Binding Mechanism of the Farnesoid X Receptor Marine Antagonist

Article pubs.acs.org/jmc

Binding Mechanism of the Farnesoid X Receptor Marine Antagonist Suvanine Reveals a Strategy To Forestall Drug Modulation on Nuclear Receptors. Design, Synthesis, and Biological Evaluation of Novel Ligands Francesco Saverio Di Leva,†,∥ Carmen Festa,‡,∥ Claudio D’Amore,§,∥ Simona De Marino,‡ Barbara Renga,§ Maria Valeria D’Auria,‡ Ettore Novellino,‡ Vittorio Limongelli,*,‡ Angela Zampella,*,‡ and Stefano Fiorucci*,§ †

Department of Drug Discovery and Development, Istituto Italiano di Tecnologia, via Morego 30, 16163 Genova, Italy Dipartimento di Farmacia, Università di Napoli “Federico II”, Via D. Montesano 49, I-80131 Napoli, Italy § Dipartimento di Medicina Clinica e Sperimentale, Nuova Facoltà di Medicina e Chirurgia, Università di Perugia, Via Gerardo Dottori 1, S. Andrea delle Fratte, 06132 Perugia, Italy ‡

S Supporting Information *

ABSTRACT: Here, we report suvanine, a marine sponge sesterterpene, as an antagonist of the mammalian bile acid sensor farnesoid-X-receptor (FXR). Using suvanine as a template, we shed light on the molecular bases of FXR antagonism, identifying the essential conformational changes responsible for the transition from the agonist to the antagonist form. Molecular characterization of the nuclear corepressor NCoR and coactivator Src-1 revealed that receptor conformational changes are associated with a specific dynamic of recruitment of these cofactors to the promoter of OSTα, a FXR regulated gene. Using suvanine as a novel hit, a library of semisynthetic derivatives has been designed and prepared, leading to pharmacological profiles ranging from agonism to antagonism toward FXR. Deep pharmacological evaluation demonstrated that derivative 19 represents a new chemotype of FXR modulator, whereas alcohol 6, with a simplified molecular scaffold, exhibits excellent antagonistic activity.

■

“lid” and closes the ligand-binding pocket,7 adopting a conformation competent for the recruitment of coactivators and thus enhancing the expression of target genes.8 On the other hand, it was supposed that in the presence of an antagonist, the AF-2 helix adopts an orientation not suitable for coactivator binding, thus leading to transcriptional silencing.9 It is interesting to note that although the LBD shows a low sequence homology across the NRs family, its secondary structure is rather conserved, particularly in the C-terminal region where the AF-2 helix is located.10 This aspect would suggest a similar functional mechanism for all of the members of the NRs superfamily, whereas each receptor might establish specific interactions with its agonist/antagonist ligands. On this background, understanding at molecular level the NRs conformational changes occurring upon agonist and antagonist binding, is of great help in the design of compounds able to selectively modulate their activity, thus having specific effects on metabolic pathways.

INTRODUCTION Nuclear receptors (NRs) are a superfamily of ligand-dependent transcription factors that mediate the effects of hormones and other endogenous small molecules to regulate the expression of specific genes. NRs are made of five main functional domains. Among these, the DNA binding domain is highly conserved across the NRs superfamily while there is a considerable variability for the other domains.1−3 The activity of these receptors can be modulated by endogenous and exogenous molecules that bind to the ligand-binding activation function 2 (AF-2) domain (LBD).4 To date, an exhaustive description of the functional mechanism of these receptors is still missing. However, it is widely accepted that upon ligand binding, the NRs activity is modulated through conformational changes at the LBD. These transitions change the affinity of NRs for partner peptides, namely coactivators and corepressors, thus increasing or decreasing the transcriptional activity of target genes.5 In fact, rearrangements of the AF-2 helix located at the C-terminal of the LBD are supposed to mediate the interactions of NRs with coactivator peptides.6 In particular, in the agonist-bound conformation, the AF-2 helix works as a © 2013 American Chemical Society

Received: March 21, 2013 Published: May 8, 2013 4701

dx.doi.org/10.1021/jm400419e | J. Med. Chem. 2013, 56, 4701−4717

Journal of Medicinal Chemistry

Article

Figure 1. FXR transactivation assay performed on HepG2 cells transfected with pSG5-FXR, pSG5-RXR, pCMV-βgal, and p(hsp27)TKLUC vectors, stimulated 24 h post transfection with (A) CDCA 10 μM, 1 10 μM, and with a combination of CDCA 10 μM plus 1 50 μM or (B,C) with increasing doses of 1 (1, 10, and 50 μM) in combination with CDCA 10 μM. Real-time PCR analysis of (D) OSTα, (E) SHP, and (F) CYP7α1 performed on HepG2 cells treated with CDCA 10 μM, 1 10 μM, and CDCA 10 μM plus 1 50 μM. *p < 0.05 vs NT; #p < 0.05 vs CDCA. Chromatin immunoprecipitation assay carried out to detect the interaction of FXR, Src-1, and NCoR with the OSTα promoter (G). HepG2 cells were stimulated with 6-ECDCA 5 μM alone or in combination with 1 15 μM for 18 h.

acids.18 These findings have raised the notion that FXR antagonists might be useful in the treatment of liver disorders in those settings in which bile secretion is impaired (i.e., cholestasis). To date, only few FXR antagonists are known and the main contribution is derived from terrestrial and marine natural compounds.19 Guggulsterone, isolated from the resin extract of the tree Commiphora mukul, and xanthohumol, the principal prenylated chalcone from beer hops, were the first FXR antagonists to be reported from “Nature”.20−22 However, guggulsterone is a promiscuous agent which binds and activates the pregnane-X-receptor and glucocorticoid receptor at concentrations that are approximately 100-fold lower than that required for FXR antagonism.23 In this context, the sea, with its extraordinary variety of organisms and symbiotics, has recently emerged as an invaluable source of FXR ligands.24 Indeed, as the result of

Among NRs, the farnesoid-X-receptor (FXR) is the bile acid sensor in enterohepatic tissues where it regulates the expression of transporters and biosynthetic enzymes crucial for the physiological maintenance of bile acids (BAs) homeostasis.11−14 FXR shows the typical structural features of the metabolic NRs superfamily and binds to specific DNA responsive elements in complex with the retinoic-X-receptor (RXR). Upon agonist binding, FXR undergoes to a conformational change favoring the release corepressors such as nuclear co-repressor (NCoR) and enhancing the recruitment of coactivators such as steroid receptor coactivator-1 (Src-1)6 and others.15 Shortly after its discovery, potent and selective FXR agonists have been generated to target liver and metabolic disorders.16,17 However, hepatic FXR activation leads to a complex response that integrates beneficial actions and potentially undesirable side effects. Among these, there are the inhibition of BAs synthesis and basolateral efflux of bile 4702



Article

Figures 1D−F, we found that the exposure of HepG2 cells to suvanine (1), per se, did not alter the expression of canonical FXR target genes such as OSTα and SHP, while it was as effective as CDCA in reducing CyP7α1 mRNA. Further on, when administered in combination with CDCA, suvanine (1) exerted an antagonistic effect on the expression of OSTα and SHP, while a further reduction in the expression of CyP7α1 was observed (Figure 1F). Taken together, these data illustrate that suvanine behaves as a full FXR antagonist. Computational Studies. To shed light on the binding mechanism of FXR ligands, computational studies were performed on this receptor in complex with the agonist 6ECDCA and the antagonist suvanine. First, we carried out molecular docking calculations that represent the fastest way to describe ligand/protein interactions. Then, molecular dynamic (MD) simulations were carried out to identify the major receptor conformational changes responsible for the transition from the agonist to the antagonist form. Docking Calculations on 6-ECDCA/FXR and Suvanine/ FXR Complexes. To date, several crystal structures of the FXR-LBD in complex with agonists including 6-ECDCA have been reported.35−45 On the other hand, no structural information are available on the binding mode of FXR antagonists. Thus, we selected the crystal of the FXR-LBD from Rattus norvegicus (rFXR) in complex with 6-ECDCA and the GRIP-1 coactivator peptide, NID-3 (PDB 1osv),36 for docking studies on both 6-ECDCA and suvanine using AutoDock4.2 (AD4.2).46 The sequence of rFXR-LBD shares the 95% of homology with that of the human FXR-LBD (hFXR-LBD), with all of the residues in the ligand binding pocket conserved among the two species.36 First, we docked 6ECDCA in its cocrystallized receptor to check the reliability of the docking approach on this target. AD4.2 successfully reproduced the experimental pose as the best ranked solution, with a ligand rmsd of 0.54 Å (Figure S24A in the Supporting Information). It is worth mentioning that 6-ECDCA stabilizes a cation−π interaction between the protonated His444 on helix H11 and Trp466 on helix H12 in the AF-2 domain. This interaction is supposed to act as a trigger for FXR activation allowing helices H3, H4, H11, and particularly H12 to adopt a conformation competent for the binding of coactivator peptides.36 Docking simulations on the suvanine/FXR complex showed that the ligand occupies the LBD similarly to 6-ECDCA, although few differences in the interaction pattern can be found (Figure S24B in the Supporting Information). In particular, suvanine occupies the cavity formed by H3, H5, H6, H7, H11, and H12 (Figure 2), with its terpenoid scaffold forming favorable interactions with the side chains of Leu284, Ala288, Met325, Ile332, and Leu345. Moreover, the furane moiety fits into this hydrophobic pocket where it engages a number of interactions with the side chains of Phe326, Phe333, Ile349, Ile354, Tyr358, Met362, and Phe363. On the other side, the sulfate group H-bonds with the Tyr358 side chain and is involved in a salt bridge interaction with the positively charged side chain of His444 on H12. MD Simulations on 6-ECDCA/FXR and Suvanine/FXR Complexes. As reported in the previous section, in the receptor agonist-bound conformation the position of H12, which is important for coactivator binding, is strongly stabilized by the cation−π interaction between His444 and Trp466. Therefore, it might be suggested that ligands able to interfere with such interaction might destabilize H12, thus displaying an

millions of years of evolution and natural selection, the marine ecosystem represents an immeasurable source of chemical entities with extraordinary chemodiversity.25 In this frame and in the course of our long-standing interest in bioactive molecules from marine invertebrates, we had the opportunity to identify several compounds endowed with promising activity on human nuclear receptors, encompassing sulfated steroids from echinoderms26 and porifera,27 4-methylene steroids from Theonella swinhoei.28,29 Within these rich libraries of marine derivatives, we have identified theonellasterol as the first example of natural selective FXR antagonist,30 demonstrating its pharmacological potential in the treatment of cholestasis in rodent models where theonellasterol attenuates liver injury and the extent of liver necrosis caused by bile duct ligation. Here we report the identification of suvanine (Figure 1), a furano sesterterpene sulfate from the marine sponge Coscinoderma mathewsi,31,32 as a novel FXR antagonist. Using extensive computations on FXR in complex with 6-αethylchenodeoxycholic acid (6-ECDCA), a well-known semisynthetic agonist,33 and suvanine (1), we have disclosed the major receptor conformational changes responsible for the transition from the active to the inactive state, defining for the first time the “antagonistic conformation” of this nuclear receptor. This model of antagonism has been validated through chromatin immunoprecipitation (ChIP) experiments showing, in the presence of suvanine, an alteration in the recruitment of the coactivator Src-1 on the promoter of the FXR target gene OSTα and through the design and the synthesis of a small library of semisynthetic derivatives. Biochemical decodification of 25 analogues allowed us to identify several FXR ligands with simplified chemical scaffolds and potent biological activity and to develop a structure−activity relationship that discloses the molecular requisites for FXR binding. This study provides crucial information for the development of novel and potent FXR modulators, able to selectively activate or repress subgroups of target genes and therefore endowed with reduced side effects.

