by utilizing the NHS/DCC coupling procedure. Oligonucleotide Synthesis. Phosphoramidites 1214 were successfully employed in automated DNA synthesis using a commercial instrument under standard conditions. The performance of the diHis reagents 13 and 14 was equivalent, and subsequent experiments were carried out with the more stable TFA-protected reagent 14. A series of modified (T)7 oligonucleotides 15a-c were prepared incorporating 1, 2, or 3 additions of 14, respectively, at the 5′-terminus. These oligos were assayed for purity by ion-exchange HPLC, and their identities confirmed by MALDI-TOF mass spectroscopy. These results are summarized in Table 1. Also prepared using 14 was a series, 16a-c, of longer, 24-mer, mixed oligonucleotides incorporating 1, 2, and 3 additions of 14. These syntheses also proceeded without incident. While the size of these molecules precluded acquisition of mass spectral data, the resulting oligonucleotides were analyzed by PAGE (Figure 2). This analysis demonstrates the effect of the introduction of multiple histidine residues on oligonucleotide gel mobility. Also demonstrated is the high efficiency with which dihistidyl residues can be incorporated into oligonucleotides with 14. IMAC Retention. The retention of the “His-tagged” oligonucleotides 16a-c by a common IMAC matrix, NiIDA (iminodiacetic acid), was investigated, and the results were outlined in Figure 3. Samples were applied in denaturing phosphate buffer (pH 8), and the absorbed

Figure 3. IMAC of 2-, 4-, and 6-His-Oligos (24-mer) (Figure 1) on Ni2+-IDA-Superflow 6. Approximately 1.0 AU (254 nm) was loaded ona 5 × 1 cm.i.d. column packed with IDA-Superflow 6, charged with Ni2+ ions and equilibrated with 50 mM sodium phosphate; 0.25 M NaCl; 8.0 M Urea, pH 8.0, at a flow rate of 1 mL/min. The nonadsorbed material was washed out with the equilibration buffer and the adsorbed material was eluted with 150 mM imidazole in the equilibration buffer. a. 2-His-Oligo (24mer) 16a. b. 4-His-Oligo (24-mer) 16b. c. 6-His-Oligo (24-mer) 16c.

material eluted with 150 mM imidazole. Under these conditions, IMAC retentivity increased with increasing numbers of imidazole residues. Very little of oligonucleotide 16a, with two His residues, was retained by the matrix while almost all of 16c, with six His residues, was retained. Summary. Synthesis of a bifunctional reagent for the incorporation of dihistidyl residues into oligonucleotides has been reported. Any number of dihistidyl residues can be incorporated at any position in the oligonucleotide. Preliminary experiments indicate feasibility of modifying

652 Bioconjugate Chem., Vol. 10, No. 4, 1999

oligonucleotides with this reagent to permit their purification by IMAC methods. Histidine- or imidazolecontaining oligonucleotides are also of interest as artificial nucleases due to the ability of imidazole rings to complex metal ions and cleave nucleic acid chains (1, 2). The reagents reported herein provide a convenient and flexible way to introduce imidazole moieties into oligonucleotides. LITERATURE CITED (1) Hovinen, J., Guzaev, A., Azhayeva, E., Azhayev, A., and Lonnberg, H. (1995) Imidazole tethered oligodeoxyribonucleotide: Synthesis and RNA cleaving activity. J. Org. Chem. 60, 2205. (2) Reynolds, M. A., Beck, T. A., Say, P. B., Schwartz, D. A., Dwyer, B. P., Daily, W. J., Vaghefi, M. M., Metzler, M. D., Klem, R. E., and Arnold, L. J. (1996) Antisense oligonucleotides containing an internal, nonnucleotide-based linker promote site-specific cleavage of RNA. Nucleic Acids Res. 24, 760. (3) Porath, J. (1992) Immobilized metal ion affinity chromatography. Protein Expression Purif. 3, 263. (4) Lopatin, S. A., and Varlamov, V. P. (1995) New trends in immobilized metal affinity chromatography of proteins. App. Biochem. Microbiol. 31, 221. (5) Ford, C. F., Suominen, I., and Glatz, C. E. (1991) Fusion tails for the recovery and purification of recombinant proteins. Protein Expression Purif. 2, 95. (6) Orum, H., Nielsen, P. E., Jorgensen, M., Larsson, C., Stanley, C., and Koch, T. (1995) Seauence-specific purification of nucleic acids by PNA-controlled hybrid selection. BioTechniques 19, 472.

Smith et al. (7) Min, C., and Verdine, G. L. (1996) Immobilized metal affinity chromatography of DNA. Nucleic Acids Res. 24, 3806. (8) Hochuli, E., Dobeli, H., and Schacher, A. (1987) New metal chelate adsorbent selective for proteins and peptides containing neighbouring histidine residues. J. Chromatogr. 411, 177. (9) Beltran, M., Pedroso, E., and Grandas, A. (1998) A comparison of histidine protecting groups in the synthesis of peptide-oligonucleotide conjugates. Tetrahedrom Lett. 39, 4115. (10) Nelson, P. S., Kent, M., and Muthini, S. (1992) Oligonucleotide labeling methods 3. Direct Labeling of oligonucleotides employing a novel, nonnucleosidic, 2-aminobutyl-1,3-propanediol backbone. Nucleic Acids Res. 20, 6253. (11) Smith, T. H., Kent, M. A., Muthini, S., Boone, S. J., and Nelson, P. S. (1996) Oligonucleotide labeling methods 4. Direct Labeling reagents with a novel, nonnucleosidic, chirally defined 2-deoxy-β-D-ribosyl backbone. Nucleosides Nucleotides 15, 1581. (12) Hovinen, J., and Salo, H. (1997) C-Glycoside phosphoramidite building block for versatile functionalization of oligodeoxyribnucleotides. J. Chem. Soc., Perkin Trans. 1, 3017. (13) Behrens, C., Petersen, K. H., Egholm, M., Nielsen, J., Buchardt, O., and Dahl, O. (1995) A new achiral reagent for the incorporation of multiple amino groups into oligonucleotides. Bioorg. Med. Chem. Lett. 5, 1785. (14) Su, S.-H., Iyer, R. S., Aggarwal, S. K., and Kalra, K. L. (1997) Novel nonnucleosidic phosphoramidites for oligonucleotide modification and labeling. Bioorg. Med. Chem. Lett. 7, 1639. (15) Bodanszky, M. (1993) Principles of Peptide Synthesis, 2nd ed. pp 152-157, Springer-Verlag, New York.

BC990002C