Bilayered Scaffold Prepared from Kartogenin Loaded Hydrogel and

Subscriber access provided by Nottingham Trent University

Tissue Engineering and Regenerative Medicine

Bilayered Scaffold Prepared from Kartogenin Loaded Hydrogel and BMP-2-derived Peptides Loaded Porous Nanofibrous Scaffold for Osteochondral Defect Repair Lixia Zheng, Dejian Li, Weizhong Wang, Qianqian Zhang, Xiaojun Zhou, Dinghua Liu, Jingtian Zhang, Zhengwei You, Jundong Zhang, and Chuanglong He ACS Biomater. Sci. Eng., Just Accepted Manuscript • DOI: 10.1021/ acsbiomaterials.9b00513 • Publication Date (Web): 05 Aug 2019 Downloaded from pubs.acs.org on August 11, 2019

Just Accepted “Just Accepted” manuscripts have been peer-reviewed and accepted for publication. They are posted online prior to technical editing, formatting for publication and author proofing. The American Chemical Society provides “Just Accepted” as a service to the research community to expedite the dissemination of scientific material as soon as possible after acceptance. “Just Accepted” manuscripts appear in full in PDF format accompanied by an HTML abstract. “Just Accepted” manuscripts have been fully peer reviewed, but should not be considered the official version of record. They are citable by the Digital Object Identifier (DOI®). “Just Accepted” is an optional service offered to authors. Therefore, the “Just Accepted” Web site may not include all articles that will be published in the journal. After a manuscript is technically edited and formatted, it will be removed from the “Just Accepted” Web site and published as an ASAP article. Note that technical editing may introduce minor changes to the manuscript text and/or graphics which could affect content, and all legal disclaimers and ethical guidelines that apply to the journal pertain. ACS cannot be held responsible for errors or consequences arising from the use of information contained in these “Just Accepted” manuscripts.

is published by the American Chemical Society. 1155 Sixteenth Street N.W., Washington, DC 20036 Published by American Chemical Society. Copyright © American Chemical Society. However, no copyright claim is made to original U.S. Government works, or works produced by employees of any Commonwealth realm Crown government in the course of their duties.

Page 1 of 34 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

ACS Biomaterials Science & Engineering

Bilayered Scaffold Prepared from Kartogenin Loaded Hydrogel and BMP-2-derived Peptides Loaded Porous Nanofibrous Scaffold for Osteochondral Defect Repair

Lixia Zheng,†,‡ Dejian Li,†,§ Weizhong Wang,‡ Qianqian Zhang,‡ Xiaojun Zhou,‡ Dinghua Liu,‡ Jingtian Zhang,‡ Zhengwei You,⊥ Jundong Zhang,*,# Chuanglong He*,‡ ‡

State Key Laboratory for Modification of Chemical Fibers and Polymer Materials,

College of Chemistry, Chemical Engineering and Biotechnology, Donghua University, Shanghai 201620, China. §

Department of Orthopedics, Shanghai Pudong Hospital, Fudan University Pudong

Medical Center, Shanghai 201301, China. ⊥

State Key Laboratory for Modification of Chemical Fibers and Polymer Materials,

International Joint Laboratory for Advanced Fiber and Low-dimension Materials, College of Materials Science and Engineering, Donghua University, Shanghai 201620, China. # Tenth

People's Hospital Affiliated to Tongji University, Shanghai 200072, China.

Corresponding author. *E-mail: [email protected]. Tel and Fax: +86 21 6779 2742. (C. L. He) *E-mail: [email protected] (J. D. Zhang)

ACS Paragon Plus Environment

ACS Biomaterials Science & Engineering 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 2 of 34

ABSTRACT Recently,

bilayered

scaffold

with

anisotropic

structure

mimicking

native

osteochondral tissue shows the considerable potential for treating osteochondral defects. Herein, a bilayered scaffold consisting of biomimetic cartilage and subchondral bone architecture was constructed for repairing osteochondral defect. A hydrogel prepared by the Schiff base reaction of gelatin, silk fibroin and oxidized dextran was designed as cartilage layer, while a nanofibrous scaffold with macroporous structure prepared from polymer blend of poly(L-lactic acid) (PLLA)/poly(lactic-co-glycolic acid) (PLGA)/poly(ε-caprolactone) (PCL) using dual phase separation technique served as subchondral layer. The subchondral layer was then treated with polydopamine coating for osteogenic factor immobilization. To facilitate the chondrogenic and osteogenic differentiation of bone marrow mesenchymal stem cells (BMSCs) on the bilayered scaffold, the cartilage-inducing drug kartogenin (KGN) and osteogenic-inducing factor bone morphogenetic protein 2-derived peptides (P24 peptides) were respectively loaded on the subchondral layer and subchondral layer. Next, the in vitro release of KGN and P24 peptide from the corresponding layer were monitored respectively, and the results showed that the both the release time of KGN and P24 peptides would last for more than 28 days. The in vitro results indicated that the KGN-loaded cartilage layer and P24 peptides-loaded subchondral layer were capable of supporting cell proliferation, and induced the chondrogenic and osteogenic differentiation respectively. Furthermore, the in vivo experiments suggested the bilayered scaffold significantly accelerated the regeneration of osteochondral tissue in the rabbit knee joint model. Consequently, this bilayered scaffold loaded with KGN and P24 peptides would be a promising candidate for repairing osteochondral defect.

Key word:

hydrogel, nanofibrous scaffold, kartogenin, BMP-2 derived peptides,

osteochondral regeneration


Page 3 of 34 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


1. INTRODUCTION Osteochondral defects which were commonly caused by trauma, disease or aging create a severe healthcare burden all over the world and commonly involve injuries of cartilage and subchondral bone.1-3 Currently, the frequently-used treatment strategies for osteochondral damage include microfracture,4,5 implantation of autologous chondrocyte,6,7 and implantation of osteochondral autografts and allografts.8-10 Despite they were commonly used in clinic, various limitations and shortcomings still exist, including limited treatment effect,11,12 shortage of implants source13,14 and risk of immune rejection and disease transmission.15,16 Recently, the development of tissue engineering provides a promising method with broad application prospects for osteochondral defect repair.17 The strategy is mainly providing proper biomaterials as artificial and transient extracellular matrix (ECM) to support cell growth, differentiation and tissue regeneration at the defects.18 The construction of bi-layered scaffolds is currently the focus of osteochondral research, which was mainly based on the layered structure of osteochondral tissue.19,20 Hydrogels have attracted great attention of researchers because of the structural similarity to ECM and the porous framework, which enables cell transplantation and proliferation. Compared with other synthetic biomaterials, hydrogels provide a more appropriate microenvironment similar to the ECM, which could reduce the friction and mechanical effects on surrounding tissues and significantly improve the biological properties of materials.21-23 More importantly, hydrogels have the similar mechanical performance as cartilage. Therefore, hydrogels are suitable for cartilage defects repair. However, the mechanical properties of hydrogels limited them to be the appropriate subchondral bone scaffolds. In a previous study, we developed a dual phase separation method to construct porous and biomimetic nanofibrous scaffold without using porogen materials.24,25 Especially, the prepared poly(L-lactic acid) (PLLA)/poly(lactic-co-glycolic acid) (PLGA)/poly(ε-caprolactone) (PCL) scaffold possessed not only proper mechanical property, but also superior degradability and excellent pore interconnectivity, which makes it to be the potential subchondral bone