■

RESULTS Suvanine Is a FXR Antagonist. While sesterterpenoids (C25 terpenes) are common in marine sponges, furanosesterterpene sulfates are rare. Among these, tricyclic suvanine (Figure 1), largely present in the marine sponges of the genus Coscinoderma, shows distinctive and unusual structural features such as the uncommon enol-sulfate group and the furane moiety at the terminus of its linear side chain.31,32 Suvanine (1), isolated in our laboratories from a Solomon collection of the sponge Coscinoderma mathewsi,34 was first tested in vitro by using an hepatocarcinoma cell line (HepG2) transiently transfected with FXR, RXR, β-galactosidase expression vectors (pSG5FXR, pSG5RXR, and pCMV-βgal) and with the p(hsp27)TKLUC reporter vector that contains the promoter of the FXR target gene, heat shock protein 27 (hsp27), cloned upstream of the luciferase gene. As shown in Figure 1A, stimulation of HepG2 cells with 10 μM suvanine failed to activate FXR in a transactivation assay. By contrast, suvanine (1) effectively antagonized FXR transactivation induced by chenodeoxycholic acid (CDCA) (Figure 1A). As shown in parts B and C of Figure 1, this effect was concentrationdependent and the relative EC50 was ≈24 μM. To further characterize its antagonistic behavior, we have then examined the effect of suvanine on the expression of canonical FXR target genes in HepG2 cells. As shown in 4703



Article

complex using MD simulations, however achieved within shorter time scale.48 Suvanine/FXR. During the MD simulation performed on the suvanine/FXR complex, the ligand gradually left the starting conformation assuming a slightly different binding mode at 50 ns, which was conserved for the rest of the simulation (Figure 3B,D). The major difference with respect to the docking conformation resides in the interactions established by the negatively charged sulfate group. In particular, the sulfate group engages a number of water-mediated H-bonds with the side chains of Tyr358, Tyr366, and Asn441. Furthermore, it is placed in between His444 and Trp466 H-bonding with their side chains and thus breaking the native cation−π interaction. This induces a rearrangement of H12 which assumes a conformation unsuitable for the binding of the coactivator peptide (Figure 4). In fact, most of the residues in H12, that are involved in the coactivator binding, change their position with respect to the agonist-bound conformation. In particular, Asp467 assumes an inner position stabilized by an ionic bond with the charged His444 side chain, whereas in the agonistbound conformation it engages a salt-bridge with Lys318 on H4 and H-bonds with the coactivator peptide (Figure 4A). Also, Leu461 and Ile465 adopts an inner position in the suvanine/ FXR complex forming favorable contacts with Val292 and Val322, respectively (Figure 4B). Thus, these residues are unable to engage hydrophobic interactions with the coactivator peptide. Finally, while in the FXR agonist conformation, Glu464 is solvent exposed and is involved in the H-bond network with the coactivator, in the suvanine/FXR complex, it is shifted inward, forming a salt-bridge with the side chain of Lys318. In this new orientation, the glutamate residue is not available to form the H-bond network with the coactivator peptide (Figure 4A). Because of all these changes, the FXR binding affinity for the coactivator peptide is reduced. These results highlight the importance of the H-bond network made by Lys318, Glu464, and Asp467 in determining the different FXR conformations. Thus, our model fully agrees with that based on experiments invoking a “charge clamp” mechanism at the base of the NRs activation.49 In particular, the “charge clamp” consists in a number of H-bonds established between a lysine residue on H3, a glutamic acid residue on H12, and the coactivator backbone residues.50 These interactions fix the coactivator peptide into the shallow hydrophobic cleft shaped by helices H3, H4, and AF-2, thus stabilizing the NR active conformation.51,52 It is worth noting that both the Lys and Glu residues are highly conserved among the NRs.10 Furthermore, mutations of these residues can prevent the interaction of NRs with coactivator peptides, thus silencing both the basal and ligand-activated transcriptional activity.52−54 ChIP Assays. To further confirm the MD results, we performed chromatin immunoprecipitation (ChIP) experiments, treating HepG2 cells with 6-ECDCA alone or in combination with suvanine. As shown in Figure 1G, ChIP assay revealed a constitutive binding of FXR and Src-1 and a weak binding of NCoR to the OSTα promoter in not treated cells. Upon 6-ECDCA treatment, we found no change in terms of FXR/Src-1 complex bound to the OSTα promoter, while a marked decrease in NCoR binding was observed. In these conditions, the transcription of the OSTα gene should be induced, as confirmed by the results of RT-PCR performed in HepG2 cells with specific primers for the OSTα gene (Figure 1D). The concomitant stimulation with 6-ECDCA and suvanine significantly reduced the percentage of FXR/Src-1

Figure 2. Ligand binding site within the FXR-LBD. Structure of the FXR-LBD (PDB 1osv) in complex with suvanine (1) represented as cyan sticks and transparent surface. FXR is shown as orange (H3, H4, and H12) and gray cartoons.

antagonist or modulator activity. Unfortunately, this kind of motion cannot be taken into account by docking methods that consider the target as rigid. Nevertheless, our docking results have shown that suvanine interacts with His444 and might interfere with the interactions networks involving residues of the AF-2 domain. To further investigate this hypothesis, we decided to step up the computational strategy using all-atom MD simulations to take into account the full protein flexibility and the solvent role. Thus, over 100 ns, long MD simulations were performed on the complexes of 6-ECDCA and suvanine with FXR. 6-ECDCA/FXR. In the first case, the starting docking conformation adopted by 6-ECDCA is conserved for the whole simulation (Figure 3A,C). However, the presence of water molecules causes slight changes in the ligand/protein interaction pattern observed in the crystal structure. In particular, the carboxylate group of 6-ECDCA is further stabilized by waters in its interaction with Arg328. Moreover, two water-mediated interactions between the α-oriented hydroxyl group at C-7 of 6-ECDCA and the backbone of the Tyr358 and the His444 imidazole ring are formed. Thus, at variance with the X-ray structure, the Tyr358 side chain does not interact with the ligand and rotates toward the solvent. It is worth noting that similar conformations of the Tyr358 side chain can be found in many crystal structures of FXR in complex with agonist compounds.35,37,39−44 Finally, His444 is involved in a water bridge interaction with the backbone of Trp466, which further stabilizes the receptor agonist state. This simulation has shown the important role played by waters during ligand binding and similar functional roles have been reported also in other docking studies.47 Our results are in line with those reported in a previous study on the 6-ECDCA/FXR 4704



Article

Figure 3. MD simulations on 6-ECDCA/FXR and suvanine/FXR complex. (A) Binding mode of 6-ECDCA (green sticks) within the FXR-LBD after 100 ns MD; (B) binding mode of suvanine (1) (cyan sticks) within the FXR-LBD after 100 ns MD; (C) rmsd of the heavy atoms of 6-ECDCA relative to the ligand coordinates at the beginning of the simulation; (D) rmsd of the heavy atoms of 1 relative to the initial MD frame (black line) and to the average conformation obtained along the simulation (red line). The rmsd values are calculated aligning the secondary structural elements of the FXR-LBD. (A,B) FXR is shown as orange (H3, H4, and H12) and gray cartoons. Amino acids involved in ligand binding are shown as orange sticks, and waters that engage stable interactions along the simulation are displayed as spheres. Hydrogens are omitted for clarity.

Figure 4. FXR/Src-1 interaction upon agonist and antagonist binding. Superimposition of the FXR-LBD conformations found in complex with 1 after 100 ns MD simulation (orange cartoon and labels) and in complex with the agonist MFA-1 (silver cartoon and labels) and the coactivator Src-1 (magenta) as found through X-ray (PDB 3bej). (A,B) Polar and hydrophobic amino acids, respectively, involved in the coactivator binding. Hydrogens, suvanine (1) and MFA-1 are omitted for clarity.

4705



Article

Scheme 1. Synthesis of the C13-Modified Analogues and of the Suvanine Pentacyclic Derivativesa

Reagents and conditions: (a) dioxane/pyridine, 90 °C, argon atmosphere, 3 h; (b) NaBH4, absolute MeOH, 0 °C, overnight; (c) 2-methy-2-butene, KH2PO4, NaClO2, t-BuOH:H2O 4:1, rt, 4 h; (d) dioxane/pyridine, 90 °C, 3 h, then MeOH. a

be generated via nucleophilic attack of the highly reactive enolsulfate group to an oxygen molecule with formation of an αperoxy aldehyde intermediate (Figure S25 in the Supporting Information), easily oxidized to the corresponding carboxylic acid. Thermal decarboxylation of the so generated α-peroxy carboxylic acid could afford the observed derivative 5. To confirm this hypothesis, an open air solvolysis (pyr/dioxane, 90 °C) of a suvanine sample was performed. The reaction mixture was analyzed by HPLC and the relative composition of the products was compared with the corresponding one from the solvolysis under argon atmosphere (Figure S25 in the Supporting Information). The considerable increasing of derivative 5 in the open air reaction conditions clearly confirms the role of the molecular oxygen in promoting an oxidative degradation process. In agreement with the steric influence played by Me-23, sodium borohydride treatment on 5 proceeded in a stereoselective manner, affording the exclusive formation of 13αhydroxyl derivative (6) as judged by the shape of H-13 as a broad singlet which is consistent with an equatorial disposition for this proton and therefore with the axial α-orientation of the hydroxyl group on ring C. This was confirmed by the strong downfield shift exhibited by Me-23 (δH 1.02 in 6, δH 0.77 in 5) caused by the 1,3-diaxial relationship with the hydroxyl group at C-13. As depicted in the Scheme 1, hydrolytic treatment of suvanine (1) also allowed us to obtain aldehyde 7, epimeric at position-13 with respect to the parent aldehyde 2, and two minor compounds (8 and 9) with a scalarane-type sesterterpene skeleton, and previously reported as natural derivatives from a Coscinoderma Micronesia collection.56 Sodium borohydride reduction on 9 afforded alcohol 10 in good yield. Even if obtained in very small amounts, 8, 9, and 10 were judged to be helpful for a complete SAR study on the role played by the entire suvanine molecular scaffold in the FXR binding activity (see below). Unfortunately, the scarce amount of aldehyde 7 obtained in this condition, as well as the impossibility to get a pure sample, free from the contamination of the parent 2, hampered any further chemical speculation at this stage of our protocol. Finally enol-ether derivative 11 and the acetal 12 were prepared by MeOH quenching of a small aliquot of suvanine hydrolytic mixture to explore the pharmacophoric role of a hydrogen bond donor/acceptor as well as a negative appendage at position-13 in the FXR-LBD (Scheme 1). Moreover aldehyde 2 represents a good starting point for the preparation of carboxyl-bearing elongated derivatives useful to

complex bound to the OSTα promoter, while it has not changed the quote of NCoR bound to the chromatin. In these conditions, the transcription of the OSTα promoter should be reduced, as confirmed by the results of RT-PCR shown in Figure 1D. All together these experiments demonstrated that suvanine might act as an FXR antagonist by precluding the formation of an FXR/Src-1 mediated-transcription activation complex. Medicinal Chemistry on Suvanine. To further validate our models and to elucidate the molecular requisites of ligands with agonist and antagonist profiles on FXR, we developed a series of suvanine derivatives. There are two points for chemical modification in the suvanine structure: (i) the exocyclic enolsulfate group at position-13 and (ii) the furane moiety at position-16 of the linear side chain. In particular, the sulfate group was substituted with functional groups such as carboxylic and hydroxyl groups that should preserve the ability to interact with residues like Tyr358 and the His443. Furthermore, different lengths of the carbon chain at position-13 have been explored to fully investigate the conformational space available at the binding site. Apart from planned SAR studies, the chemical modification meets the specific demand to improve metabolic stability and be devoid of toxic effects associated with the presence of two highly reactive functional groups. For instance, enol-sulfate could undergo to hydrolytic generation of an aldehyde whose reactivity and possible toxicity is wellknown. On the other hand, the predominant biotransformation pathway of the furan moiety involves ring scission to α,βunsaturated dicarbonyl metabolites acting as Michael acceptors in dangerous covalent bindings to proteins and DNA.55 Modification at the Enol-sulfate Group. Solvolysis of the enol-sulfate group in a mixture of pyridine and dioxane (90 °C under argon atmosphere) proceeded with the formation of a mixture that was efficiently separated by HPLC (Scheme 1). The main product (70%) was aldehyde 2 whose stereochemical characterization was based on the large coupling constant H13/H-14 (9.5 Hz), pointing toward their trans diaxial relationship and therefore implying the β-orientation of the formyl group at position-13. NaBH4 reduction and mild sodium chlorite oxidation afforded alcohol 3 and carboxylic acid 4, respectively. Surprisingly, in this condition also compound 5 was obtained, in which the presence of a ketone functionality at position-13 was easily inferred from NMR analysis, i.e., δC 216.9 C-13, δH 2.77 d (9.3 Hz) H-14 (for detailed NMR assignments, see Table S2 in the Supporting Information). This derivative, with one carbon less with respect to suvanine, could 4706



Article

Scheme 2. Synthesis of the C13-Elongated Side Chain Modified Suvanine Derivativesa

Reagent and conditions: (a) dioxane/pyridine, 90 °C, argon atmosphere, 3 h; (b) TEPA, LiOH, THF dry, reflux, 10 h; (c) LiOH, MeOH:H2O 3:1, 0 °C, overnight; (d) NaBH4, absolute MeOH, 0 °C, overnight; (e) NaBH4 excess, absolute MeOH, 0 °C, 24 h.

a

Scheme 3. Synthesis of the Terminal Furane Ring-Modified Analoguesa

Reagent and conditions: (a) H2, Pd(OH)2 Degussa type, MeOH dry, rt, 15 min; (b) O3, CH2Cl2 dry, −78 °C, 10 min, then DMS in excess, 3 h; (c) CH2N2 ethereal solution, 0 °C, 10 min, quantitative yield; (d) AcO2, pyridine, rt, overnight, quantitative yield. a

Figure 5. FXR transactivation assay. Twenty-four h post transfection with pSG5-FXR, pSG5-RXR, pCMV-βgal, and p(hsp27)TKLUC vectors, HepG2 cells were primed with CDCA 10 μM and compounds 1−6 and 8−26 10 μM for 18 h; *p < 0.05 vs NT.

