Biochemical Analysis Reveals the Multifactorial ... - ACS Publications

Subscriber access provided by CORNELL UNIVERSITY LIBRARY

Article

The biochemical analysis reveals multifactorial mechanism of histone H3 clipping by Chicken Liver Histone H3 protease Sakshi Chauhan, Papita Mandal, and Raghuvir Singh Tomar Biochemistry, Just Accepted Manuscript • DOI: 10.1021/acs.biochem.6b00625 • Publication Date (Web): 02 Sep 2016 Downloaded from http://pubs.acs.org on September 2, 2016

Just Accepted “Just Accepted” manuscripts have been peer-reviewed and accepted for publication. They are posted online prior to technical editing, formatting for publication and author proofing. The American Chemical Society provides “Just Accepted” as a free service to the research community to expedite the dissemination of scientific material as soon as possible after acceptance. “Just Accepted” manuscripts appear in full in PDF format accompanied by an HTML abstract. “Just Accepted” manuscripts have been fully peer reviewed, but should not be considered the official version of record. They are accessible to all readers and citable by the Digital Object Identifier (DOI®). “Just Accepted” is an optional service offered to authors. Therefore, the “Just Accepted” Web site may not include all articles that will be published in the journal. After a manuscript is technically edited and formatted, it will be removed from the “Just Accepted” Web site and published as an ASAP article. Note that technical editing may introduce minor changes to the manuscript text and/or graphics which could affect content, and all legal disclaimers and ethical guidelines that apply to the journal pertain. ACS cannot be held responsible for errors or consequences arising from the use of information contained in these “Just Accepted” manuscripts.

Biochemistry is published by the American Chemical Society. 1155 Sixteenth Street N.W., Washington, DC 20036 Published by American Chemical Society. Copyright © American Chemical Society. However, no copyright claim is made to original U.S. Government works, or works produced by employees of any Commonwealth realm Crown government in the course of their duties.

Page 1 of 41

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

The biochemical analysis reveals multifactorial mechanism of histone H3 clipping by Chicken Liver Histone H3 protease Sakshi Chauhan1, Papita Mandal1, 2 and Raghuvir S. Tomar1* 1 Laboratory of Chromatin Biology, Department of Biological Sciences, Indian Institute of Science Education and Research, Bhopal- 462066, India. 2 Current address: King Abdullah University of Science and Technology, Thuwal, Saudi Arabia *To whom correspondence to be addressed: Raghuvir S. Tomar, Associate Professor, Department of Biological Sciences, Indian Institute of Science Education and Research, Bhopal-462066, India. Tel.: +91-755-6692560; Email: [email protected]

ACS Paragon Plus Environment

Biochemistry

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Abstract Proteolytic clipping of histone H3 has been identified in many organisms. Despite several studies, mechanism of clipping, substrate specificity and significance of this poorly understood epigenetic mechanism is not clear. We have earlier reported histone H3 specific proteolytic clipping and a protein inhibitor in chicken liver. However, the sites of clipping are still not known very well. In present study, we have made an attempt to identify clipping sites in histone H3 and mechanism of inhibition by stefin B protein, a cysteine protease inhibitor. By employing site directed mutagenesis and in vitro biochemical assays, we have identified three distinct clipping sites in recombinant human histone H3 and variants (H3.1, H3.3 and H3t). However, post translational modified histones isolated from chicken liver and Saccharomyces cerevisiae wild type cells showed different clipping pattern. Clipping of histone H3 Nterminal tail at three sites occurs in sequential manner. We have further observed that clipping sites are regulated by the structure of the N-terminal tail as well as globular domain of histone H3. We also have identified QVVAG region of stefin B protein to be very crucial for inhibition of the protease activity. Altogether our comprehensive biochemical studies have revealed three distinct clipping sites in histone H3 and their regulation by the structure of histone H3, histone modifications marks and stefin B. Key words: H3 clipping, stefin B, H3 protease, Glud1


Page 2 of 41

Page 3 of 41

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

Chromatin consists of nucleoprotein complexes. The fundamental unit of chromatin is nucleosome, which contains approximately 147 base pairs of DNA wrapped around octamer of highly conserved core histone proteins. Histone octamer contains two copies of each; H3, H4, H2A and H2B