Page 4 of 34

scaffold in osteochondral defect repair application. In addition, massive studies have demonstrated that the pure polymer scaffold is always insufficient for effective treatment of osteochondral defects because of the complexity of osteochondral tissue. It is necessary to incorporate bioactive factors to promote

osteochondral

regeneration

during

tissue

reconstruction

process.26

Kartogenin (KGN) is a small molecule cartilage-inducing drug that was found by Johnson and the co-workers.27 It has been verified to induce chondrogenesis and maintain the chondrocytes’ phenotype.28,29 Moreover, KGN retained a strong chondroprotective effect after activating chondrocytic chondrolysis.30 Bone morphogenetic protein-2 (BMP-2) is regarded as an high-efficiency osteogenic factor.31 Besides, massive studies found that the KIPKASSVPTELSAISTLYL peptide synthesized from the 73-92 amino acid fragment of the BMP-2 finger epitope can induce ectopic osteogenesis.32,33 Biomaterials incorporated with BMP-2-derived peptides are also capable of inducing osteogenic differentiation and bone regeneration in vivo.34,35 Compared with BMP-2, BMP-2-derived peptides are inexpensive and not easily inactivated.34 Therefore, incorporating BMP-2-derived peptides in biomaterials is effective to enhance the bone regeneration. Herein, we aimed to develop a KGN and BMP-2-derived peptides incorporated bilayered scaffold that simulates the layered structure of osteochondral tissue, and assess the repair effect of this scaffold for osteochondral defects. The morphologies of the distinct layers were observed by using scanning electron microscopy (SEM). The release of loaded factors from the different layers was monitored. In addition, in vitro chondrogenic and osteogenic differentiation of bone marrow mesenchymal stem cells (BMSCs) on the dual-factors loaded bilayered scaffold were evaluated. Finally, in vivo repair effect of the prepared dual-factors loaded bilayered scaffold on osteochondral defect was systematically investigated.

2. EXPERIMENTAL SECTION 2.1 Materials. Silkworm cocoons were purchased from Xinyuan sericulture


Page 5 of 34 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


company (Nantong, Jiangsu, China). Gelatin (Gel), dextran, lithium bromide (LiBr) and tetrahydrofuran (THF) were bought from Sigma-Aldrich Trading Co., Ltd. (USA). PLLA (Mw: 2.47×105), PCL (Mw: 1.2×105) and PLGA (75:25, Mw: 1.1×105) were purchased from Daigang Biomaterials Inc. (Jinan, China). BMP-2-derived peptides (amino acid sequence: SKIPKASSVPTELSAISTLYDDD, P24 peptides) were obtained

from

Chinapeptides

Co.,

Ltd.

(China).

KGN,

dopamine,

1-Ethyl-3-(3’-dimethylaminopropyl) carbodiimide (EDC) and N-Hydroxysuccinimide (NHS) were obtained from Aladdin Bio-Chem Technology Co., Ltd. (USA). DMEM/F-12 cell culture medium, trypsin-EDTA, fetal bovine serum (FBS), and penicillin-streptomycin were purchased from Gibco Life Technologies Co. (Grand Island, NY). 2.2 Preparation of Bilayered Scaffold. 2.2.1 Preparation of P24 Peptides Loaded Nanofibrous Scaffolds. Nanofibrous scaffold was fabricated using dual phase separation as previously described.25 Briefly, PLLA/PLGA/PCL with blend ratio of 3:4:3 was dissolved at 60 °C using THF to prepare homogeneous polymer solutions with concentration of 10% (w/v). Next, the obtained homogeneous solution was immediately casted into Teflon molds and quickly placed at -80 °C for at least 8 h. After that, the polymer gel was immersed in ice-water mixture for 3 days with water changed 4 times per 24 h. Finally, the obtained nanofibrous scaffold (NF scaffold) was cut into the same size. The NF scaffolds were then placed in a dopamine solution with the concentration of 2 mg/ml in 10 mM Tris-HCl (pH = 8.5) at room temperature and incubated for 12 h, polydopamine (PDA) formed by self-polymerization was coated on the surface of the NF scaffolds. Then the obtained scaffolds were ultrasonically treated to remove uncoated dopamine. The NF scaffolds modified with PDA were subsequently immersed in a P24 peptides solution with concentration of 1 mg/ml in 10 mM Tris-HCl (pH = 8.5) and stirred at 37 °C for 24 hours. As reported in a published paper,36 P24 peptides were mainly covalently immobilized on the scaffold through the reaction between nucleophiles and the PDA coating. Then the scaffolds were washed with phosphate buffer saline (PBS) for three times to remove the unattached P24



peptides. The obtained scaffolds were designated as NF-P24 scaffold. In addition, NF scaffold without PDA treatment was immersed in the same P24 peptides at the same conditions were set as control group. 2.2.2 Preparation of KGN Loaded Hydrogels. Silk fibroin (SF) protein was extracted according to earlier published paper with some modifications.37,38 Briefly, 30 g silkworm cocoons were weighed and boiled for 30 min in 3 L deionized water containing 15 g of Na2CO3, and rinsed 3 times with deionized water. The extracted SF was dried in 60 °C oven and weighed. The degummed silk and 9.3 M LiBr aqueous solution were dissolved at a mass ratio of 1:9 in a water bath at 45 °C. Next, transfer the reaction solution into dialysis bag (MWCO 14000, Viskase, America) for 3 days, changing the water 4 times per day. The silk solution was freeze-dried using a lyophilizer and placed in a refrigerator at -20 °C. Oxidized dextran (ODEx) was synthesized on the basis of a reported method.39 Briefly, 5 g dextran was added into 50 mL of deionized water. Then, 5 mL of NaIO4 solution (20% w/v) was dropwise added into dextran solution. The mixture solution was continuously stirred away from light for 4 h at room temperature. Then, ethylene glycol with the volume of 2 mL was added into the mixture solution to stop the reaction. Next, the reaction solution was transferred to dialysis bag (MWCO 3500, Viskase, America) and dialyzed for 3 days, with water changed 4 times per day. The product was freeze-dried using a lyophilizer and placed in a ziplock bag at -20 °C. Gel, SF and ODEx were combined through deionized water to produce a Gel concentration of 0.05 g/mL, SF concentration of 0.05 g/mL and ODex concentration of 0.06 g/mL. At the same time, 1 mg of KGN was dissolved in a solution containing EDC/NHS for 30 min. All the above prepared solutions were mixed, placed in a mold, and the solutions were allowed to gel at room temperature for 5 minutes to obtain KGN-loaded Gel/SF/ODex hydrogel (designated as GSO-KGN hydrogel). 2.2.3 Preparation of Dual-Factors Loaded Bilayered Scaffolds. First, NF-P24 scaffolds were prepared and placed in a mold. The previously prepared KGN-loaded GSO hydrogel mixed solution was placed on the NF-P24 scaffolds in the mold, and a vacuum was applied to immerse a part of the hydrogel solution into the surface of the