Chemoselective hydrogenation of the side-chain double bond on different catalysts (Pt/C, Pd(OH)2 Degussa type, PtO2) failed, producing invariably the concomitant reduction of the furane ring. Alternative reduction of the ethyl ester 15 with NaBH4 in dry MeOH to obtain methyl ester 17 followed by LiOH hydrolysis to carboxylic acid 18 was found to proceed smoothly. Prolonged hydride handling on an additional aliquot of 17 gave exhaustive reduction, affording alcohol 19 in 71% yield. Modification on the Furane Side Chain. Catalytic hydrogenation (Pd(OH)2 Degussa type, MeOH dry) of suvanine afforded 20 and 21, epimeric at position-17 of the

explore the role of a carboxyl group in the C13 side chain for the interaction in FXR-LBD. Horner C2 homologation on pure compound 2 led to ethyl ester 15 whose stereochemical assignment as depicted in Scheme 2 was substantiated by NMR analysis (Table S4 in the Supporting Information) and chemical correlation with the starting material. When Horner homologation was performed on the crude solvolysis reaction mixture of suvanine, the epimeric ethyl ester 13 was also obtained as a minor compound, and the two esters 15 and 13 were efficiently separated by HPLC. Lithium hydroxide treatment gave the desired conjugated carboxyl acids 16 and 14, respectively. 4707



Article

Figure 6. FXR transactivation assay. Twenty-four h post transfection with pSG5-FXR, pSG5-RXR, pCMV-βgal, and p(hsp27)TKLUC vectors, HepG2 cells were primed with CDCA 10 μM in combination with compounds 1−6 and 8−26 50 μM for 18 h; #p < 0.05 vs CDCA.

and SHP and repressed Cyp7α1, thereby confirming at molecular level that this compound is a weak FXR agonist. To investigate the specificity toward other NRs, suvanine (1) and compounds 6 and 19, the most interesting derivatives within this family of FXR modulators, were tested on PXR, PPARγ, and LXRα (Figure 9). For this purpose, the LBD of PPARγ and LXRα were fused with a GAL4-DNA binding domain cloned into an expression vector (pSG5). Transactivation experiments were carried out using a reporter vector containing five repeats of the GAL4 responsive element cloned upstream the luciferase gene (p(UAS)5x-TK-Luc). To investigate the effect of 1, 6, and 19 on PXR, HepG2 cells were transfected with pSG5PXR, pSG5RXR, pCMV-βgal, and with the reporter vector p(CYP3A4)TKLUC containing the PXR response element of CYP3A4, a canonical PXR target gene, cloned upstream to the luciferase gene. As shown in Figure 9, suvanine and compounds 6 and 19, at the concentration of 10 μM, failed to transactivate PPARγ and LXRα (Figure 9A,B) but were able to induce the PXR mediated transactivation (Figure 9C). SAR on Suvanine Derivatives. Among the so generated family of FXR modulators, alcohol 19 represents a new chemotype of FXR ligands able to transactivate the receptor and to induce the expression of canonical FXR regulated genes. The binding mode of 19 in FXR-LBD was revealed through docking calculations using the agonist conformation of the receptor, showing a binding pattern similar to that of 6-ECDCA (Figure 10A). In particular, the flexible hydroxyl-alkyl chain occupies the LBD in such a way that the hydroxyl group can Hbond with the Tyr358 and His444 side chains. As seen for 6ECDCA, these interactions are fundamental to stabilize the receptor in the agonist conformation allowing the binding of coactivators and thus the activation of the transcription. If at position-13 less polar groups are present, as in the inactive 11 and the poor antagonist 12, the interactions with Tyr358 and His444 are weakened. On the other hand, carboxylic acid 14 showed a slight agonistic behavior (Figure 5), whereas epimeric derivatives 16 and 18 are almost inactive toward FXR, thus demonstrating that the configuration at position-13 can play a fundamental role to properly orient the

so generated tetrahydrofurane moiety (Scheme 3). Concomitant removal of the enol-sulfate group and the furane ring was achieved through ozonolysis followed by oxidative workup to give carboxylic acid 22, efficiently transformed into methyl ester 23 (diazometane, quantitative yield). This family of derivatives with chemical modification on the furane ring was also enriched by the natural γ-hydroxybutenolide derivative 24, the α,βunsaturated-γ-lactam congener 25, both obtained during suvanine isolation procedure and previously reported from a Coscinoderma sp.,57 and the acetyl derivative 26, obtained from natural derivative 24 through acetic anhydride treatment (Scheme 3). Pharmacological Evaluation. All synthetic derivatives obtained in this study were tested on FXR in a luciferase reporter assay. As shown in Figures 5 and 6, several suvanine semisynthetic derivatives were relatively effective in inhibiting FXR transactivation caused by CDCA with alcohol 6 the most potent antagonist of this series (EC50 ≈ 25 μM, Figures 7C,D).58 Notably, some derivatives were able to partially transactivate FXR when administered alone (Figure 5) but showed a different behavior when evaluated in the presence of CDCA, with aldehyde 8 acting as an antagonist, whereas carboxylic acid 14 and alcohol 19 producing an additive effect (Figure 6). Because compound 19 was effective in transactivating FXR in a luciferase repeorter assay, we have then examined a concentration−response curve of this compound. We thus found that, although 19 transactivated FXR with an EC50 of 30 μM, its efficacy was only 21.5% of CDCA, thus indicating that this compound is a weak agonist (Figure 7A,B). To further characterize these derivatives, the effect of compounds 6, 8, 19, and 23 on the expression of canonical FXR target genes was examined by RT-PCR. As shown in Figures 8A−C, the exposure of HepG2 cells to alcohol 6, aldehyde 8, and methyl ester 23 does not alter the expression of OSTα and SHP. On the other hand, if administered in combination with CDCA, 6, 8, and 23 exert an antagonistic effect on the expression of the above-mentioned genes, thus demonstrating that these derivatives behave as FXR antagonists. Conversely, alcohol 19 increased the expression of OSTα 4708



Article

Figure 7. Dose−response curves. HepG2 cells were transfected for FXR transactivation assay, as described above, and stimulated with increasing concentration of (A,B) CDCA (1, 10, and 50 μM), 19 (1, 10, and 50 μM) and (C,D) 6 (1, 10, 25, and 50 μM) plus CDCA 10 μM. *p < 0.05 vs NT; #p < 0.05 vs CDCA.

Figure 8. RT-PCR analysis of (A) OSTα, (B) SHP, and (C) CYP7α1 performed on HepG2 cells treated with CDCA and with compounds 6, 8, 19, and 23, alone or in combination with CDCA; *p < 0.05 vs NT; #p < 0.05 vs CDCA.

ligand polar group which interacts with Tyr358 and His444. In the docked pose of 19 (Figure 10A), the furane moiety

occupies the hydrophobic pocket formed by Phe326, Phe333, Ile349, Ile354, Tyr358, Met362, and Phe363, similarly to what 4709



Article

Figure 9. HepG2 cells were cotransfected with the Gal4 luciferase reporter and a chimeras in which the Gal4 DNA binding domain is fused to the LBD of (A) PPARγ and (B) LXRα. Cells were treated 18 h with (A) 10 μM rosiglitazone, (B) GW3965 or with 1, 6, and 19. (C) HepG2 cells were cotransfected with pSG5-PXR, pSG5-RXR, and with the reporter pCYP3A4promoter-TKLuc. Cells were stimulated 18 h with 10 μM rifaximin or with 1, 6, and 19. Data are the mean ± SE of three experiments; *p < 0.05 vs NT.

Figure 10. Binding modes of 6 and 19 in FXR. Binding mode of (A) 19 (magenta sticks) obtained through docking calculations in the crystal structure of the FXR-LBD in the agonist conformation (PDB 1osv), and (B) 6 (yellow sticks) in the receptor antagonist conformation obtained through MD simulations on the suvanine/FXR complex. FXR is shown as orange (H3, H4, and H12) and gray cartoons. Amino acids involved in ligand binding are shown as orange sticks. Hydrogens are omitted for clarity.

3.1).59 The final binding mode of 6 is very similar to suvanine, with the hydroxyl group close enough to interact with His444 and Trp466 and thus being able to interfere with the cation−π interaction that had been shown to be important for FXR activation (Figure 10B and Figure S26 in the Supporting Information). Furthermore, this binding conformation favors the H-bond formation between His444 on H4 and Asp467 on H12, thus stabilizing the AF-2 domain in the antagonist conformation. Similarly to other dockings results, the furane ring of 6 occupies the large hydrophobic pocket formed by Phe326, Phe333, Ile349, Ile354, Tyr358, Met362, and Phe363. Furthermore, aldehyde 8, which has a scaffold rather different than the parent suvanine, well docks in the agonist conformation of FXR (Figure S27 in the Supporting Information). In particular, this compound occupies the LBD

seen for suvanine and the ethyl group of 6-ECDCA. However, this functional group appears to be an accessory point in the ligand/FXR interaction because furane modifications do not alter the activity profiles of compounds such as 20, 25, and 26 that retain the antagonist activity. On the other hand, the replacement of enol-sulfate group of suvanine with a ketone or a hydroxyl group directly linked at position-13 produces derivatives such as 5 and 6 that show promising antagonistic profiles (Figure 6). In particular, alcohol 6 turns to be the most potent derivative (Figure 7) generated in this study. Thus, we decided to perform docking calculations of 6 in the FXR antagonist conformation yielded by MD simulations on the suvanine/FXR complex. Because of the shorter chain in position-13 of 6, the docking complex was further minimized through a MM-GBSA based procedure using Prime (version 4710



Article

of FXR bound to the OSTα promoter nor the recruitment of Src-1. This was expected because at the basal state FXR is physiologically activated by the endogenous ligand CDCA. However, upon 6-ECDCA binding, the amount of NCoR bound to OSTα promoter is significantly decreased, and this shift in coactivator/corepressor abundance results in a relative prevalence of the coactivator, thus favoring gene transcription. On the other hand, suvanine destabilizes the protranscriptional complex, causing the release of FXR from the OSTα promoter. This event leads to a reduced recruitment of Src-1 and NCoR, thus silencing the gene transcription. The above-mentioned changes were consistent with the profile of gene transcription triggered by activation or inhibition of FXR by the natural ligand CDCA and suvanine. Fully in agreement with its antagonist profile, 1 effectively reverses induction of OSTα and SHP gene expression caused by CDCA, as shown in Figure 1D,E. To validate our models, a library of derivatives was designed and prepared with the ultimate aim not only to elucidate the molecular requisites for FXR agonist and antagonist profiles but also to develop more druggable molecules with a simplified and safe chemical scaffold. Thus, modifications at the enol-sulfate group and at the furane moiety were explored, generating several compounds with promising pharmacological profiles. Among these derivatives, alcohol 19 can be considered a new chemotype of FXR ligands able to transactivate the receptor and to induce the expression of FXR regulated genes such as OSTα and SHP, and alcohol 6, with a simplified molecular scaffold, exhibits excellent antagonistic activity. In conclusion, the reported binding mode of suvanine, the first preliminary structure−activity relationship (SAR) on this new chemotype of FXR antagonist as well as the generation of semisynthetic derivatives with simplified chemical scaffolds and improved pharmacological activity, provide precious insights into the mechanism of ligand recognition by FXR and pave the way to design new selective and potent modulators for human nuclear receptors. This study reaffirms natural products as biological probes representing an essential component of today’s research arsenal to shed light on complex biological processes and biochemical pathways.

in a way similar to that of 6-ECDCA with the carbonyl oxygen of the lactone function interacting with Tyr358 and His444. This is reflected in its activity showing a partial transactivation of FXR. At variance with 8, compound 9, which does not present the lactone function, is not able to transactivate the receptor, thus suggesting that for such compounds the presence on the 5-member ring of functional groups able to engage polar interactions with Tyr358, His444, and Trp466 is important to retain the activity. Finally, compounds 22 and 23 show interesting antagonistic profiles, further supporting that the presence of the furane moiety is not necessary to have activity. However, the structural dissimilarity of these compounds with respect to the other suvanine derivatives might suggest a different interaction pattern with FXR and a diverse antagonism mechanism that will be further investigated.