(1)

. Plasticity of chromatin

structure is essential for regulation of DNA dependent processes; replication, transcription, repair and recombination. Structural dynamics of chromatin is primarily maintained by ATP-dependent chromatin remodeling machineries, histone variants, DNA methylation, post-translational modifications of histones and proteolytic clipping of histone proteins

(2-7)

. However, function of histone tail clipping process is not

very well understood. History of proteolytic processing of histones is quite long. It has been observed in many organisms; protozoa

(8)

, yeast

(9)

, chicken

(7)

, human

(10)

and upon infection by virus(11,

12)

. The

proteolytic processing of histones was detected in 70s and 80s. Based on a few biochemical studies, it was proposed that clipping of histones may have impact on transcription of genes. Until 2000, there was no strong evidence to believe that clipping of histones can regulate gene expression. The studies on clipping of histone tails started again around 2008. The cathepsin L dependent clipping of histone H3 tail was identified in mouse embryonic stem cells during differentiation

(6)

histone H3 in yeast identified which regulate gene expression

(9)

. Around same time the clipping of

. However, protease responsible for

clipping of histone H3 is not known. After these few studies, clipping of histones became an interesting area for research. In chicken, a highly tissue specific clipping of H3

(7, 13)

was reported. Subsequently in

yeast, PRB1, vacuole proteinase was shown to be involved in cleavage of histone H3

(14)

. Clipping of

histone H3 was also detected in human embryonic stem cells and human peripheral blood mononuclear cells

(10, 15)

. In another study, clipping of histone H2B and H3 both was observed in primary human

hepatocytes and hepatocellular carcinoma cell line HepG2/C3A in spheroid culture

(16)

. Not only H3 but

variant, H3.3 specific clipping was also observed and shown to regulate cellular senescence Glutamate dehydrogenase dependent clipping of histone H3 tail

(7)

and stefin B as its inhibitor

(18)

(17)

.

was

identified in chicken liver. However, glutamate dehydrogenase 1 (GDH1) in yeast recently has been identified as negative regulator of histone H3 clipping and has been shown to play role in modulation of gene expression

(19)

. The virulence factors of Neisseria meningitidis, adhesion and penetration protein

(App) and meningococcal serine protease A (Msp A) have also been shown as clippers of histone H3 (20). Recently, in primary mouse OCP cells, MMP-9 dependent proteolysis of histone H3 has been reported which regulates gene pathways required for osteoclastogenesis process

(21)

. Despite many reports,

regulation of such an irreversible process is not very well established in comparison to other epigenetic mechanisms. In order to understand the regulation of H3 clipping, we have confirmed stefin B and other cystatins as inhibitors of histone H3 protease (22). However, clipping sites and mechanism of inhibition of H3 protease by stefin B is not known. In this study, we have identified three different highly dynamic clipping sites within N-terminal tail region of histone H3. Furthermore, we observed that globular domain


Biochemistry

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

of H3 is essential for H3 protease activity. However, cutting pattern at three sites differs with histone H3 expressed in bacteria, isolated from chicken tissues and yeast. Difference in clipping pattern with these sources of histone H3 is probably due to post-translational modifications of histone H3. It is known that clipped histone H3 tail exhibit different frequency of post-translational modification marks in comparison to un-clipped histone H3 tail

(16)