Page 6 of 34

Page 7 of 34 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


NF-P24 scaffolds to prepare the bilayered scaffolds. Then the hrdrogel layer were crosslinked at room temperature for 5 minutes as described above to obtain dual-factors loaded bilayered scaffold (designated as DF bilayered scaffold). 2.3 Morphological Characterization. The microstructures of the individual layers of the bilayered scaffold and the integrated bilayered scaffold were observed by SEM (Phenom XL, China). The specimens were dried by a vacuum freeze dryer (ALPHA 1-2 LD, Germany), and the cross-section of the scaffolds was quenched with liquid nitrogen. The surface of the sample was coated with gold before observation and then characterized using SEM at 10 kV of acceleration voltage. 2.4 In Vitro Release Study. The release kinetics study of KGN from GSO-KGN hydrogel was carried out by using rhodamine B (named as RhB) as a model of KGN molecule.40 Briefly, GSO-RhB hydrogel was dispersed in a centrifuge tube containing 5 mL of PBS buffer and incubated at 37 °C in a shaker (100 rpm). At specific times, 2 mL of PBS was withdrawn and added 2 mL of new PBS. The absorbance of release solution at 527 nm was detected via microplate reader to calculate the sustained release amount of the drug. To assess the release of P24 peptides from NF-P24 scaffolds, the fluorescein isothiocyanate (FITC)-labeled P24 peptides (FITC-P24 peptides) were used. The experiment was performed with the same procedures as the release kinetics study of KGN. The fluorescence intensities in the buffer were measured at 490 nm of excitation wavelength and 530 nm of emission wavelength, respectively. 2.5 Cell Isolation and Culture. The animal tests were performed according to the NIH guidelines for the care and use of laboratory animals (NIH Publication No. 85-23 Rev. 1985) and approved by the ethics committee in animal experimentation of the Research Center for Laboratory Animals of the Ninth People’s Hospital affiliated to Shanghai Jiao Tong University, School of Medicine, Shanghai, China. Sprague-Dawley (SD) rats’ BMSCs were isolated as described in the previous literature with minor modifications.41 Briefly, 2-4 weeks old healthy SD rat pups were purchased from Shanghai Slac laboratory animal co., LTD, China. BMSCs were extracted from the hind leg femur. Subsequently, BMSCs were cultured in



DMEM/F-12 medium containing 10% (v/v) FBS and 1% (v/v) penicillin/streptomycin in a 37 °C incubator containing 5% CO2. The 3-5th generation cells with better growth state were selected for subsequent experiments. 2.6 Cell Viability Assay. The viability of BMSCs on the scaffolds was evaluated by Cell Counting Kit-8 (CCK-8) assay. Briefly, place the sterilized GSO hydrogels, GSO-KGN hydrogels, NF scaffolds and NF-P24 scaffolds in 24-well plates and the blank plate (TCP) without samples was selected as the control. BMSCs were seeded in the hydrogels wells at 2×104 cells per well and in the nanofibrous scaffolds wells at 5×103 cells per well. At the predetermined culture time, remove the culture medium and wash the scaffolds three times with PBS. Next, 200 μL of CCK-8 working solution containing 10% CCK-8 reagent was added into each well. After incubation at 37 °C for 1 hour in a 5% CO2 incubator, transfer 100 μL of the supernatant into a 96-well plate and detect the absorbance at 450 nm using a microplate reader (MK3, Thermo, USA). 2.7 Cartilage Differentiation Assay. The expression of chondrogenic markers, including collagen type I (COL I), collagen type II (COL II), Aggrecan and SOX9, was measured using real-time polymerase chain reaction (RT-PCR). Briefly, the sterilized hydrogels were placed in 6-well plates and BMSCs were seeded in the wells at 2 × 105 per well. BMSCs were induced by cartilage-induced medium (DMEM/F-12, 100 nM dexamethasone, 50 μg/mL ascorbic acid, 40 μg/mL valine, 1% double antibody, 1% ITS medium additive (100×)) . After 7 and 14 days of culture, BMSCs were lysed by adding cell lysate, and then the expression of cartilage-related genes was detected by RT-PCR. The experimental steps of RT-PCR mainly include extraction of total ribonucleic acid (RNA), reverse transcription, quantitative PCR and result processing. The primers sequences used in this study were listed in Table 1. The gene expression level of each targeted gene was detected by the 2-ΔΔCT method, and the glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was selected as the reference gene. Each RT-PCR was carried out using at least 3 different parallel samples. Western blotting analysis was performed to analyze the expression of COL I, COL


Page 8 of 34

Page 9 of 34 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


II, Aggrecan and SOX9 at the protein level. Briefly, extract the whole cellular protein of BMSCs with Radio Immunoprecipitation Assay (RIPA) lysis buffer when the BMSCs were seeded on the hydrogels and cultured for 21 days. Then measure the protein concentration using the Bicinchoninine acid assay (BCA) Protein Assay Kit. Next, separate the extracted protein on sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) gels and transfer it onto a polyvinylidene difluoride membrane. The membrane was first incubated with the primary antibody overnight at 4 °C, and then incubated at room temperature with horseradish peroxidase (HRP) conjugated secondary antibody for 2 h. Membranes were observed following immerse to chemiluminescence reagents (ECL kit). Each Western blotting analysis was conducted on at least 3 parallel samples, and the representative results were shown to be normalized to target protein expression of the reference protein β-actin. 2.8 Osteogenic Differentiation Assay. The alkaline phosphatase (ALP) is an early marker of osteogenic differentiation.42 The ALP activity was evaluated using an ALP assay kit. Briefly, place the sterilized NF scaffolds in 6-well plates and seed BMSCs in the wells at a density of 2 × 105 per well. BMSCs were incubated with osteoinductive medium (growth medium supplemented with 100 nM dexamethasone, 10 mM β-glycerol phosphate and 50 μg/mL L-ascorbic acid) for 7 or 14 days. BMSCs were cleaved through cell lysates (0.2% Triton X-100), and then cell lysates were collected through centrifugation at 10,000 rpm for 5 min. Pipette 50 μL of cell lysate into to 96-well plate and add another 50 μL of the substrate solution to each well. Next, incubate the 96-well plate

in cell culture incubator for 30 minutes, and add

stop solution into each well to stop the reaction. Finally, measure the absorbance of solution at 405 nm using a microplate reader. The ALP activity was normalized against the total protein and expressed as μmol/min/mg total protein. BMSCs were induced by bone-induced medium to 7 days and 14 days, and the expression of osteogenic markers, including COL I, runt-related transcription factor-2 (RUNX2), osteocalcin (OCN) and osteopontin (OPN), were evaluated using RT-PCR. The primers’ sequences used in this study were listed in Table 1. BMSCs were induced by bone-induced medium to 21 days, and the osteogenic associated proteins