■

DISCUSSION AND CONCLUSION NRs regulate several important physiological processes through the expression of specific genes.1,2 The activity of NRs on target genes is regulated through receptor conformational changes. These transitions modify the receptor affinity for partner peptides, namely coactivators and corepressors, thus increasing or decreasing the transcriptional activity of target genes.6 As a general rule, the presence of an agonist induces conformational changes of NRs that favor the release of corepressors such as NCoR and the recruitment of coactivators such as Src-1.5 On the other hand, receptor behavior in the presence of an antagonist remains elusive. On this background, we have used FXR to elucidate the conformational changes at the base of NRs activation and inactivation upon the binding of agonist and antagonist compounds, respectively. The potent FXR agonist 6-ECDCA was selected to investigate the molecular mechanism underlying FXR activation, while the marine derivative suvanine (1), reported here for the first time as a potent FXR antagonist, was used to elucidate the conformational changes leading to FXR inactivation. In particular, our results have shown that in the 6-ECDCA/FXR complex, His444 and Trp466 engage a strong cation−π interaction that stabilizes the H12 helix in a conformation competent for coactivator binding. On the other hand, suvanine is placed in between these two residues H-bonding with their side chains and thus breaking the cation−π interaction. This induces a shift of His444 in the LBD and, in turn, changes in the interaction patterns of residues on H12. As a consequence, H12 undergoes a rearrangement assuming a conformation unsuitable for coactivator binding. It merits to be mentioned that a similar molecular mechanism, known as “passive antagonism”,60,61 has been reported even for other NRs. For instance, the crystal structures of the estrogen receptor (ER) in complex with the antagonist raloxifene9 (PDB 1err) and the glucocorticoid receptor (GR) with the antiprogestin drug RU-48662 (PDB 3h52, chain C) show the displacement of H12 from its agonistbound conformation. This motion prevents the recruitment of coregulator peptides maintaining the receptor in a transcriptionally inactive state. The above-described conformational changes were supported by the analysis of the dynamics of coactivator/corepressor recruitment in HepG2 cells on the promoter of OSTα, a canonical FXR regulated gene, in response to 6-ECDCA and suvanine (Figure 1G). In particular, FXR regulates the expression of OSTα by binding to responsive elements, two IR-1, located at −2002 and −1484 from the ATG coding starting site. Exposure to 6-ECDCA does not alter the amount

■

EXPERIMENTAL SECTION

Chemistry. Specific rotations were measured on a Jasco P-2000 polarimeter. High-resolution ESI-MS spectra were performed with a Micromass Q-TOF mass spectrometer. NMR spectra were obtained on Varian Inova 400, 500, and 700 NMR spectrometers (1H at 400, 500, and 700 MHz, 13C at 100, 125, and 175 MHz, respectively) equipped with a SUN microsystem ultra5 hardware and recorded in CD3OD (δH = 3.31 and δC = 49.0 ppm). All of the detected signals were in accordance with the proposed structures. Coupling constants (J values) are given in hertz (Hz), and chemical shifts (δ) are reported in ppm and referred to CHD2OD as internal standards. Spin multiplicities are given as s (singlet), br s (broad singlet), d (doublet), or m (multiplet). HPLC was performed with a Waters model 510 pump equipped with Waters Rheodine injector and a differential refractometer, model 401. The purities of compounds were determined to be greater than 95% by HPLC. Reaction progress was monitored via thin-layer chromatography (TLC) on Alugram silica gel G/UV254 plates. Silica gel MN Kieselgel 60 (70−230 mesh) from Macherey-Nagel Company was used for column chromatography. All chemicals were obtained from SigmaAldrich, Inc. Sponge Material and Separation of Individual Compounds. C. mathewsi Lendenfield (order Dictyoceratida, family Spongiidae) was 4711



Article

mm) with 92% MeOH/H2O as eluent to give 11 (3.3 mg, tR = 37.5 min, 40% yield) and 12 (2.9 mg, tR = 45.0 min, 33% yield). Compound 11: white amorphous solid; [α]D25 +1.1 (c 0.17, MeOH); 1H and 13C NMR spectroscopic data in CD3OD given in Table S1 in the Supporting Information; ESIMS: m/z 385.3 [M + H]+. HRMS (ESI): calcd for C26H41O2, 385.3107; found, 385.3112 [M + H]+. Compound 12: white amorphous solid; [α]D25 +20.0 (c 0.26, MeOH); 1H and 13C NMR spectroscopic data in CD3OD given in Table S1 in the Supporting Information; ESIMS: m/z 417.3 [M + H]+. HRMS (ESI): calcd for C27H45O3, 417.3369; found, 417.3375 [M + H]+. Horner−Wadsworth−Emmons Reactions. A solution of 1 (80 mg, 0.169 mmol) in pyridine (1 mL) and dioxane (1 mL) was heated at 90 °C under argon atmosphere. After 3 h, the solution was cooled and evaporated to dryness to give 90 mg of a crude mixture. Crude reaction mixture was added to a solution of LiOH (50 mg, 2.10 mmol) and TEPA (triethylphosphonoacetate, 550 μL, 2.80 mmol) in THF dry (10 mL). The reaction mixture was stirred for 24 h at reflux and then quenched with water (10 mL). The mixture was then extracted with EtOAc (3 × 100 mL), and the organic phase was concentrated in vacuo. The mixture was purified on a Nucleodur 100−5 C18 column (5 μm; 10 mm i.d. × 250 mm) with 92% MeOH/H2O as eluent to afford 15 (55 mg, tR = 41.0 min, 74% yield) and 13 (6.1 mg, tR = 43.0 min). Compound 13: amorphous solid; [α]D25 −12.4 (c 0.07, MeOH). Selected 1H NMR (400 MHz, CD3OD) δ (ppm): 7.38 (br s, H-19), 7.23 (br s, H-27), 6.79 (dd, J = 15.5, 9.7 Hz, H-24), 6.24 (br s, H-18), 5.85 (d, J = 15.5 Hz, H-25), 4.18 (q, OCH2CH3), 1.28 (t, J = 7.1 Hz, OCH2CH3). ESIMS: m/z 441.3 [M + H]+. HRMS (ESI): calcd for C29H45O3, 441.3369; found, 441.3377 [M + H]+. Compound 15: amorphous solid; [α]D25 +57.9 (c 0.43, MeOH); 1H and 13C NMR spectroscopic data in CD3OD given in Table S4 in the Supporting Information; ESIMS: m/z 441.3 [M + H]+. HRMS (ESI): calcd for C29H45O3, 441.3369; found, 441.3380 [M + H]+. The same procedure was applied to pure 2 (30 mg, 81.0 × 10−3 mmol) to afford 15 (25 mg, 70% yield). NaBH4 reduction of 2, 5, 8, 15, and 17. Compound 2 (5.0 mg, 13.5 × 10−3 mmol) was dissolved in a solution of dry MeOH (1 mL) and treated with an excess of NaBH4 (5 mg, 0.132 mmol) at 0 °C. The reaction was stirred at room temperature overnight and then MeOH was added. After evaporation of the solvent, the residue was diluted with water and extracted with EtOAc (3 × 50 mL). The combined organic phases were washed with brine, dried over anhydrous Na2SO4, and evaporated under reduced pressure. The crude residue was purified on a Nucleodur 100−5 C18 column (5 μm; 4.6 mm i.d. × 250 mm) with 92% MeOH/H2O as eluent to afford 3 (4.2 mg, tR = 16.5 min, 84% yield). Compound 3: white amorphous solid; [α]D25 +17.0 (c 0.07, MeOH). Selected 1H NMR (400 MHz, CD3OD) δ (ppm): 7.39 (br s, H-19), 7.30 (br s, H-25), 6.34 (br s, H-18), 3.73 (d, J = 9.5 Hz, H24a), 3.54 (t, J = 9.5 Hz, H-24b), 2.57 (m, H-16a), 2.37 (dt, J = 14.8, 8.2 Hz, H-16b), 0.99 (s, H3-22), 0.87 (s, H3-20), 0.84 (s, H3-21 and H3-23). ESIMS: m/z 373.3 [M + H]+. HRMS (ESI): calcd for C25H41O2, 373.3107; found, 373.3115 [M + H]+. The same procedure was applied to 5 (2.2 mg, 8.40 × 10−3 mmol) to afford compound 6 (3 mg, tR = 28.5 min, 73% yield). Compound 6: amorphous solid; [α]D25 +34.6 (c 0.16, MeOH). Selected 1H NMR (400 MHz, CD3OD) δ (ppm): 7.39 (br s, H-19), 7.27 (br s, H-24), 6.33 (br s, H-18), 4.06 (br s, H-13), 2.57 (m, H16a), 2.36 (dt, J = 14.7, 8.2 Hz, H-16b), 1.07 (s, H3-22), 1.02 (s, H323), 0.85 (s, H3-20), 0.84 (s, H3-21). ESIMS: m/z 359.3 [M + H]+. HRMS (ESI): calcd for C24H39O2, 359.2950; found, 359.2965 [M + H]+. The same procedure was applied to 9 (3.4 mg, 9.23 × 10−3 mmol) to afford 10 (2.4 mg, tR = 22.5 min, 70% yield). Compound 10: amorphous solid; [α]D25 −39.1 (c 0.12, MeOH). Selected 1H NMR (400 MHz, CD3OD) δ (ppm): 7.25 (br s, H-19), 6.14 (br s, H-18), 3.83 (d, J = 10.7 Hz, H-24a), 3.65 (d, J = 10.7 Hz, H-24b), 1.08 (s, H3-22), 0.95 (s, H3-23), 0.91 (s, H3-20), 0.87 (s, H3-