. We have also shown through time dependent clipping assay that H3

protease acts on histone H3 in sequential manner. Through site directed mutagenesis, we created various truncation and point mutants of histone H3, stefin B and fusion of histone H3 and histone H4 to dissect the molecular mechanism of histone H3 clipping. The H3 protease activity was found to be affected by alteration in charge of H3 tail. By mutating arginine and lysine to alanine resulted in different clipping products. We also provide evidence that QVVAG and C-terminal regions of stefin B are required for inhibition of H3 protease activity. However, in contrast to a report which suggests that stefin B interacts with histone H3 (23), we did not observe interaction between stefin B and histone H3 indicating that stefin B inhibit protease activity through interaction with protease rather than histone H3. Thus our studies have advanced the knowledge about mechanism of highly complicated process of H3 clipping, an epigenetic event. Materials and methods Strains and reagents Bacterial strains DH5α and BL21 (DE3) were used for cloning and expression of recombinant proteins, respectively. Glutathione and Ni-NTA agarose resins were purchased from GE healthcare and Qiagen respectively. Restriction enzymes and Phusion HF polymerase were from NEB and Thermo Scientific. Chaperone plasmids (#3340) were purchased from TaKaRa. Histone H3 antibodies used were from Sigma (H 0164) and Abcam (ab1791). GDH antibody (SAB2100932-50UG) and lyticase from Arthrobacter luteus (L 4025) were purchased from Sigma. Histone H4 protein was purchased from NEB. TOPO-TA cloning kit was from Invitrogen. Non-essential histone H3 and H4 mutant collection in yeast (YSC5106) was purchased from Dharmacon™. All the primers used in this study are listed in table 1 and 2. Yeast strains used in this study are mentioned in table 3. Preparation of core histones from chicken brain tissue Core histones were extracted from brain nuclei of chicken by hydroxyapatite chromatography method as described earlier (24). For nuclei isolation previously described method was used (25). Briefly, chicken brain tissue was homogenized in a Solution (0.34 M sucrose, 15 mM Tris-Cl pH 7.5, 15 mM NaCl, 60 mM KCl, 0.5 mM spermidine, 0.15 mM spermine, 2 mM EDTA, 0.5 mM EGTA, 15 mM β-ME, and 0.2 mM


Page 4 of 41

Page 5 of 41

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

PMSF) and subsequently Triton X-100 (0.25%) was added followed by centrifugation. Nuclei pellets were washed and suspended in 10 mM Tris-Cl, pH 7.5, 0.35M NaCl, 0.2 mM PMSF, and 15 mM β-ME to remove non histone proteins. Washed nuclei were further sonicated in solution (10 mM Tris-Cl, pH 7.5, 15 mM β-ME, and 2 mM PMSF) to prepare soluble chromatin and mixed with hydroxyapatite resin (equilibrated in 50 mM sodium phosphate buffer, pH 6.8). The volume was further increased to 10 times (10 ml/g resin) of the initial volume with the same buffer. Sodium chloride was added to the final concentration of 0.6 M. The chromatin mixed hydroxyapatite was washed several times with 50 mM phosphate buffer containing 0.6 M NaCl. Core histones were then eluted with phosphate buffer containing 2.0 M NaCl. Eluted histones were desalted by dialysis against 10 mM Tris-Cl (pH 7.5) and precipitated with 3.5 volumes of chilled acetone. The precipitated histones were collected by centrifugation, pellet was air dried and dissolved in 10 mM Tris-Cl, pH 7.5 and purity was tested by 15% SDS-PAGE. H3 protease preparation H3 protease was purified from chicken liver microsomal extract as described earlier with some modifications

(7)

. Microsomal extract was prepared as described earlier

(26)

and partially purified by 30%

ammonium sulphate precipitation. Overnight dialysis was performed at 4° C against buffer (25 mM TrisCl, pH 7.5, 50 mM NaCl, 1 mM β-ME, 0.2 mM EDTA, and 10% glycerol) to remove salt. Extract was heat treated at 50° C for one hour and clarified by centrifugation at 15k rpm to remove precipitate. Supernatant was saved and applied to Hi Trap™5 ml DEAE chromatographic column at a flow rate of 0.5 ml/min with linear (50-250 mM) NaCl gradient in 25 mM Tris-Cl, pH 7.5, buffer containing 0.2 mM EDTA, 1 mM β-ME, and 10% glycerol. Protein fractions were eluted between 60 and 250 mM NaCl and tested for H3 protease activity. In vitro protease activity assay and activity inhibition assay Assays to examine histone H3 clipping by protease and inhibition by stefin B were performed as described earlier

(7, 18)

. Chicken brain core histones, recombinant human histone H3, its mutants, histone