Page 10 of 34

expression was characterized using western blotting. 2.9 In Vivo Osteochondral Repair. 2.9.1 Surgical Operation. To assess the in vivo osteochondral repair effect of the bilayered scaffold, New Zealand white rabbits (Shanghai Slack Laboratory Animals Co., Ltd, China) weighing approximately 2.0 kg were used. The rabbits were anesthetized using 3% pentobarbital (1 mL/kg) through the ear vein. The right and left knees were shaved and sterilized with 75% alcohol. Osteochondral defect (diameter of 5 mm and depth of 4 mm) were caused by corneal trephine in tracheal groove of distal femur. In the control group (n=3), the osteochondral defect was left blank and no material was added. In the pristine bilayered scaffold group (n=3), the osteochondral defect was implanted with scaffolds containing no bioactive factors. In the DF bilayered scaffold group (n=4), bilayered scaffolds containing KGN and P24 peptides were implanted in the site of osteochondral defect. After 4 and 12 weeks of post-surgery, the implants were harvested for further characterization. 2.9.2 Micro-Computed Tomography. Micro-computed tomography (Micro-CT) analysis was conducted to measure new bone growth conditions. The acquired samples were scanned with micro-CT (Quantum GX, PERKINELMER, USA), then 3D images were reconstructed by SkyScan CTVOX 2.1 software, and bone volume and bone mineral density were analyzed. 2.9.3

Histological

Analysis.

Rabbit

femurs

were

firstly

fixed

in

4%

paraformaldehyde at 4 °C for 2 days. Subsequently, all samples were decalcified with decalcification solution for about 15 days. The decalcified samples were then embedded in paraffin and cut into slices with thickness of 5 μm. The sections were collected and stained with hematoxylin-eosin (H&E) and masson reagents, and finally observed using an optical microscope. 2.10 Statistical Analysis. All the data were presented as mean ± standard deviation (SD) from at least three parallel experiments. Statistical analysis was performed using one-way analysis of variance (one-way ANOVA) followed by post hoc Tukey’s method. The statistical significance for all tests was considered at *P < 0.05 and **P < 0.01.


Page 11 of 34 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


3. RESULTS AND DISCUSSION 3.1 Morphologies of Different Scaffolds. The schematic illustration of dual-bioactive factors loaded bilayered scaffold for osteochondral defect repair is shown in Scheme 1. The cartilage layer was composed of a KGN-loaded polymer hydrogel, while the subchondral bone layer was constructed with BMP-2-derived peptides-loaded nanofibrous scaffold fabricated by dual phase separation method. Fig. 1 showed the morphologies of GSO-KGN hydrogel, NF-P24 scaffold and DF bilayered scaffold. As shown, the GSO-KGN hydrogel was transparent (Fig. 1A). SEM image showed that the GSO-KGN hydrogel contained a uniform and interconnected porous structure (Fig. 1D), which endow the hydrogel with high water content and specific surface area. Also, the highly porous structure in hydrogel provides proper space for cells infiltration. Fig. 1B showed that NF-P24 scaffold was black due to the coating of PDA. The coating of PDA significantly improved the hydrophilicity of the scaffold (Fig. S1). Similarly, the NF-P24 scaffold possessed large pore size with good interconnectivity as reported in our previous study.25 This porous structure makes them to be beneficial for the infiltration of seeded cells. In addition, higher magnification images revealed the scaffold had a biomimetic nanofibrous structure (Fig. 1E), which facilitated nutrient transport. The DF bilayered scaffold was prepared by combining the GSO-KGN hydrogel and the NF-P24 scaffold (Fig. 1C). The SEM image of DF bilayered scaffold showed the upper hydrogel filled in the macropores of the lower NF-P24 scaffold (Fig. 1F), which could enhance the bonding degree of two layers in the obtained bilayered scaffold. 3.2 Drug Release Behavior. RhB was used as a model drug to test the release profile of KGN from hydrogel. The cumulative release profile of RhB from the GSO-RhB hydrogels was shown in Fig. 2A. RhB in the hydrogel displayed an initial burst release about 22.76±3.32% within the first 1 days. After released for more than 5 days, RhB within the hydrogel exhibited a sustained release profile. The drug was released as the hydrogels degraded by comparing the drug release profile with the hydrogel degradation curve (Fig. S2). After released for 28 days, the cumulative



release of RhB reached to 59.45 ± 5.65%. In addition, the release profile of FITC-P24 peptides from the NF-FITC-P24 nanofibrous scaffolds were also investigated, and NF-FITC-P24 scaffolds treated without PDA coating were set as the control. We first measured the fixation efficiency of FITC-P24 peptides on these two kinds of scaffolds. For the NF scaffold treated without PDA coating, the fixation efficiency of FITC-P24 peptides was calculated to be only 45.63 ± 2.76%. While for the NF scaffold treated with PDA coating, the fixation efficiency of FITC-P24 peptides increased into 87 ± 4.60%. Fig. 2B showed the release profile of P24 peptides from the two NF scaffolds. The FITC-P24 peptides on the scaffold without PDA coating showed a burst release in the buffer and were almost completely released from the scaffold within 3 days. But the release time of the P24 peptides immobilized on the PDA coated NF scaffold was extended to 28 days. In summary, PDA coated NF scaffold not only increased the fixation efficiency of polypeptides on the scaffold,35,43 but also effectively reduced the release rate of polypeptides from the scaffold. 3.3 Cell Viability. In order to study cell viability on the prepared hydrogels and NF scaffolds, BMSCs were respectively seeded on the GSO hydrogels, GSO-KGN hydrogels, NF scaffolds, NF-P24 scaffolds and cultured for 5 days. The results of cell viability of BMSCs cultured on the scaffolds were showed in Fig. 3. The viability of BMSCs on each sample increased with culture time. BMSCs cultured on scaffolds with or without bioactive factor showed the similar cell viabilities after culture for 1, 3 and 5 days, indicating that the presence of KGN and P24 peptides did not affect the viability of BMSCs on the scaffolds. To further assess the in vivo biocompatibility, the DF bilayered scaffolds were subcutaneously implanted in ICR mice. Masson staining and H&E staining indicated the scaffolds do not cause any inflammatory reaction and cells can permeate into the bilayered scaffold (Fig. S3). 3.4 Cartilage Differentiation. In order to study the cartilage differentiation potential in the hydrogel layer, BMSCs were seeded on the hydrogel layer and cultured using cartilage-inducing medium. The expression of several chondrogenic markers (COL I, COL II, SOX9 and Aggrecan) were measured by RT-PCR for 7 and