collected on the barrier reef of Vangunu Island, Solomon Islands, in July 2004. The samples were frozen immediately after collection and lyophilized to yield 322 g of dry mass. The sponge was identified by Dr. John Hooper, Queensland Museum, Brisbane, Australia, where a voucher specimen is deposited under the access number G322695. The lyophilized material (322 g) was extracted with methanol (3 × 1.5 L) at room temperature, and the crude methanolic extract (72.6 g) was subjected to a modified Kupchan’s partitioning procedure as follows. The methanol extract was dissolved in a mixture of MeOH/ H2O containing 10% H2O and partitioned against n-hexane. The water content (% v/v) of the MeOH extract was adjusted to 30% and partitioned against CHCl3. The aqueous phase was concentrated to remove MeOH and then extracted with n-BuOH. The chloroform-soluble material (1.5 g), mainly containing suvanine, was chromatographed by DCCC using CHCl3/MeOH/ H2O (7:13:8) in the ascending mode (the lower phase was the stationary phase); the flow rate was 18 mL/h; 6 mL fractions were collected and combined on the basis of their similar TLC retention factors. Fraction 1 (326 mg) was purified by HPLC on a Nucleodur 100−5 C18 column (5 μm; 4.6 mm i.d. × 250 mm) with 35% MeCN/ H2O as eluent to give 17.6 mg of compound 25 (tR = 8.7 min) and 12.2 mg of compund 24 (tR = 12.6 min). Fraction 2 (262 mg) was purified by HPLC on a Nucleodur 100−5 C18 (5 μm; 10 mm i.d. × 250 mm, flow rate 1.0 mL/min) with 35% MeCN/H2O as eluent to give 240 mg of suvanine 1 (tR = 19.5 min). Characteristic Data for Natural Compounds. Suvanine (1): white amorphous solid; [α]D25 +12.0 (c 0.40, MeOH); ESIMS: m/z 449.2 [M − Na]−. HRMS (ESI): calcd for C25H37O5S, 449.2362; found, 449.2376 [M − Na]−. NMR data as previously reported.34 Compound 24: white amorphous solid; [α]D25 +8.1 (c 0.11, MeOH); ESIMS: m/z 481.2 [M − Na]−. HRMS (ESI): calcd for C25H37O7S, 481.2260; found, 481.2272 [M − Na]−. NMR data as previously reported.57 Compound 25: white amorphous solid; [α]D25 +3.8 (c 0.14, MeOH); ESIMS: m/z 464.2 [M − Na]−. HRMS (ESI): calcd for C25H38NO5S, 464.2471; found, 464.2485 [M − Na]−. NMR data as previously reported.57 Synthetic Procedures. Solvolysis of Suvanine (1). A solution of 1 (100 mg, 0.212 mmol) in pyridine (1.5 mL) and dioxane (1.5 mL) was heated at 90 °C for 3 h under argon atmosphere. After, the solution was cooled, the mixture was evaporated to dryness, and then purified by HPLC on a Nucleodur 100−5 C18 column (5 μm; 10 mm i.d. × 250 mm) with 92% MeOH/H2O as eluent to give 8 (10 mg, tR = 9.5 min, 12% yield), 5 (10 mg, tR = 18.0 min, 13% yield), 2 (55 mg, tR = 25.0 min, 70% yield), a mixture of 2 and 7 (4.0 mg, tR = 27.0 min), and 9 (6.0 mg, tR = 31.0 min, 8% yield). Compound 2: amorphous solid; [α]D25 −7.8 (c 0.12, MeOH); 1H and 13C NMR spectroscopic data in CD3OD given in Table S1 in the Supporting Information; ESIMS: m/z 371.3 [M + H]+. HRMS (ESI): calcd for C25H39O2, 371.2950; found, 371.2960 [M + H]+. Compound 5: white amorphous solid; [α]D25 −27.3 (c 0.25, MeOH); 1H and 13C NMR spectroscopic data in CD3OD given in Table S2 in the Supporting Information; ESIMS: m/z 357.3 [M + H]+. HRMS (ESI): calcd for C24H37O2, 357.2794; found, 357.2801 [M + H]+. Compound 8: white amorphous solid; [α]D25 +4.0 (c 0.75, CH3OH); 1H and 13C NMR spectroscopic data in CD3OD given in Table S3 in the Supporting Information; ESIMS: m/z 385.3 [M + H]+. HRMS (ESI): calcd for C25H37O3, 385.2743; found, 385.2750 [M + H]+. Compound 9: white amorphous solid; [α]D25 −52.1 (c 0.29, MeOH); 1H and 13C NMR spectroscopic data in CD3OD given in Table S3 in the Supporting Information; ESIMS: m/z 369.3 [M + H]+. HRMS (ESI): calcd for C25H37O2, 369.2794; found, 369.2808 [M + H]+. Compounds 11 and 12. A solution of suvanine 1 (10 mg, 0,0212 mmol) in pyridine (1 mL) and dioxane (1 mL) was heated at 90 °C for 3 h. The reaction was quenched with MeOH and purified by HPLC on a Nucleodur 100−5 C18 column (5 μm; 10 mm i.d. × 250 4712



Article

H2 (1 atm) for 10 min. The mixture was filtered through Celite, and the recovered filtrate was concentrated under vacuum. The residue was purified by HPLC on a Nucleodur 100−3 C18 (3 μm; 4.6 mm i.d. × 250 mm) with 35% MeCN/H2O as eluent (flow rate 1 mL/min) to give 20 (2.2. mg, tR = 23.5 min, 44% yield) and 21 (2.5 mg, tR = 25.5 min, 50% yield). Compound 20: amorphous solid; [α]D25 −1.52 (c 0.11, MeOH). Selected 1H NMR (400 MHz, CD3OD) δ (ppm): 6.28 (br s, H-24), 3.94−3.57 (m, H2-19/H2-25), 1.06 (s, H3-22), 0.91 (s, H3-23), 0.87 (s, H3-20), 0.84 (s, H3-21). ESIMS: m/z 453.3 [M − Na]−. HRMS (ESI): calcd for C25H41O5S: 453.2675; found 453.2681 [M − Na]−. Compound 21: amorphous solid; [α]D25 +10.9 (c 0.07, MeOH). Selected 1H NMR (400 MHz, CD3OD) δ (ppm): 6.25 (br s, H-24), 3.96−3.68 (m, H2-19/H2-25), 1.06 (s, H3-22), 0.90 (s, H3-23), 0.86 (s, H3-20), 0.83 (s, H3-21). ESIMS: m/z 453.3 [M − Na]−. HRMS (ESI): calcd for C25H41O5S, 453.2675; found, 453.2687 [M − Na]− Compound 22. A stream of O3 was bubbled into a solution of 1 (25.9 mg, 54.8 × 10−3 mmol) in CH2Cl2 (2 mL) kept at −78 °C until a blue-colored solution resulted. After stirring for 10 min, excess of O3 was removed upon bubbling N2, and the solution was treated with excess dimethylsulfide (2 mL). After 3 h, the solution was concentrated under vacuum to remove the solvent, and the crude residue was purified by flash chromatography on silica gel using nhexane/EtOAc (8:2 v/v) as eluent to afford 22 (10 mg, 55% yield). Compound 22: amorphous solid; [α]D25 −17.8 (c 0.08, MeOH); 1 H and 13C NMR spectroscopic data in CD3OD given in Table S5 in the Supporting Information; ESIMS: m/z 333.2 [M − H]−. HRMS (ESI): calcd for C21H33O3, 333.2430; found, 333.2440 [M − H]−. Compound 23. Compound 22 (3.1 mg, 9.27 × 10−3 mmol) was dissolved in ether, and the resulting solution was added dropwise to an ethereal solution of CH2N2 (ca. 20 equiv) at 0 °C. The cloudy yellow mixtures were stirred for 10 min and then concentrated under vacuum to give 3.2 mg of 23 (quantitative yield). Compound 23: amorphous solid; [α]D25 −18.1 (c 0.19, MeOH). Selected 1H NMR (500 MHz, CD3OD) δ (ppm): 3.65 (s, OCH3), 2.89 (br d, J = 9.9 Hz, H-14), 2.54 (m, H-12b), 2.43 (t, J = 6.0 Hz, H16b), 2.22 (m, H-12a), 2.17 (m, H-16a), 1.20 (s, H3-20), 0.93 (s, H318), 0.90 (s, H3-19), 0.78 (s, H3-21). ESIMS: m/z 349.3 [M + H]+. HRMS (ESI): calcd for C22H37O3, 349.2743; found, 349.2754 [M + H]+. Compound 26. Compound 24 (2.9 mg, 5.75 × 10−3 mmol) and acetic anhydride (1 mL, 10.5 mmol) in dry pyridine (1 mL) was left to stand at room temperature overnight. Then the solvent was evaporated and purification by HPLC on a Nucleodur 100−5 C18 column (5 μm; 4.5 mm i.d. × 250 mm) with 35% MeCN/H2O as eluent gave 26 as epimeric mixture at C-25 (quantitative yield). Compound 26: white amorphous solid; [α]D25 +27.7 (c 0.15, MeOH). 1H NMR (500 MHz, CD3OD) δ (ppm): 6.90 (6.88) (br s, H-25), 6.25 (6.24) (br s, H-24), 6.11 (br s, H-18), 2.20 (2.19) (s, COCH3), 1.07 (s, H3-22), 0.90 (s, H3-20), 0.87 (s, 6H, H3-21, H3-23). ESIMS: m/z 523.2 [M − Na]−. HRMS (ESI): calcd for C27H39O8S: 523.2366; found 523.2378 [M − Na]−. Molecular Docking. Molecular docking calculations in the FXRLBD three-dimensional X-ray structure (PDB 1osv) were carried out using the AutoDock4.2 software package. Ligand tridimensional structures were generated with the Maestro Build Panel.63 For each ligand, an extensive ring conformational sampling was performed with the OPLS-AA64 force field and a 2.0 Å rmsd cutoff using MacroModel (version 9.9)65 as implemented in Maestro 9.3.63 All conformers were then refined using LigPrep66 as implemented in Maestro 9.3.63 Protonation states at pH 7.0 were assigned using Epik.67 Protein structure was prepared through the Protein Preparation Wizard through the graphical user interface of Maestro 9.3.63 Water molecules were removed, and hydrogen atoms were added and minimized using the OPLS-2005 force field.64 Ligands and receptor structures were converted to AD4 format files using ADT, and the Gesteiger−Marsili partial charges were then assigned. Grid points of 65 × 65 × 65 with a 0.375 Å spacing were calculated around the binding cavity using AutoGrid4.2. Thus, 100 separate docking calculations were performed for each run. Each docking run consisted of 10 million energy

21). ESIMS: m/z 387.3 [M + H]+. HRMS (ESI): calcd for C25H39O2, 371.2950; found, 371.2955 [M + H]+. The same procedure was applied to 15 (6.6 mg, 15.0 × 10−3 mmol) to afford 17 (4.0 mg tR = 34.5 min, 62% yield). Compound 17: amorphous solid; [α]D25 +31.7 (c 0.08, MeOH). Selected 1H NMR (400 MHz, CD3OD) δ (ppm): 7.39 (br s, H-19), 7.27 (br s, H-27), 6.31 (br s, H-18), 3.65 (s, OCH3), 0.95 (s, H3-22), 0.93 (s, H3-23), 0.89 (s, H3-20), 0.83 (s, H3-21). ESIMS: m/z 429.3 [M + H]+. HRMS (ESI): calcd for C28H45O3, 429.3369; found, 429.3381 [M + H]+. The same procedure (for 24 h) was applied to compound 17 (1.8 mg, 4.20 × 10−3 mmol) to afford 19 (1.2 mg, tR = 19.5 min, 71% yield). Compound 19: amorphous solid; [α]D25 +36.3 (c 0.06, MeOH). Selected 1H NMR (400 MHz, CD3OD) δ (ppm): 7.39 (br s, H-19), 7.27 (br s, H-27), 6.31 (br s, H-18), 3.57 (t, J = 5.9 Hz, H2-26), 0.97 (s, H3-22), 0.93 (s, H3-23), 0.88 (s, H3-20), 0.83 (s, H3-21). ESIMS: m/z 401.3 [M + H]+. HRMS (ESI): calcd for C27H45O2, 401.3420; found, 401.3435 [M + H]+. Compound 4. Compound 2 (6.0 mg, 16.2 × 10−3 mmol) was dissolved in 1 mL of t-BuOH and 220 μL of H2O to which 2 M hexane solution of 2-methyl-2-butene (223 μL, 0.445 mmol), KH2PO4 (20 mg, 0.150 mmol), and NaClO2 (27 mg, 0.300 mmol) were successively added at room temperature. After 3 h, the reaction was concentrated and the residue was dissolved in brine and extracted three times with EtOAc. The combined organic layer was dried over Na2SO4 and concentrated. The crude residue was purified on a Nucleodur 100−5 C18 column (5 μm; 4.6 mm i.d. × 250 mm) with 87% MeOH/H2O as eluent to afford 4 (4.2 mg, tR = 54.9 min, 67% yield). Compound 4: amorphous solid; [α]D25 +14.8 (c 0.09, MeOH). Selected 1H NMR (400 MHz, CD3OD) δ (ppm): 7.35 (br s, H-19), 7.27 (br s, H-25), 6.33 (br s, H-18), 2.72 (m, H-13), 2.71 (m, H-16a), 2.44 (dt, J = 14.7, 8.1 Hz, H-16b), 1.09 (s, H3-22), 0.94 (s, H3-23), 0.87 (s, H3-20), 0.84 (s, H3-21). ESIMS: m/z 385.3 [M − H]−. HRMS (ESI): calcd for C25H37O3, 385.2743; found, 385.2755 [M − H]−. LiOH Hydrolysis of 13, 15, and 17. Compound 13 (2.0 mg, 4.54 × 10−3 mmol) was dissolved in THF/H2O (3/1, 1 mL) and treated with LiOH hydrate (3.0 mg, 0.125 mmol) at 0 °C. The resulting mixture was stirred at room temperature for 24 h. The mixture was treated with 0.2 N HCl until pH reached 7−8. The solution was concentrated in vacuum, and the crude mixture was purified by HPLC on a Nucleodur 100−5 C18 column (5 μm; 4.6 mm i.d. × 250 mm) with 95% MeOH/H2O as eluent to afford 14 (1.2 mg, tR = 8.4 min, 64% yield). Compound 14: amorphous solid; [α]D25 −5.6 (c 0.05, MeOH). Selected 1H NMR (400 MHz, CD3OD) δ (ppm): 7.35 (br s, H-19), 7.25 (br s, H-27), 6.63 (dd, J = 15.4, 10.3 Hz, H-24), 6.26 (br s, H-18), 5.81 (d, J = 15.4 Hz, H-25). ESIMS: m/z 411.3 [M − H]−. HRMS (ESI): calcd for C27H39O3, 411.2899; found, 411.2910 [M − H]−. The same procedure was applied to 15 (4.0 mg, 9.10 × 10−3 mmol) to afford 16 (2.7 mg, tR = 3.9 min, 72% yield). Compound 16: amorphous solid; [α]D25 +18.8 (c 0.09, MeOH). Selected 1H NMR (400 MHz, CD3OD) δ (ppm): 7.36 (br s, H-19), 7.26 (br s, H-27), 6.98 (dd, J = 15.3, 8.6 Hz, H-24), 6.31 (br s, H-18), 5.84 (d, J = 15.3 Hz, H-25), 0.99 (s, H3-22), 0.97 (s, H3-23), 0.88 (s, H3-20), 0.83 (s, H3-21). ESIMS: m/z 411.3 [M − H]−. HRMS (ESI): calcd for C27H39O3, 411.2899; found, 411.2907 [M − H]−. The same procedure was applied to 17 (2.8 mg, 6.54 × 10−3 mmol) to afford 18 (1.5 mg, tR = 21.0 min, 56% yield). Compound 18: amorphous solid; [α]D25 +17.4 (c 0.06, MeOH). Selected 1H NMR (400 MHz, CD3OD) δ (ppm): 7.36 (br s, H-19), 7.20 (br s, H-27), 6.33 (br s, H-18), 0.95 (s, H3-22 and H3-23), 0.88 (s, H3-20), 0.84 (s, H3-21). ESIMS: m/z 413.3 [M − H]−. HRMS (ESI): calcd for C27H41O3, 413.3056; found, 413.3062 [M − H]−. Compounds 20 and 21. An oven-dried 10 mL flask was charged with 10% Pd(OH)2 Degussa type on carbon (2.0 mg) and 1 (5.0 mg, 10.6 × 10−3 mmol). Absolute methanol (1 mL) and dry THF (1 mL) were added, and the flask was evacuated, flushed with argon and then with hydrogen. The reaction was stirred at room temperature under 4713