H4, H3-H4 fusion proteins and core histones isolated from yeast were used as substrate for H3 protease activity. In brief, 0.3 µg of partially purified H3 protease was mixed with 4 µg of core histones or 2 µg of recombinant histone H3 or its mutant and incubated in 20 µl reactions for 1 hour at 37 ºC. Reaction buffer contains 10 mM HEPES, pH 5.5, 100 mM NaCl, 1 mM β-ME, 0.1 mM EDTA and 10% glycerol. For time dependent H3 clipping assays 0.20 µg of partially purified protease was used. Reactions were stopped by boiling the reaction mixture in SDS-PAGE loading dye and resolved on 15% SDS-PAGE. To examine inhibition of the H3 clipping, same assays were performed except that stefin B was added in the reaction before adding H3 protease.


Biochemistry

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 6 of 41

Construction of Plasmids Histone plasmids The construct, pHCE-H3.2 was used as template for site directed mutations. The PCR site-directed mutagenesis was performed to create sequential truncations as well as point mutations in histone H3.2. We also generated fusion proteins of histone H3 and H4. For pHCE-H3 (1-44th amino acids) H4 (32-103rd amino acids) plasmid construction, we amplified tail region of H3 and globular domain of histone H4. After restriction digestion of both products with XhoI, ligation reaction was performed which was then used for amplification of chimeric gene product. Final gene products were subcloned into pET28a vector at NdeI and BamHI sites through TOPO TA cloning and XhoI site was removed by PCR site directed mutagenesis. For construction of pET28a-H4 (1-31st amino acids) H3 (45- 136th amino acids) plasmid and pET28a-H4 (32-103rd amino acids) H3 (1-44th amino acids) plasmid same strategy was used as discussed above. The pGEX6P1-N-terminal tail of histone H3 (1-44th amino acids) and pGEX6P1-globular domain of histone H3 (45-136th) were also constructed using primers listed in table1, at EcoRI and XhoI restriction sites of pGEX6P1. For construction of pET28a-N-terminal tail of H3-GST, N-terminal tail of H3 and GST was amplified and then digested with HindIII. After ligation of these two products, full product is amplified and subcloned into pET28a vector at EcoRI and XhoI site. Stefin B plasmid Stefin B gene was cloned and expressed as described earlier

(22)

. For cloning of stefin B, human stefin B

was amplified from pcDNA 3.1 stefin B vector and sub-cloned into pGEX6P1 vector at EcoRI and XhoI restriction sites. Through PCR site-directed mutagenesis, point and truncation mutations were created in stefin B. All constructs were verified by DNA sequencing. Primers used for these constructs are listed in table1. Protein expression and purification His-tagged protein purification For expression of wild-type and mutant forms of stefin B, histone H3, H3 variants and fusion of H3-H4, plasmids were transformed into BL21 (DE3) bacterial strain. Recombinant His-tagged histone H3 and its mutant proteins were purified as described previously with some modifications (27). In brief, O/N grown cells (at 37 °C) were harvested by centrifugation at 4000 rpm for 20 min at 4 °C, washed in PBS. In pHCE-H3.2 plasmid, H3.2 gene is under constitutive promoter. Cells were suspended in lysis buffer (50 mM Tris-Cl pH-8.0, 0.5 M NaCl, 1 mM PMSF, and 5% glycerol), sonicated, clarified by centrifugation.