Page 12 of 34

Page 13 of 34 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


14 days of culture. Fig. 4B showed the expressions of COL II, SOX9 and Aggrecan for GSO-KGN hydrogels were obviously higher than those in GSO hydrogels (P < 0.05). Comparatively, the expression of COL I for GSO-KGN hydrogels was lower than that for GSO hydrogels and showed no statistically significant difference. In addition, the expression of COL II, SOX9 and Aggrecan for the same sample increased with the culture time, but the expression of COL I decreased with culture duration (P < 0.05). These results confirmed that KGN promoted cartilage differentiation of BMSCs.27 Western blotting analysis also showed the similar expression of chondrogenic markers of BMSCs on the GSO hydrogels and GSO-KGN hydrogels after 21 days of induction culture (Fig. 4A), further demonstrating that GSO-KGN hydrogels can further promote the differentiation of BMSCs into chondrocytes. 3.5 Osteogenic Differentiation. To assess the effect of NF scaffolds on the osteogenic differentiation of BMSCs, the activity of ALP was evaluated. As shown in Fig. 5, the ALP activity was not significantly different between the NF scaffolds and NF-P24 scaffolds when culturing BMSCs for 7 days. However, when BMSCs were cultured for 14 days, the ALP activity for NF-P24 scaffolds was obviously higher than that of the NF scaffolds (P < 0.05), which suggested that the P24 peptides released from the scaffolds obviously increased synthesis and secretion of ALP in vitro. To confirm the osteoinductive abilities of the scaffolds, the gene and protein expression levels of RUNX2, COL I, OPN and OCN were measured using RT-PCR and western blotting. As seen in Fig. 6A, obvious visible bands for RUNX2, COL I, OPN and OCN were observed for NF-P24 scaffolds. The quantitative analyses of RT-PCR indicated that mRNA expression levels of RUNX2, COL I, OPN and OCN for NF-P24 scaffolds were obviously higher than those for NF scaffolds after culture for 7 and 14 days (Fig. 6B). These results indicated that the presence of P24 peptides effectively facilitated the expression of osteogenic differentiation related gene markers of BMSCs, and thus indicated that the NF-P24 scaffolds were able to enhance in vitro osteogenic differentiation of BMSCs.43 3.6 In Vivo Repair Evaluation. An osteochondral defect model in rabbit was



created to assess the in vivo repair effect of dual-factor loaded bilayered scaffold for osteochondral regeneration. Surgical procedure photographs for creating the rabbit osteochondral defect were showed in Fig. S4. Macroscopic photographs of knees collected at 4 and 12 weeks of post-implantation were shown in Fig. 7. New tissues was found in the pristinepristine bilayered scaffold and the DF bilayered scaffold groups, while large residual void space was found still in the control group at 4 weeks (Fig. 7A-C). Specifically, cartilage-like tissue was regenerated in the DF bilayered scaffold group, while in the pristinepristine bilayered scaffold group, only a handful of cartilaginous tissue with some small cavities was found. Repair effect was improved with the increase of implantation time from 4 to 12 weeks. At week 12, the defects became shallow and filled with coarse fibrous tissue in the control group (Fig. 7D). The regeneration tissue in the pristine bilayered scaffold group was smooth and translucent, and visible connection to the surrounding normal cartilage was observed, but the defect was still not completely filled with the regenerated tissue (Fig. 7E). Defects in the DF bilayered scaffold group were repaired with translucent tissue, which was similar to the neighbouring normal cartilage, with no apparent boundaries (Fig. 7F). Micro-CT was selected to detect the newly formed bone in the defects. After implantation for 4 weeks, a large cavity was found in the defect region, indicating the limited self-repair of subchondral bone (Fig. 8A). While partial bone repair was found in the pristine bilayered scaffold group, and the new bone was mostly regenerated around the bottom and side of defects. Notably, the defect for the DF bilayered scaffold group had the largest amount of new bone formation. At week 12, the formation of new bone increased for all the three groups, and the amount of new bone was much greater for the DF bilayered scaffold group than that for the pristine bilayered scaffold and control groups (Fig. 8A). Moreover, new bone volume (Fig. 8B) and bone density (Fig. 8C) were calculated by SkyScan CTVOX 2.1 software. The calculated results showed that the DF bilayered scaffold group showed higher bone volume and density compared with the control group and the pristine bilayered scaffold group (P < 0.05). In addition, the bone volume and density for each group


Page 14 of 34

Page 15 of 34 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


also displayed a time dependent increase. Histological analysis further verified that DF bilayered scaffold group was capable of facilitating the repair of bone and cartilage, compared to the pristine bilayered scaffold and the control groups. At week 4 (Fig. 9A-C), the defects in three groups were not completely repaired. The most new tissues were regenerated in the defect for DF bilayered scaffold group, although apparent boundary was still found between the repaired tissue and normal native cartilage. At week 12 (Fig. 9D-F), the defects for the control and pristine bilayered scaffold groups were still unfilled. While the regenerated tissue with smooth interface as the adjacent normal cartilage filled in the defect for the DF bilayered scaffold group. In addition, the repair quality in the osteochondral defect is also an important indicator and it was characterized using the Masson staining. At week 4 (Fig. 9G-I), the ECM in the defect for the DF bilayered scaffold group was positively stained, meaning the formation of new tissues. Unfortunately, apparent boundary existed between the repaired tissue and normal native cartilage, indicating the incomplete integration of regeneration tissue with the surrounding native osteochondral tissue. At week 12 (Fig. 9J-L), the filled tissue in the defect for the control group showed the obviously different staining with the surrounding tissue. Although regeneration tissue in the defect for the pristine bilayered scaffold group displayed similar staining with the surrounding tissue, distinct junction was still remained between them. Notably, the defect treated with the DF bilayered scaffold possessed the best repair quality, because almost the same staining was displayed between the regenerated tissue and surrounding tissue, and no obvious boundary was found.

4. CONCLUSION In summary, we have constructed a bilayered scaffold containing hydrogel-based cartilage layer and multi-polymer nanofibrous scaffold-based subchondral bone layer, which was integrated in biomimetic articular cartilage-subchondral bone architecture. KGN was loaded on the cartilage layer and P24 peptides were immobilized on the



Page 16 of 34

subchondral bone layer. Two different bioactive factors could be released from the corresponding layers for more than 28 days. Both the hydrogel and nanofibrous scaffold exhibit the porous structure and high interconnectivity. The cell viability assays revealed that they also showed excellent cell compatibility. The loading of KGN significantly improved the chondrogenic ability of BMSCs. Furthermore, with the

immobilization

of

P24

peptides

on

the

nanofibrous

scaffold,

osteogenesis-associated genes and proteins expression were up-regulated. Animal test results demonstrated that the bilayered scaffold with KGN and P24 peptides had the ability to simultaneously enhance the regeneration of cartilage and subchondral bone. Thus, these results indicated that the resultant bilayered scaffold might be a promising candidate for repairing osteochondral defects.

ASSOCIATED CONTENT Supporting Information The Supporting Information is available free of charge on the ACS Publications website at DOI: Contact angles of scaffolds; degradation behaviour of GSO-KGN hydrogel; histological evaluation of DF bilayered scaffolds; surgical procedures for creating an osteochondral defect model in rabbits.

AUTHOR INFORMATION Author Contributions † L.

X. Zheng and D. J. Li contributed equally to this work.

Notes The authors declare no competing financial interest.