Article

relative mRNA expression was calculated and expressed as 2−(ΔΔCt). Primers used for qRT-PCR were as follows. hGAPDH: GAAGGTGAAGGTCGGAGT and CATGGGTGGAATCATATTGGAA hOSTα: TGTTGGGCCCTTTCCAATAC and GGCTCCATGTTCTGCTCAC hSHP: GCTGTCTGGAGTCCTTCTGG and CCAATGATAGGGCGAAAGAAGAG hCYP7α1: CACCTTGAGGACGGTTCCTA and CGATCCAAAGGGCATGTAGT Chomatin Immunoprecipitation. HepG2 cells (10 ×106) were serum starved for 24 h and then treated for 18 h with 6-ECDCA (5 μM), alone or in combination with suvanine (15 μM). After treatment, cells were cross-linked with 1% formaldehyde for 10 min at room temperature and then the reaction was stopped by glycine addition to a final concentration of 125 mM. Cells were washed twice in ice-cold PBS and lysed with 500 μL of swelling buffer (25 mM Hepes, pH 7.8; 1.5 mM MgCl2; 10 mM KCl; 0.1% NP-40; 1 mM DTT) containing protease inhibitors. Cells were centrifuged at 2000 rpm for 10 min at +4 °C, resuspended in sonication buffer (50 mM Hepes, pH 7.8; 140 mM NaCl; 1 mM EDTA; 1% Triton X-100; 0,1% SDS) plus protease inhibitors and then sonicated four times for 30 s using Bandelin SONOPULS ultrasonic homogenizers (cycle 8, power 70%). Then 50 μL of each supernatant (Input DNA) were reverse-cross-linked by the addition of 150 μL of elution buffer (1% SDS; 0.1 M NaHCO3) and 12 μL of NaCl 5 M and then heating the mixture to 65 °C overnight. DNA was recovered from Input by proteinase K treatment at 65 °C for 4 h, followed by phenol/chloroform (1:1) extraction and ethanol precipitation, and dissolved into 50 μL of TE 1× buffer. For chromatin immunoprecipitation, 150 μL of chromatin was diluted with 850 μL of sonication buffer containing protease inhibitors, and then 20 μL of sonication buffer equilibrated Protein A Sepharose (Invitrogen)/ Salmon Sperm DNA (Invitrogen)/1% BSA (PAS/SS/BSA) was added to each sample. After mixing at +4 °C for 1 h, mixtures were centrifuged at 2000 rpm for 5 min to obtain supernatants that were subsequently immunoprecipitated overnight at +4 °C with specific antibodies: anti-FXR (sc-13063X, Santa Cruz, CA), anti-Src1 (sc32789X, Santa Cruz, CA), anti-NCoR (sc-1609X, Santa Cruz, CA), or anti-IgG (SA1−36098, Pierce), for all experimental conditions. Then 40 μL of PAS/SS/BSA were added to each mixtures that were incubated at +4 °C for 2 h and then centrifuged at 13000 rpm for 1 min. Immunoprecipitates were washed twice with low salt buffer (0.1% SDS; 1% Triton X-100; 2 mM EDTA, pH 8.0; 20 mM Tris−HCl, pH 8.0; 150 mM NaCl), twice with high salt buffer (0.1% SDS; 1% Triton X-100; 2 mM EDTA, pH 8.0; 20 mM Tris−HCl, pH 8.0; 500 mM NaCl), and finally once in TE 1× (10 mM Tris-HCl, pH 8.0; 1 mM EDTA, pH 8.0). DNA was eluted by the addition of 250 μL of elution buffer, and the cross-linking reactions were reversed by heating the mixture to 65 °C overnight. The DNA was recovered from immunoprecipitated material by proteinase K treatment at 65 °C for 4 h, followed by phenol/chloroform (1:1) extraction and ethanol precipitation, and dissolved into 20 μL of TE 1×. Then 2 μL of chromatin were used for qRT-PCR. Raw data analysis was performed as follows: ΔCt was calculated versus the input DNA concentration; ΔΔCt was versus unstimulated cells immunoprecipitated with the antiIgG antibody (experimental condition set as 1.0); the relative expression was calculated as 2−(ΔΔCt). The sequences of primers used for the amplification of the OSTα promoter were: CTCTGGGAAGTCTAAAGTTCAG and CTCCTAAAGTCCAGTTCCTG. Selectivity of Suvanine and Compounds 6 and 19. HepG2 cells were transiently transfected with 500 ng reporter vector p(UAS)5XTKLuc, 200 ng pCMV-βgalactosidase, and with two vectors containing the ligand binding domain of the nuclear receptors PPARγ and LXRα cloned upstream of the GAL4-DNA binding domain. Then 48 h post-transfection, cells were stimulated 18 h with the appropriate nuclear receptor agonist or with suvanine and derivatives 6 and 19 (10 μM). To investigate the PXR mediated transactivation, HepG2 cells were transfected with 100 ng of pSG5-PXR, 100 ng of pSG5-RXR, 200

evaluations using the Lamarckian genetic algorithm local search (GALS) method. Otherwise default docking parameters were applied. Docking conformations were clustered on the basis of their rmsd (tolerance = 2.0 Å) and were ranked based on the AutoDock scoring function.46 Molecular Dynamics. All the simulations were performed with NAMD 2.9 using the f f 99SBildn Amber force field parameters.68 Each complex was solvated in a 10.0 Å layer cubic water box using the TIP3P water model parameters.69 Neutrality was ensured by rescaling the excess charges on the α carbon atoms using a factor equal to the ratio between the system net charge and number of Cα atoms. A 10 Å cutoff (switched at 8.0 Å) was used for atom-pair interactions. The long-range electrostatic interactions were computed by means of the particle mesh Ewald (PME) method using a 1.0 Å grid spacing in periodic boundary conditions. The SHAKE algorithm was applied to constraint bonds involving hydrogen atoms, and thus an integration 2 fs time step interval could be used. Amber charges were applied to the proteins and water molecules, whereas the ligand charges were computed using the restrained electrostatic potential (RESP) fitting procedure.70 The ESP was first calculated by means of the Gaussian09 package71 using a 6-31G* basis set at Hartree−Fock level of theory, and then the RESP charges were obtained by a two-stages fitting procedure using Antechamber.72 Each complex was heated up to 300K while putting harmonic constraints on the protein and the ligand, which were gradually released along the thermalization process. Production runs were then performed under NPT conditions at 1 atm and 300 K. All the residue labels were taken from the Protein Data Bank using the FXR-LBD structure with PDB 1osv. All figures were rendered using PyMOL (http://www.pymol.org). Transactivation. HepG2 cells were cultured at 37 °C in Minimum Essential Medium with Earl’s salts containing 10% fetal bovine serum (FBS), 1% L-glutamine, and 1% penicillin/streptomycin. The transfection experiments were performed using Fugene HD (Promega) according to manufactured specifications. Cells were plated in a 12well plate at 1 × 105 cells/well. HepG2 cells were transfected with 150 ng pSG5-FXR, 150 ng pSG5-RXR, 200 ng pCMV-βgalactosidase, and with 500 ng of the reporter vector p(hsp27)-TK-LUC containing the FXR response element IR1 cloned from the promoter of heat shock protein 27 (hsp27). At 24 h post-transfection, cells were stimulated 18 h with 10 μM CDCA, 10 μM compounds 1−6 and 8−26, or with the combination of CDCA (10 μM) and compounds 1−6 and 8−26 (50 μM). In other experimental settings, cells were treated with increasing concentrations of 1 (10, 25, and 50 μM) plus 10 μM CDCA, 6 (1, 10, 25, and 50 μM) plus 10 μM CDCA, 19 (1, 10, and 50 μM), and CDCA (1, 10, and 50 μM). After treatments, cells were lysed in 100 μL of lysis buffer (25 mM TRIS-phosphate pH 7.8; 2 mM DTT; 10% glycerol; 1% Triton X-100), and 20 μL of cellular lysate was assayed for luciferase activity using the Luciferase Assay System (Promega). Luminescence was measured using Glomax 20/20 luminometer (Promega). Luciferase activities were normalized for transfection efficiencies by dividing the luciferase relative light units by βgalactosidase activity expressed from cells cotransfected with pCMVβgal. Real-Time PCR. HepG2 cells (1 ×106) were starved for 24 h at 37 °C in E-MEM containing 1% FBS, 1% L-glutamine, and 1% penicillin/ streptomycin. Cells were primed 18 h with CDCA 10 μM, compounds 1, 6, 8, 19, and 23 (10 μM) or with the combination of 10 μM CDCA and compounds 1, 6, 8, 19, and 23 (50 μM). Quantization of the expression level of selected genes was performed by quantitative RTPCR (qRT-PCR). Total RNA was isolated with TRIzol reagent (Invitrogen), incubated with DNase I (Invitrogen), and random reverse-transcribed with Superscript II (Invitrogen) according to manufacturer specifications. Then the 25 ng template was amplified using the following reagents: 0.2 μM of each primer and 12.5 μL of 2× SYBR Green qPCR master mix (Invitrogen). All reactions were performed in triplicate, and the thermal cycling conditions were as follows: 2 min at 95 °C, followed by 40 cycles of 95 °C for 20 s, 55 °C for 20 s, and 72 °C for 30 s in an iCycler iQ instrument (Biorad). The 4714



Article

of ng pCMV-galactosidase, and with 500 ng of the reporter vector containing the PXR target gene promoter (CYP3A4 gene promoter) cloned upstream of the luciferase gene (pCYP3A4promoter-TKLuc). At 48 h post-transfection, cells were stimulated 18 h with rifaximin or with suvanine and derivatives 6 and 19 (10 μM).