Page 7 of 41

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

Pellet was re-suspended into lysis buffer containing 7 M guanidine hydrochloride, centrifuged and supernatant fraction was mixed with Ni-NTA agarose for 1hr at 4 °C in a column. Column was washed with buffer (50 mM Tris-Cl, pH-8.0, 0.5 M NaCl, 6 M urea, 5 mM imidazole and 5% glycerol), elution was performed twice, 1 ml each time with 50-500 mM imidazole containing buffer (50 mM Tris-Cl, pH8.0, 0.5 M NaCl, 6 M urea and 5% glycerol). The purified histones were dialyzed against buffer containing 25 mM Tris-Cl pH-7.5, 100 mM NaCl, 1mM β-ME, 0.2 mM EDTA and 10% glycerol. Mutants of histone H3 and its variants were also purified through same protocol; results are shown in supplementary figure 1. For purification of H3-H4 fusion protein, expression was induced by 1 mM IPTG for 3 hours at 37 °C and then same Ni-NTA procedure was followed for the purification. GST-tagged protein purification For purification of GST-tagged human histone H3 N-terminal tail, pGEX6P1 plasmid having gene for Nterminal tail of H3 was transformed into BL21(DE3) cells and grown at 37 °C in LB medium till 0.6 OD at 600 and then expression was induced with 0.5 mM IPTG for 3 hours. After induction cells were harvested and washed with 1X PBS. Cells were lysed in buffer (20 mM Tris-Cl, pH 7.5, 250 mM NaCl, 2 mM EDTA, 10 mM β-ME, PIC) and sonicated. Supernatant was collected by centrifugation and applied on to glutathione agarose beads in a column. Flow through was collected, beads were washed with washing buffer and then elution was performed with elution buffer (10 mM reduced glutathione containing binding buffer). Elution was dialyzed against buffer containing 25mM Tris-Cl pH-7.5, 100 mM NaCl, 1mM β-ME, 0.2 mM EDTA and 10% glycerol. Then pET28a plasmid having N-terminal tail of H3 was fused with GST at its C-terminus, expressed and purified as above. For purification of GST-tagged globular domain of human histone H3, BL21 (DE3) cells were cotransformed with pGEX6P1 plasmid containing gene for globular domain and pG-TF2 (groES-groEL-tig) plasmid. Cells were grown at 37 °C in LB medium (100 µg/ml Ampicillin and 25 µg/ml Chloramphenicol) until 0.6 OD at 600 nm and the induced with 0.5 mM IPTG and 5 ng/ml tetracycline and grown at 20 °C O/N. Next day cells were harvested, washed and lysed by sonication in lysis buffer (20 mM Tris-Cl, pH 7.5, 250 mM NaCl, 2 mM EDTA, 10 mM β- ME, PIC). Supernatant was collected by centrifugation and applied to the glutathione agarose column for 1 hour and washed with washing buffer and elution was performed with 10 mM reduced glutathione containing binding buffer. Elution was dialyzed against buffer containing 25mM Tris-Cl pH-7.5, 100 mM NaCl, 1mM β-ME, 0.2 mM EDTA and 10% glycerol. For purification of GST-tagged stefin B, a protocol was followed as described earlier

(22)

. BL21 (DE3)

cells transformed with pGEX6P1-stefin B plasmid were grown in LB medium at 37º C till 0.6 OD at 600


Biochemistry

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 8 of 41

nm. Gene expression was induced with 1mM IPTG and after 3 hrs. cells were harvested and washed in 1X PBS. Cells were suspended in lysis buffer (20 mM Tris-Cl, pH 7.5, 250 mM NaCl, 2 mM EDTA, 10 mM β- ME, PIC) and sonicated. The cell lysates were centrifuged, and supernatants were loaded on glutathione beads (pre-equilibrated with lysis buffer) in column, mixed for 1 hour, beads were then washed with washing buffer (Same as binding buffer). Stefin B protein was eluted with buffer containing 10 mM reduced glutathione. Further, GST tag was clipped by preScission protease enzyme and separated by DEAE ion exchange chromatography. Western blotting Following primary antibodies were used for western blotting- H3 antibody (1:3000) (Abcam, 1791), H3 antibody (1:5000) (Sigma H 0164) and Glud1 antibody (1:500) (Sigma, SAB2100932-50UG). IR dye labelled secondary antibodies was purchased from LI-COR. Signals were detected using a LI-COR automated infrared imaging system as secondary antibodies were IR dye-labelled. Isolation of core histones from yeast Histones from yeast were purified as described earlier

(28, 29)