ACKNOWLEDGMENT This work was financially supported by the National Key Research and Development Program of China (2018YFB1105600), National Natural Science


Page 17 of 34 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Foundation of China (31570984, 31771048 and 21574019), and the Fundamental Research Funds for the Central Universities (2232018A3-07).

REFERENCES (1) Du, Y. Y.; Liu, H. M.; Yang, Q.; Wang, S.; Wang, J. L.; Ma, J.; Noh, I.; Mikos, A. G.; Zhang, S. M. Selective laser sintering scaffold with hierarchical architecture and gradient composition for osteochondral repair in rabbits. Biomaterials 2017, 137, 37-48. https://doi.org/10.1016/j.biomaterials.2017.05.021 (2) Levingstone, T. J.; Ramesh, A.; Brady, R. T.; Brama, P. A. J.; Kearney, C.; Gleeson, J. P.; O'Brien, F. J. Cell-free multi-layered collagen-based scaffolds demonstrate layer specific regeneration of functional osteochondral tissue in caprine joints.

Biomaterials

2016,

87,

69-81.

https://doi.org/10.1016/j.biomaterials.2016.02.006 (3) Jia, S. J.; Wang, J.; Zhang, T.; Pan, W. M.; Li, Z.; He, X.; Yang, C. F.; Wu, Q. N.; Sun, W.; Xiong, Z.; Hao, D. J. Multilayered scaffold with a compact interfacial layer enhances osteochondral defect repair. ACS Appl. Mater. Interface 2018, 10 (24), 20296-20305. https://doi.org/10.1021/acsami.8b03445 (4) Nukavarapu, S. P.; Dorcemus, D. L. Osteochondral tissue engineering: Current strategies

and

challenges.

Biotechnol.

Adv.

2013,

31

(5),

706-721.

https://doi.org/10.1016/j.biotechadv.2012.11.004 (5) Mithoefer, K.; McAdams, T.; Williams, R. J.; Kreuz, P. C.; Mandelbaum, B. R. Clinical efficacy of the microfracture technique for articular cartilage repair in the knee an evidence-based systematic analysis. Am. J. Sport. Med. 2009, 37 (10), 2053-2063. https://doi.org/10.1177/0363546508328414 (6) Selmi, T. A. S.; Verdonk, P.; Chambat, P.; Dubrana, F.; Potel, J. F.; Barnouin, L.; Neyret, P. Autologous chondrocyte implantation in a novel alginate-agarose hydrogel - Outcome at two years. J. Bone Joint Surg. Br. 2008, 90B (5), 597-604. https://doi.org/10.1302/0301-620X.90B5.20360 (7) Niemeyer, P.; Pestka, J. M.; Kreuz, P. C.; Erggelet, C.; Schmal, H.; Suedkamp,



Page 18 of 34

N. P.; Steinwachs, M. Characteristic complications after autologous chondrocyte implantation for cartilage defects of the knee joint. Am. J. Sport. Med. 2008, 36 (11), 2091-2099. https://doi.org/10.1177/0363546508322131 (8) Haene, R.; Qamirani, E.; Story, R. A.; Pinsker, E.; Daniels, T. R. Intermediate outcomes of fresh talar osteochondral allografts for treatment of large osteochondral lesions of the talus. J. Bone Joint Surg. Am. 2012, 94A (12), 1105-1110. http://dx.doi.org/10.2106/JBJS.J.02010 (9) Benazzo, F.; Cadossi, M.; Cavani, F.; Fini, M.; Giavaresi, G.; Setti, S.; Cadossi, R.; Giardino, R. Cartilage repair with osteochondral autografts in sheep: Effect of biophysical stimulation with pulsed electromagnetic fields. J. Orthop. Res. 2008, 26 (5), 631-642. https://doi.org/10.1002/jor.20530 (10) Wu, Y.; Zhu, S. A.; Wu, C. T.; Lu, P.; Hu, C. C.; Xiong, S.; Chang, J.; Heng, B. C.; Xiao, Y.; Ouyang, H. W. A bi-lineage conducive scaffold for osteochondral defect regeneration.

Adv.

Funct.

Mater.

2014,

24

(28),

4473-4483.

https://doi.org/10.1002/adfm.201304304 (11) Galperin, A.; Oldinski, R. A.; Florczyk, S. J.; Bryers, J. D.; Zhang, M. Q.; Ratner, B. D. Integrated bi-layered scaffold for osteochondral tissue engineering. Adv. Healthc. Mater. 2013, 2 (6), 872-883. https://doi.org/10.1002/adhm.201200345 (12) Kreuz, P. C.; Steinwachs, M. R.; Erggelet, C.; Krause, S. J.; Konrad, G.; Uhl, M.; Sudkamp, N. Results after microfracture of full-thickness chondral defects in different compartments in the knee. Osteoarthr. Cartilage 2006, 14 (11), 1119-1125. https://doi.org/10.1016/j.joca.2006.05.003 (13) Tuan, R. S. A second-generation autologous chondrocyte implantation approach to the treatment of focal articular cartilage defects. Arthritis Res. Ther. 2007, 9 (5), 109. https://doi.org/10.1186/ar2310 (14) Giannoni, P.; Pagano, A.; Maggi, E.; Arbico, R.; Randazzo, N.; Grandizio, M.; Cancedda, R.; Dozin, B. Autologous chondrocyte implantation (ACI) for aged patients: development of the proper cell expansion conditions for possible therapeutic applications.

Osteoarthr.

Cartilage

2005,

https://doi.org/10.1016/j.joca.2005.02.015


13

(7),

589-600.

Page 19 of 34 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


(15) Bal, B. S.; Rahaman, M. N.; Jayabalan, P.; Kuroki, K.; Cockrell, M. K.; Yao, J. Q.; Cook, J. L. In vivo outcomes of tissue-engineered osteochondral grafts. J. Biomed. Mater. Res. B 2010, 93B (1), 164-174. https://doi.org/10.1002/jbm.b.31571 (16) Caldwell, K. L.; Wang, J. Cell-based articular cartilage repair: the link between development and regeneration. Osteoarthr. Cartilage 2015, 23 (3), 351-362. https://doi.org/10.1016/j.joca.2014.11.004 (17) Man, Z. T.; Hu, X. Q.; Liu, Z. L.; Huang, H. J.; Meng, Q. Y.; Zhang, X.; Dai, L. H.; Zhang, J. Y.; Fu, X.; Duan, X. N.; Zhou, C. Y.; Ao, Y. F. Transplantation of allogenic chondrocytes with chitosan hydrogel-demineralized bone matrix hybrid scaffold to repair rabbit cartilage injury. Biomaterials 2016, 108, 157-167. https://doi.org/10.1016/j.biomaterials.2016.09.002 (18) Yang, J. Z.; Zhang, Y. S.; Yue, K.; Khademhosseini, A. Cell-laden hydrogels for osteochondral and cartilage tissue engineering. Acta Biomater. 2017, 57, 1-25. https://doi.org/10.1016/j.actbio.2017.01.036 (19) Armiento, A. R.; Stoddart, M. J.; Alini, M.; Eglin, D. Biomaterials for articular cartilage tissue engineering: Learning from biology. Acta Biomater. 2018, 65, 1-20. https://doi.org/10.1016/j.actbio.2017.11.021 (20) Radhakrishnan, J.; Manigandan, A.; Chinnaswamy, P.; Subramanian, A.; Sethuraman, S. Gradient nano-engineered in situ forming composite hydrogel for osteochondral

regeneration.