■

(6) Glass, C. K.; Rose, D. W.; Rosenfeld, M. G. Nuclear receptor coactivators. Curr. Opin. Cell Biol. 1997, 9, 222−232. (7) Matias, P. M.; Donner, P.; Coelho, R.; Thomaz, M.; Peixoto, C.; Macedo, S.; Otto, N.; Joschko, S.; Scholz, P.; Wegg, A.; Bäsler, S.; Schäfer, M.; Egner, U.; Carrondo, M. A. Structural evidence for ligand specificity in the binding domain of the human androgen receptor. Implications for pathogenic gene mutations. J. Biol. Chem. 2000, 275, 26164−26171. (8) Mueller-Fahrnow, A.; Egner, U. Ligand-binding domain of estrogen receptors. Curr. Opin. Biotechnol. 1999, 10, 550−556. (9) Brzozowski, A. M.; Pike, A. C.; Dauter, Z.; Hubbard, R. E.; Bonn, T.; Engström, O.; Ohman, L.; Greene, G. L.; Gustafsson, J. A.; Carlquist, M. Molecular basis of agonism and antagonism in the oestrogen receptor. Nature 1997, 389, 753−758. (10) Wurtz, J. M.; Bourguet, W.; Renaud, J. P.; Vivat, V.; Chambon, P.; Moras, D.; Gronemeyer, H. A canonical structure for the ligandbinding domain of nuclear receptors. Nature Struct. Biol. 1996, 3, 87− 94. (11) Makishima, M.; Okamoto, A. Y.; Repa, J. J.; Tu, H.; Learned, R. M.; Luk, A.; Hull, M. V.; Lustig, K. D.; Mangelsdorf, D. J.; Shan, B. Identification of a nuclear receptor for bile acids. Science 1999, 284, 1362−1365. (12) Parks, D. J.; Blanchard, S. G.; Bledsoe, R. K.; Chandra, G.; Consler, T. G.; Kliewer, S. A.; Stimmel, J. B.; Willson, T. M.; Zavacki, A. M.; Moore, D. D.; Lehmann, J. M. Bile acids: natural ligands for an orphan nuclear receptor. Science 1999, 284, 1365−1368. (13) Moore, D. D.; Kato, S.; Xie, W.; Mangelsdorf, D. J.; Schmidt, D. R.; Xiao, R.; Kliewer, S. A. The NR1H and NR1I receptors: constitutive androstane receptor, pregnane X receptor, farnesoid X receptor α, farnesoid X receptor β, liver X receptor α, liver X receptor β, and vitamin D receptor. Pharmacol. Rev. 2006, 58, 742−759. (14) Jonker, J. W.; Liddle, C.; Downes, M. FXR and PXR: potential therapeutic targets in cholestasis. J. Steroid Biochem. Mol. Biol. 2012, 130, 147−158. (15) Rizzo, G.; Renga, B.; Antonelli, E.; Passeri, D.; Pellicciari, R.; Fiorucci, S. The methyl transferase PRMT1 functions as co-activator of farnesoid X receptor (FXR)/9-cis retinoid X receptor and regulates transcription of FXR responsive genes. Mol. Pharmacol. 2005, 68, 551−558. (16) Fiorucci, S.; Rizzo, G.; Donini, A.; Distrutti, E.; Santucci, L. Targeting FXR for liver and metabolic disorders. Trends Mol. Med. 2007, 13, 298−309. (17) Fiorucci, S.; Mencarelli, A.; Distrutti, E.; Palladino, G.; Cipriani, S. Targeting farnesoid-X-receptor: from medicinal chemistry to disease treatment. Curr. Med. Chem. 2010, 17, 139−159. (18) Renga, B.; Migliorati, M.; Mencarelli, A.; Cipriani, S.; D’Amore, C.; Distrutti, E.; Fiorucci, S. Farnesoid X receptor suppresses constitutive androstane receptor activity at the multidrug resistance protein-4 promoter. Biochim. Biophys. Acta 2011, 1809, 157−165. (19) D’Auria, M. V.; Sepe, V.; Zampella, A. Natural ligands for nuclear receptors: biology and potential therapeutic applications. Curr. Top. Med. Chem. 2012, 12, 637−669. (20) Urizar, N. L.; Liverman, A. B.; Dodds, D. T.; Silva, F. V.; Ordentlich, P.; Yan, Y.; Gonzalez, F. J.; Heyman, R. A.; Mangelsdorf, D. J.; Moore, D. D. A natural product that lowers cholesterol as an antagonist ligand for FXR. Science 2002, 296, 1703−1706. (21) Wu, J.; Xia, C.; Meier, J.; Li, S.; Hu, X.; Lala, D. S. The hypolipidemic natural product guggulsterone acts as an antagonist of the bile acid receptor. Mol. Endocrinol. 2002, 16, 1590−1597. (22) Nozawa, H. Xanthohumol, the chalcone from beer hops (Humulus lupulus L.), is the ligand for farnesoid X receptor and ameliorates lipid and glucose metabolism in KK-Ay mice. Biochem. Biophys. Res. Commun. 2005, 336, 754−761. (23) Burris, T. P.; Montrose, C.; Houck, K. A.; Osborne, H. E.; Bocchinfuso, W. P.; Yaden, B. C.; Cheng, C. C.; Zink, R. W.; Barr, R. J.; Hepler, C. D.; Krishnan, V.; Bullock, H. A.; Burris, L. L.; Galvin, R. J.; Bramlett, K.; Stayrook, K. R. The hypolipidemic natural product guggulsterone is a promiscuous steroid receptor ligand. Mol. Pharmacol. 2005, 67, 948−954.

ASSOCIATED CONTENT

* Supporting Information S

Tabulated NMR data for 2, 5, 8, 9, 11, 12, 15, and 22, NMR proton spectra for all compounds, binding modes of 6-ECDCA, suvanine, alcohol 6, and aldehyde 8 in FXR, postulated mechanism for the formation of derivative 5. This material is available free of charge via the Internet at http://pubs.acs.org.

■

AUTHOR INFORMATION

Corresponding Author

*Phone: 0039-081-678525. Fax: 0039-081-678552. E-mail: [email protected] (V.L.); angela.zampella@unina. it (A.Z.); fi[email protected] (S.F.). Author Contributions ∥

F.S.D., C.F., and C.D. contributed equally to this work. F.S.D., E.N., and V.L. performed the computational studies. Notes

The authors declare no competing financial interest.

■

ACKNOWLEDGMENTS This work was supported by grants from “MAREX-Exploring Marine Resources for Bioactive Compounds: From Discovery to Sustainable Production and Industrial Applications” (Call FP7-KBBE-2009-3, project no. 245137), from MIUR (PRIN 2009) “Sostanze ad attività antitumorale: isolamento da fonti marine, sintesi di analoghi e ulteriore sviluppo della chemoteca LIBIOMOL”, and from the Swiss National Supercomputing Centre (CSCS) under project ID s312.

■

ABBREVIATIONS USED AD4.2, AutoDock4.2; BAs, bile acids; BSEP, bile salt export pump; CDCA, chenodeoxycholic acid; ChIP, chromatin immunoprecipitation; CyP7α1, cytochrome P450 7α1; FXR, farnesoid-X-receptor; HepG2, human hepatoma cell line; LBD, ligand binding domain; LXRα, liver-X-receptor α; MD, molecular dynamics; NCoR, nuclear corepressor; NRs, nuclear receptors; OSTα, organic solute transporter α; PXR, pregnaneX-receptor; PPARγ, peroxisome proliferator-activated receptor γ; RXR, retinoid-X-receptor; RT-PCR, real-time polymerase chain reaction; SHP, small heterodimer partner; Src-1, steroid receptor coactivator-1

■

REFERENCES

(1) Mangelsdorf, D. J.; Thummel, C.; Beato, M.; Herrlich, P.; Schütz, G.; Umesono, K.; Blumberg, B.; Kastner, P.; Mark, M.; Chambon, P.; Evans, R. M. The nuclear receptor superfamily: the second decade. Cell 1995, 83, 835−839. (2) Zubay, G. L.; Parson, W. W.; Vance, D. E. Principles of Biochemistry; Wm. C. Brown Communications, Inc., Dubuque, IA, 1995. (3) Giguere, V. Orphan nuclear receptors: from gene to function. Endocr. Rev. 1999, 20, 689−724. (4) Moras, D.; Gronemeyer, H. The nuclear receptor ligand-binding domain: structure and function. Curr. Opin. Cell. Biol. 1998, 10, 384− 391. (5) Glass, C. K.; Rosenfeld, M. G. The coregulator exchange in transcriptional functions of nuclear receptors. Genes Dev. 2000, 14, 121−141. 4715



Article

(24) Fiorucci, S.; Distrutti, E.; Bifulco, G.; D’Auria, M. V.; Zampella, A. Marine sponge steroids as nuclear receptor ligands. Trends Pharmacol. Sci. 2012, 33, 591−601. (25) Carlson, E. E. Natural products as chemical probes. ACS Chem. Biol. 2010, 5, 639−653. (26) Sepe, V.; Bifulco, G.; Renga, B.; D’Amore, C.; Fiorucci, S.; Zampella, A. Discovery of sulfated sterols from marine invertebrates as a new class of marine natural antagonists of farnesoid-X-receptor. J. Med. Chem. 2011, 54, 1314−1320. (27) Festa, C.; De Marino, S.; D’Auria, M. V.; Bifulco, G.; Renga, B.; Fiorucci, S.; Petek, S.; Zampella, A. Solomonsterols A and B from Theonella swinhoei. The first example of C-24 and C-23 sulfated sterols from a marine source endowed with a PXR agonistic activity. J. Med. Chem. 2011, 54, 401−405. (28) De Marino, S.; Ummarino, R.; D’Auria, M. V.; Chini, M. G.; Bifulco, G.; Renga, B.; D’Amore, C.; Fiorucci, S.; Debitus, C.; Zampella, A. Theonellasterols and conicasterols from Theonella swinhoei. Novel marine natural ligands for human nuclear receptors. J. Med. Chem. 2011, 54, 3065−3075. (29) De Marino, S.; Sepe, V.; D’Auria, M. V.; Bifulco, G.; Renga, B.; Petek, S.; Fiorucci, S.; Zampella, A. Towards new ligands of nuclear receptors. Discovery of malaitasterol A, an unique bis-secosterol from marine sponge Theonella swinhoei. Org. Biomol. Chem. 2011, 9, 4856− 4862. (30) Renga, B.; Mencarelli, A.; D’Amore, C.; Cipriani, S.; D’Auria, M. V.; Sepe, V.; Chini, M. G.; Monti, M. C.; Bifulco, G.; Zampella, A.; Fiorucci, S. Discovery that theonellasterol a marine sponge sterol is a highly selective FXR antagonist that protects against liver injury in cholestasis. PLoS One 2012, 7, e30443. (31) Manes, L. V.; Naylor, S.; Crews, P.; Bakus, G. J. Suvanine, a novel sesterterpene from an Ircinia marine sponge. J. Org. Chem. 1985, 50, 284−286. (32) Manes, L. V.; Crews, P.; Kernan, M. R.; Faulkner, D. J.; Fronczek, F. R.; Gandour, R. D. Chemistry and revised structure of suvanine. J. Org. Chem. 1988, 53, 570−575. (33) Pellicciari, R.; Fiorucci, S.; Camaioni, E.; Clerici, C.; Costantino, G.; Maloney, P. R.; Morelli, A.; Parks, D. J.; Willson, T. M. 6α-Ethylchenodeoxycholic acid (6-ECDCA), a potent and selective FXR agonist endowed with anticholestatic activity. J. Med. Chem. 2002, 45, 3569−3572. (34) De Marino, S.; Festa, C.; D’Auria, M. V.; Bourguet-Kondracki, M.-L.; Petek, S.; Debitus, C.; Andrés, R. M.; Terencio, M. C.; Payá, M.; Zampella, A. Coscinolactams A and B: new nitrogen-containing sesterterpenoids from the marine sponge Coscinoderma mathewsi exerting anti-inflammatory properties. Tetrahedron 2009, 65, 2905− 2909. (35) Downes, M.; Verdecia, M. A.; Roecker, A. J.; Hughes, R.; Hogenesch, J. B.; Kast-Woelbern, H. R.; Bowman, M. E.; Ferrer, J. L.; Anisfeld, A. M.; Edwards, P. A.; Rosenfeld, J. M.; Alvarez, J. G.; Noel, J. P.; Nicolaou, K. C.; Evans, R. M. A chemical, genetic, and structural analysis of the nuclear bile acid receptor FXR. Mol. Cell 2003, 11, 1079−1092. (36) Mi, L. Z.; Devarakonda, S.; Harp, J. M.; Han, Q.; Pellicciari, R.; Willson, T. M.; Khorasanizadeh, S.; Rastinejad, F. Structural basis for bile acid binding and activation of the nuclear receptor FXR. Mol. Cell 2003, 11, 1093−1100. (37) Soisson, S. M.; Parthasarathy, G.; Adams, A. D.; Sahoo, S.; Sitlani, A.; Sparrow, C.; Cui, J.; Becker, J. W. Identification of a potent synthetic FXR agonist with an unexpected mode of binding and activation. Proc. Natl. Acad. Sci. U..S. A. 2008, 105, 5337−5342. (38) Akwabi-Ameyaw, A.; Bass, J. Y.; Caldwell, R. D.; Caravella, J. A.; Chen, L.; Creech, K. L.; Deaton, D. N.; Jones, S. A.; Kaldor, I.; Liu, Y.; Madauss, K. P.; Marr, H. B.; McFadyen, R. B.; Miller, A. B.; Navas, F., III; Parks, D. J.; Spearing, P. K.; Todd, D.; Williams, S. P.; Wisely, G. B. Conformationally constrained farnesoid X receptor (FXR) agonists: naphthoic acid-based analogs of GW 4064. Bioorg. Med. Chem. Lett. 2008, 18, 4339−4343. (39) Bass, J. Y.; Caldwell, R. D.; Caravella, J. A.; Chen, L.; Creech, K. L.; Deaton, D. N.; Madauss, K. P.; Marr, H. B.; McFadyen, R. B.;