. In brief, 250 ml of yeast culture was

harvested (2700g, 5 min) at 1.5 OD and washed with water. After 15 min incubation (at 30 °C with 100 rpm) in 7.5 ml of solution 1 (0.1 mM Tris-Cl, pH-9.4 and 10 mM DTT), cells were collected by centrifugation (2700g, 5 min) and washed with 15 ml of solution 2 (1.2 M sorbitol, 20 mM HEPES-OH, pH 7.4) and collected again. Collected cells (re-suspended in 15 ml of solution 2) were treated with 625 U of lyticase at 30 °C and 100 rpm for spheroplast preparation. When spheroplasts were greater than 90%, 15 ml ice-cold solution (1.2 M sorbitol, 20 mM PIPES-OH pH 6.8, 1 mM MgCl2) was added. After spin at 1300g for 5 min at 4 °C, spheroplasts were re-suspended and washed in nuclei isolation buffer (250 mM sucrose, 60 mM KCl, 14 mM NaCl, 5 mM MgCl 2, 1 mM CaCl2, 15 mM MES, pH-6.6, 1mM PMSF and 0.8% triton X 100) three times with 20 min incubation on ice in between. After washing with 12.5 ml of buffer A (10 mM Tris-Cl, pH-8.0, 0.5% NP-40, 75 mM NaCl and 1mM PMSF) for three times (15 minutes on ice for the first two washes, and 5 minutes on ice for the third wash), and with 12.5 ml of buffer B (10 mM Tris-Cl, pH-8.0, 400 mM NaCl and 1 mM PMSF) for two times (10 minutes on ice for the first wash, and centrifuged immediately after second resuspension) pellets were extracted with 0.4 N H2SO4 with incubation on ice for 30 min and with intermittent vortexing. Debris was removed by centrifugation at 10000g for 10 min. and extracted histones were precipitated by TCA (Final concentration of TCA-20%). Precipitated histones were collected by centrifugation at 15000g for 10 min. The precipitate was washed first with acetone containing 1% HCl and then with acetone, air dried and


Page 9 of 41

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

dissolved in buffer (25 mM Tris-Cl, pH-7.5, 100 mM NaCl, 1 mM β-ME, 0.2 mM EDTA and 10% glycerol). Ni-NTA pull down assay To study interaction between stefin B and human histone H3, His-tagged human histone H3 protein was immobilized to Ni-NTA resin, equilibrated with buffer (25 mM Tris-Cl, pH-7.5, 100 mM NaCl, 1 mM βME, 0.2 mM EDTA and 10% glycerol) for one hour at 4 °C with rotation. After one hour, resin was washed with washing buffer (same as binding buffer) 6 times. His-tagged H3 immobilized Ni-NTA agarose resin was incubated with stefin B protein for one hour at 4 °C. After one hour flow through was collected and resin was washed with washing buffer. Ni-NTA agarose bound histone H3 was eluted by boiling in 1X SDS dye. For control, we incubated Ni-NTA agarose resin directly with stefin B and after washing resin was boiled in 1X SDS dye. Ni-NTA pull down assay involving histone H3, H3 protease, wild-type stefin B and mutant stefin B was performed as described earlier

(18)

. Elutions were performed

with 300 mM and 500 mM NaCl containing buffer (25 mM Tris-Cl, pH-7.5, 1 mM β-ME, 0.2 mM EDTA and 10% glycerol). Results Recombinant human histone H3 expressed in bacteria exhibit three distinct clipping sites whereas H3 purified from chicken and yeast S. cerevisiae is cleaved only at two sites by the H3 specific protease (7)

In our previous study

, we have reported clipping of histone H3 upon incubation of core histones with

protease isolated from chicken liver. However, precise cutting sites are still not identified. To find out clipping sites within histone H3, we performed in vitro cleavage assays with recombinant human histone H3 and its variants expressed in bacteria. As we have reported earlier that protease cleave at N-terminal end of histone H3

(30)

, we performed western blotting using an antibody specific to C-terminal end of

histone H3 to detect cleaved H3 products. Interestingly, we detected three major clipping products of H3 and its variants (figure 1A). There could be two ways for generating three cleaved products, one; H3 protease may first attack on a site and product of this reaction, serves as substrate for subsequent clipping site and second; protease may attack on all three sites same time but with different binding affinities. To get more insight about the accessibility of clipping sites, time point assay was performed. Histone H3 (From now on we have referred recombinant human histone H3.2 as human histone H3) was incubated with protease at 37 °C for ½, ¾, 1, 2, 3, 4, 5, 6, 7 and 8 hours (figure 1B). Based on the intensities of the cleaved products, in 1 hour time all three clipping products got increased in linear range but with different