Biomaterials

2018,

162,

82-98.

https://doi.org/10.1016/j.biomaterials.2018.01.056 (21) Gao, F.; Xu, Z. Y.; Liang, Q. F.; Liu, B.; Li, H. F.; Wu, Y. H.; Zhang, Y. Y.; Lin, Z. F.; Wu, M. M.; Ruan, C. S.; Liu, W. G. Direct 3d printing of high strength biohybrid gradient hydrogel scaffolds for efficient repair of osteochondral defect. Adv. Funct. Mater. 2018, 28 (13), 1706644. https://doi.org/10.1002/adfm.201706644 (22) Amini, A. A.; Nair, L. S. Injectable hydrogels for bone and cartilage repair. Biomed. Mater. 2012, 7 (2), 024105. https://doi.org/10.1088/1748-6041/7/2/024105 (23) Spiller, K. L.; Maher, S. A.; Lowman, A. M. Hydrogels for the Repair of Articular Cartilage Defects. Tissue Eng. Part B Rev. 2011, 17 (4), 281-299. https://doi.org/10.1089/ten.teb.2011.0077



Page 20 of 34

(24) Wang, W. Z.; Nie, W.; Zhou, X. J.; Feng, W.; Chen, L.; Zhang, Q. Q.; You, Z. W.; Shi, Q. S.; Peng, C.; He, C. L. Fabrication of heterogeneous porous bilayered nanofibrous vascular grafts by two-step phase separation technique. Acta Biomater. 2018, 79, 168-181. https://doi.org/10.1016/j.actbio.2018.08.014 (25) Wang, W. Z.; Nie, W.; Liu, D. H.; Du, H. B.; Zhou, X. J.; Chen, L.; Wang, H. S.; Mo, X. M.; Li, L.; He, C. L. Macroporous nanofibrous vascular scaffold with improved biodegradability and smooth muscle cells infiltration prepared by dual phase

separation

technique.

Int.

J.

Nanomed.

2018,

13,

7003-7018;

https://doi.org/10.2147/IJN.S183463 (26) Lam, J.; Lu, S.; Meretoja, V. V.; Tabata, Y.; Mikos, A. G.; Kasper, F. K. Generation

of

osteochondral

tissue

constructs

with

chondrogenically

and

osteogenically predifferentiated mesenchymal stem cells encapsulated in bilayered hydrogels.

Acta

Biomater.

2014,

10

(3),

1112-1123.

https://doi.org/10.1016/j.actbio.2013.11.020 (27) Johnson, K.; Zhu, S. T.; Tremblay, M. S.; Payette, J. N.; Wang, J. N.; Bouchez, L. C.; Meeusen, S.; Althage, A.; Cho, C. Y.; Wu, X.; Schultz, P. G. A stem cell-based approach

to

cartilage

repair.

Science

2012,

336

(6082),

717-721.

https://doi.org/10.1126/science.1215157 (28) Li, X. Z.; Ding, J. X.; Zhang, Z. Z.; Yang, M. D.; Yu, J. K.; Wang, J. C.; Chang, F.; Chen, X. S. Kartogenin-incorporated thermogel supports stem cells for significant cartilage regeneration. ACS Appl. Mater. Interface 2016, 8 (8), 5148-5159. https://doi.org/10.1021/acsami.5b12212 (29) Kang, M. L.; Ko, J. Y.; Kim, J. E.; Im, G. I. Intra-articular delivery of kartogenin-conjugated chitosan nano/microparticles for cartilage regeneration. Biomaterials

2014,

35

(37),

9984-9994.

https://doi.org/10.1016/j.biomaterials.2014.08.042 (30) Ono, Y.; Ishizuka, S.; Knudson, C. B.; Knudson, W. Chondroprotective effect of kartogenin on cd44-mediated functions in articular cartilage and chondrocytes. Cartilage 2014, 5 (3), 172-180. https://doi.org/10.1177/1947603514528354 (31) David, L.; Feige, J. J.; Bailly, S. Emerging role of bone morphogenetic proteins


Page 21 of 34 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


in

angiogenesis.

Cytokine

Growth

F.

R.

2009,

20

(3),

203-212.

https://doi.org/10.1016/j.cytogfr.2009.05.001 (32) Zhou, X. J.; Feng, W.; Qiu, K. X.; Chen, L.; Wang, W. Z.; Nie, W.; Mo, X. M.; He, C. L. BMP-2 derived peptide and dexamethasone incorporated mesoporous silica nanoparticles for enhanced osteogenic differentiation of bone mesenchymal stem cells.

ACS

Appl.

Mater.

Interface

2015,

7

(29),

15777-15789.

https://doi.org/10.1021/acsami.5b02636 (33) Lu, Y.; Lee, J. S.; Nemke, B.; Graf, B. K.; Royalty, K.; Illgen, R.; Vanderby, R.; Markel, M. D.; Murphy, W. L. Coating with a modular bone morphogenetic peptide promotes healing of a bone-implant gap in an ovine model. PLos One 2012, 7 (11), 50378. https://doi.org/10.1371/journal.pone.0050378 (34) Zhou, J.; Guo, X. D.; Zheng, Q. X.; Wu, Y. C.; Cui, F. Z.; Wu, B. Improving osteogenesis of three-dimensional porous scaffold based on mineralized recombinant human-like collagen via mussel-inspired polydopamine and effective immobilization of

BMP-2-derived

peptide.

Colloid.

Surface.

B

2017,

152,

124-132.

https://doi.org/10.1016/j.colsurfb.2016.12.041 (35) Pan, H. T.; Zheng, Q. X.; Guo, X. D.; Wu, Y. C.; Wu, B. Polydopamine-assisted BMP-2-derived peptides immobilization on biomimetic copolymer scaffold for enhanced bone induction in vitro and in vivo. Colloid. Surface. B 2016, 142, 1-9. https://doi.org/10.1016/j.colsurfb.2016.01.060 (36) Lee, H.; Rho, J.; Messersmith, P. B. Facile conjugation of biomolecules onto surfaces via mussel adhesive protein inspired coatings. Adv. Mater. 2009, 21(4), 431-434. https://doi.org/10.1002/adma.200801222 (37) Raia, N. R.; Partlow, B. P.; McGill, M.; Kimmerling, E. P.; Ghezzi, C. E.; Kaplan, D. L. Enzymatically crosslinked silk-hyaluronic acid hydrogels. Biomaterials 2017, 131, 58-67. https://doi.org/10.1016/j.biomaterials.2017.03.046 (38) Yan, L. P.; Oliveira, J. M.; Oliveira, A. L.; Caridade, S. G.; Mano, J. F.; Reis, R. L. Macro/microporous silk fibroin scaffolds with potential for articular cartilage and meniscus tissue engineering applications. Acta Biomater. 2012, 8 (1), 289-301. https://doi.org/10.1016/j.actbio.2011.09.037



Page 22 of 34

(39) Zhao, X.; Li, P.; Guo, B. L.; Ma, P. X. Antibacterial and conductive injectable hydrogels based on quaternized chitosan-graft-polyaniline/oxidized dextran for tissue engineering.