Miller, A. B.; Parks, D. J.; Todd, D.; Williams, S. P.; Wisely, G. B. Substituted isoxazole analogs of farnesoid X receptor (FXR) agonist GW4064. Bioorg. Med. Chem. Lett. 2008, 19, 2969−2973. (40) Akwabi-Ameyaw, A.; Bass, J. Y.; Caldwell, R. D.; Caravella, J. A.; Chen, L.; Creech, K. L.; Deaton, D. N.; Madauss, K. P.; Marr, H. B.; McFadyen, R. B.; Miller, A. B.; Navas, F., III; Parks, D. J.; Spearing, P. K.; Todd, D.; Williams, S. P.; Wisely, G. B. FXR agonist activity of conformationally constrained analogs of GW 4064. Bioorg. Med. Chem. Lett. 2009, 19, 4733−4739. (41) Flatt, B.; Martin, R.; Wang, T.-L.; Mahaney, P.; Murphy, B.; Gu, X.-H.; Foster, P.; Li, J.; Pircher, P.; Petrowski, M.; Schulman, I.; Westin, S.; Wrobel, J.; Yan, G.; Bischoff, E.; Daige, C.; Mohan, R. Discovery of XL335 (WAY-362450), a highly potent, selective, and orally active agonist of the farnesoid X receptor (FXR). J. Med. Chem. 2009, 52, 904−907. (42) Lundquist, J. T., IV; Harnish, D. C.; Kim, C. Y.; Mehlmann, J. F.; Unwalla, R. J.; Phipps, K. M.; Crawley, M. L.; Commons, T.; Green, D. M.; Xu, W.; Hum, W.-T.; Eta, J. E.; Feingold, I.; Patel, V.; Evans, M. J.; Lai, K.; Borges-Marcucci, L.; Mahaney, P. E.; Wrobel, J. E. Improvement of physiochemical properties of the tetrahydroazepinoindole series of farnesoid X receptor (FXR) agonists: beneficial modulation of lipids in primates. J. Med. Chem. 2010, 53, 1774−1787. (43) Richter, H. G. F.; Benson, G. M.; Blum, D.; Chaput, E.; Feng, S.; Gardes, C.; Grether, U.; Hartman, P.; Kuhn, B.; Martin, R. E.; Plancher, J.-M.; Rudolph, M. G.; Schuler, F.; Taylor, S.; Bleicher, K. H. Discovery of novel and orally active FXR agonists for the potential treatment of dyslipidemia and diabetes. Bioorg. Med. Chem. Lett. 2011, 21, 191−194. (44) Bass, J. Y.; Caravella, J. A.; Chen, L.; Creech, K. L.; Deaton, D. N.; Madauss, K. P.; Marr, H. B.; McFadyen, R. B.; Miller, A. B.; Mills, W. Y.; Navas, F., III; Parks, D. J.; Smalley, T. L., Jr.; Spearing, P. K.; Todd, D.; Williams, S. P.; Wisely, G. B. Conformationally constrained farnesoid X receptor (FXR) agonists: heteroaryl replacements of the naphthalene. Bioorg. Med. Chem. Lett. 2011, 21, 1206−1213. (45) Akwabi-Ameyaw, A.; Caravella, J. A.; Chen, L.; Creech, K. L.; Deaton, D. N.; Madauss, K. P.; Marr, H. B.; Miller, A. B.; Navas, F., III; Parks, D. J.; Spearing, P. K.; Todd, D.; Williams, S. P.; Wisely, G. B. Conformationally constrained farnesoid X receptor (FXR) agonists: alternative replacements of the stilbene. Bioorg. Med. Chem. Lett. 2011, 21, 6154−6160. (46) Huey, R.; Morris, G. M.; Olson, A. J.; Goodsell, D. S. A semiempirical free energy force field with charge-based desolvation. J. Comput. Chem. 2007, 28, 1145−1152. (47) Limongelli, V.; Marinelli, L.; Cosconati, S.; La Motta, C.; Sartini, S.; Mugnaini, L.; Da Settimo, F.; Novellino, E.; Parrinello, M. Sampling protein motion and solvent effect during ligand binding. Proc. Natl. Acad. Sci. U. S. A. 2012, 109, 1467−1472. (48) Costantino, G.; Entrena-Guadix, A.; Macchiarulo, A.; Gioiello, A.; Pellicciari, R. Molecular dynamics simulation of the ligand binding domain of farnesoid X receptor. Insights into helix-12 stability and coactivator peptide stabilization in response to agonist binding. J. Med. Chem. 2005, 48, 3251−3259. (49) Nolte, R. T.; Wisely, G. B.; Westin, S.; Cobb, J. E.; Lambert, M. H.; Kurokawa, R.; Rosenfeld, M. G.; Willson, T. M.; Glass, C. K.; Milburn, M. V. Ligand binding and co-activator assembly of the peroxisome proliferator-activated receptor-γ. Nature 1998, 395, 137− 143. (50) Perissi, V.; Staszewski, L. M.; McInerney, E. M.; Kurokawa, R.; Krones, A.; Rose, D. W.; Lambert, M. H.; Milburn, M. V.; Glass, C. K.; Rosenfeld, M. G. Molecular determinants of nuclear receptorcorepressor interaction. Genes Dev. 1999, 13, 3198−3208. (51) Xu, H. E.; Lambert, M. H.; Montana, V. G.; Plunket, K. D.; Moore, L. B.; Collins, J. L.; Oplinger, J. A.; Kliewer, S. A.; Gampe, R. T., Jr.; McKee, D. D.; Moore, J. T.; Willson, T. M. Structural determinants of ligand binding selectivity between the peroxisome proliferator activated receptors. Proc. Natl. Acad. Sci. U. S. A. 2001, 98, 13919−13924. (52) Feng, W.; Ribeiro, R. C.; Wagner, R. L.; Nguyen, H.; Apriletti, J. W.; Fletterick, R. J.; Baxter, J. D.; Kushner, P. J.; West, B. L. Hormone4716



Article

dependent coactivator binding to a hydrophobic cleft on nuclear receptors. Science 1998, 280, 1747−1749. (53) Henttu, P. M.; Kalkhoven, E.; Parker, M. G. AF-2 activity and recruitment of steroid receptor coactivator 1 to the estrogen receptor depend on a lysine residue conserved in nuclear receptors. Mol. Cell. Biol. 1997, 17, 1832−1839. (54) Shiau, A. K.; Barstad, D.; Loria, P. M.; Cheng, L.; Kushner, P. J.; Agard, D. A.; Greene, G. L. The structural basis of estrogen receptor/ coactivator recognition and the antagonism of this interaction by tamoxifen. Cell 1998, 95, 927−937. (55) Kalgutkar, A. S.; Gardner, I.; Obach, R. S.; Shaffer, C. L.; Callegari, E.; Henne, K. R.; Mutlib, A. E.; Dalvie, D. K.; Lee, J. S.; Nakai, Y.; O’Donnell, J. P.; Boer, J.; Harriman, S. P. A comprehensive listing of bioactivation pathways of organic functional groups. Curr. Drug. Metab. 2005, 161−225. (56) Kimura, J.; Hyosu, M. Two new sesterterpenes from the marine sponge Coscinoderma mathewsi. Chem. Lett. 1999, 61−62. (57) Bae, J.; Jeon, J. E.; Lee, Y. J.; Lee, H. S.; Sim, C. J.; Oh, K. B.; Shin, J. Sesterterpenes from the tropical sponge Coscinoderma sp. J. Nat. Prod. 2011, 74, 1805−1811. (58) At tested concentration compound 3 was toxic on HepG2 cells. (59) Prime, version 3.1; Schrödinger, LLC: New York, 2012. (60) Wagner, B. L.; Pollio, G.; Giangrande, P.; Webster, J. C.; Breslin, M.; Mais, D. E.; Cook, C. E.; Vedeckis, W. V.; Cidlowski, J. A.; McDonnell, D. P. The novel progesterone receptor antagonists RTI 3021−012 and RTI 3021−022 exhibit complex glucocorticoid receptor antagonist activities: implications for the development of dissociated antiprogestins. Endocrinology 1999, 140, 1449−1458. (61) Link, J. T.; Sorensen, B.; Patel, J.; Grynfarb, M.; Goos-Nilsson, A.; Wang, J.; Fung, S.; Wilcox, D.; Zinker, B.; Nguyen, P.; Hickman, B.; Schmidt, J. M.; Swanson, S.; Tian, Z.; Reisch, T. J.; Rotert, G.; Du, J.; Lane, B.; von Geldern, T. W.; Jacobson, P. B. Antidiabetic activity of passive nonsteroidal glucocorticoid receptor modulators. J. Med. Chem. 2005, 48, 5295−5304. (62) Schoch, G. A.; D’Arcy, B.; Stihle, M.; Burger, D.; Bär, D.; Benz, J.; Thoma, R.; Ruf, A. Molecular switch in the glucocorticoid receptor: active and passive antagonist conformations. J. Mol. Biol. 2010, 395, 568−577. (63) Maestro, version 9.3; Schrödinger, LLC: New York, 2012. (64) Jorgensen, W. L.; Maxwell, D. S.; Tirado-Rives, J. Development and testing of the OPLS all-atom force field on conformational energetics and properties of organic liquids. J. Am. Chem. Soc. 1996, 118, 11225−11236. (65) MacroModel, version 9.9; Schrödinger, LLC: New York, 2012. (66) Ligprep, version 2.5; Schrödinger, LLC: New York, 2012. (67) Epik, version 2.3; Schrödinger, LLC: New York, 2012. (68) Lindorff-Larsen, K.; Piana, S.; Palmo, K.; Maragakis, P.; Klepeis, J. L.; Dror, R. O.; Shaw, D. E. Improved side-chain torsion potentials for the Amber ff99SB protein force field. Proteins 2010, 78, 1950− 1958. (69) Jorgensen, W. L.; Chandrasekhar, J.; Madura, J. D.; Impey, R. W.; Klein, M. L. Comparison of simple potential functions for simulating liquid water. J. Chem. Phys. 1983, 79, 926−935. (70) Bayly, C. I.; Cieplak, P.; Cornell, W. D.; Kollman, P. A. A wellbehaved electrostatic potential based method using charge restraints for determining atom-centered charges: The RESP Model. J. Phys. Chem. 1993, 97, 10269−10280. (71) Gaussian09; Gaussian, Inc.: Wallingford, CT, 2009. (72) Wang, J.; Wang, W.; Kollman, P. A.; Case, D. A. Automatic atom type and bond type perception in molecular mechanics. J. Mol. Graphics Modell. 2006, 25, 247−260.

4717


Binding Mechanism of the Farnesoid X Receptor Marine Antagonist

Recommend Documents