Acta

Biomater.

2015,

26,

236-248.

https://doi.org/10.1016/j.actbio.2015.08.006 (40) Hu, X. X.; Wang, Y. L.; Tan, Y. N.; Wang, J.; Liu, H. Y.; Wang, Y. Q.; Yang, S.; Shi, M. S.; Zhao, S. Y.; Zhang, Y. F.; Yuan, Q. A difunctional regeneration scaffold for knee repair based on aptamer-directed cell recruitment. Adv. Mater. 2017, 29 (15), 1605235. https://doi.org/10.1002/adma.201605235 (41) Jiang, X. Q.; Zhao, J.; Wang, S. Y.; Sun, X. J.; Zhang, X. L.; Chen, J.; Kaplan, D. L.; Zhang, Z. Y. Mandibular repair in rats with premineralized silk scaffolds and BMP-2-modified

bMSCs.

Biomaterials

2009,

30

(27),

4522-4532.

https://doi.org/10.1016/j.biomaterials.2009.05.021 (42) Zhao, X. Y.; Han, Y.; Li, J. W.; Cai, B.; Gao, H.; Feng, W.; Li, S. Q.; Liu, J. G.; Li, D. S. BMP-2 immobilized PLGA/hydroxyapatite fibrous scaffold via polydopamine stimulates osteoblast growth. Mater. Sci. Eng. C 2017, 78, 658-666. https://doi.org/10.1016/j.msec.2017.03.186 (43) Ye, K. Q.; Liu, D. H.; Kuang, H. Z.; Cai, J. Y.; Chen, W. M.; Sun, B. B.; Xia, L. G.; Fang, B.; Morsi, Y.; Mo, X. M. Three-dimensional electrospun nanofibrous scaffolds displaying bone morphogenetic protein-2-derived peptides for the promotion of osteogenic differentiation of stem cells and bone regeneration. J. Colloid Interf. Sci. 2019, 534, 625-636. https://doi.org/10.1016/j.jcis.2018.09.071


Page 23 of 34 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Figures

Scheme 1. Schematic illustration of the bilayered scaffold loaded with kartogenin and BMP-2-derived peptides for osteochondral repair.



Figure 1. Gross appearance of (A) GSO-KGN hydrogel, (B) NF-P24 scaffold and (C) DF bilayered scaffold. SEM images of (D) GSO-KGN hydrogel, (E) NF-P24 scaffold and (F) DF bilayered scaffold. The inset in (E) represents the magnifying image.


Page 24 of 34

Page 25 of 34 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Figure 2. Release kinetics of RhB (A, KGN model drug) from GSO-RhB hydrogels and P24 peptides (B) from NF-P24 nanofibrous scaffolds with PDA assisted immobilization and without PDA assisted immobilization. Data are expressed as means ± SD (n = 3).



Figure 3. Proliferation of BMSCs cultured on TCP, GSO hydrogels, GSO-KGN hydrogels (A), NF scaffolds and NF-P24 scaffolds (B) for 1, 3 and 5 days. (*P < 0.05, **P < 0.01)


Page 26 of 34

Page 27 of 34 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Figure 4. Cartilage relative proteins expressions (A) within BMSCs cultured on GSO hydrogels and GSO-KGN hydrogels for 21 days and cartilage genes expressions (B) within BMSCs cultured on GSO hydrogels and GSO-KGN hydrogels for 7 and 14 days. (*P < 0.05, **P < 0.01)



Figure 5. The ALP activity of BMSCs cultured on NF scaffolds and NF-P24 scaffolds for 7 and 14 days. (*P < 0.05)


Page 28 of 34

Page 29 of 34 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Figure 6. Bone relative proteins (A) expressions within BMSCs cultured on NF scaffolds and NF-P24 scaffolds for 21 days and bone relative genes (B) within BMSCs cultured on NF scaffolds and NF-P24 scaffolds for 7 and 14 days. (*P < 0.05, **P < 0.01)



Figure 7. Macro-photographes of rabbit osteochondral defects after implanted with (A, D) the control group, (B, E) the pristine bilayered scaffold group, and (C, F) the DF bilayered scaffold group for (A-C) 4 and (D-F) 12 weeks.


Page 30 of 34

Page 31 of 34 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Figure 8. 3D reconstruction images (A), bone volume (B) and bone density (C) of the control group, the pristine bilayered scaffold group, and the DF bilayered scaffold group. (* P < 0.05)



Figure 9. H&E (A-F) and Masson (G-L) staining images of samples after implantation for 4 and 12 weeks (scale bar = 1 mm).


Page 32 of 34

Page 33 of 34 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Table 1 Primer sequences used for RT-qPCR.

Gene

Primer sequence

Aggrecan

5’-CCTGGACAAGTGCTATGCTGG-3’ 5’-GCACCACTGACACACCTCGGA-3’

SOX9

5’-AGGGTTAAAGTGCCACAGAGGA-3’ 5’-AATGCTTTTCTGGTTCTTGGAGG-3’

COL2

5’-ACGCTCAAGTCGCTGAACAAC-3’ 5’-CCAGTAGTCTCCGCTCTTCCA-3’

COL1

OCN

RUNX2

OPN

GADPH

5' -TCAAGATGGTGGCCGTTACT -3' 5'- CATCTTGAGGTCACGGCATG -3' 5'- AATAGACTCCGCGCTACCTC-3' 5'- GCTAGCTCGTCACAATTGGG- 3' 5'- ACGTACCCAGGCGTATTTCA -3' 5' -GCTGGATAGTGCATTCGTGG- 3' 5' -AGCCATGAGTCAAGTCAGCT -3' 5' -ACTCGCCTGACTGTCGATAG -3' 5'-CAAGTTCAACGGCACAGTCA- 3' 5'- CCCCATTTGATGTTAGCGGG -3'



Page 34 of 34

For Table of Contents Use Only

Bilayered

Scaffold

Prepared

from

Kartogenin

Loaded

Hydrogel

and

BMP-2-derived Peptides Loaded Porous Nanofibrous Scaffold for Osteochondral Defect Repair

Lixia Zheng,†,‡ Dejian Li,†,§ Weizhong Wang,‡ Qianqian Zhang,‡ Xiaojun Zhou,‡ Dinghua Liu,‡ Jingtian Zhang,‡ Zhengwei You,⊥ Jundong Zhang,*,# Chuanglong He*,‡


Bilayered Scaffold Prepared from Kartogenin Loaded Hydrogel and

Recommend Documents