Biochemistry

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 10 of 41

intensities which suggest that all three sites are cleaved at different rates. We believe that H3 protease first cleaves at one site and after then resulting clipping product is cleaved further to generate three distinct clipping products, as after two hours intensity of band 1 got decreased and of band 2 and 3 increased. To understand clipping pattern, we further performed in vitro protease activity assay with posttransnationally modified histones - core histones isolated from brain tissue of chicken and from S. cerevisiae. We observed that instead of three, chicken histone H3 got cleaved at two sites and yeast histone H3 at only one site (figure 1C and D). Time dependent clipping assay was also performed with histones isolated from chicken brain and yeast cells to further confirm the above observations (figure 1CII and 1DII). We observed that histone H3 isolated from S. cerevisiae was also clipped at two sites same as chicken H3. Results from clipping of recombinant unmodified human histone H3 (expressed in bacteria) and post-translational modified histone H3 (isolated from chicken brain and yeast cells) are summarized in (figure 1E I and II). H3 protease requires distinct regions within globular domain (75-85 and 117-127) of recombinant human histone H3 for efficient clipping and does not distinguish between globular domain of human histone H3 and H4 To understand the role of globular domain, we made GST fusion of human histone H3 N-terminal tail (1 to 44th amino acids), GST fusion of globular domain of human histone H3 (45th to 136th amino acids) and fusion of human histone H3 tail (1 to 44) with globular domain of human histone H4. Mutants that we created are diagrammatically represented in figure 2A. Recombinant proteins were expressed and purified as described in materials & methods section and in vitro protease assays were performed (figure 2B). As we expected protease did not cleave within the globular domain (figure 2A#3) and the cleavage within H3 tail was not significant in absence of globular domain (GST fused H3 tail #1 and 2) suggesting that it requires globular domain of H3 to act on N-terminal tail. Further to find any specific region within the globular domain that regulate clipping at N-terminal tail, we created 10 serial truncations in globular domain of histone H3. Recombinant proteins of all 10 truncation mutants were made in bacteria and clipping assays were performed (figure 2C). Careful analyses of results suggest that in absence of two sequences within globular domain of H3; 75 to 85 and 117 to127, protease did not generate any cleaved products (figure 2D). Another interesting result that we observed here was, the mutant#10 (∆128-136) of H3 protein got cleaved only at one site. These results led us to believe that these regions of globular domain of histone H3 are required by H3 protease to attack on N-terminal tail. To further understand the role of globular domain, we made fusion of ‘histone H3 and histone H4’ (figure 2A, #4 and 6). To our surprise, upon replacing globular domain of histone H3 with H4, clipping was not affected; rather we detected three clipping products same as with wild-type histone H3 (figure 2B #4). For control, we also


Page 11 of 41

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

fused histone H4 tail with globular domain of H3 (figure 2A#5). This protein also got cleaved at one site, probably at the junction or a new clipping site got emerged. However, when we fused N-terminal end of H3 tail at C-terminal end of globular domain of H4 (figure 2A#6) we detected two clipping products, which shows that orientation of H3 tail is also an important factor that can regulate clipping activity. Altogether these results suggest that protease does not distinguish between globular domain of H3 and H4 for clipping at N-terminal tail of histone H3. However, protease is very specific to H3, it does not clip histone H4 (figure 2B, H4) or any other core histones. Thus these results suggest that globular domain of either H3 or H4 provide some assistance to the H3 protease for clipping at N-terminal tail of histone H3. Proteolytic clipping of histone H3 N-terminal tail is regulated by structure of histone H3 and posttranslational modification marks It is clear from the results described in figure 1 & 2 that human histone H3 expressed in bacteria is cleaved at three distinct sites upon incubation with chicken liver H3 specific protease. To find the clipping sites in H3, we created sequential truncation mutations in human histone H3 starting from Nterminal end. We removed 5 to 10 amino acids sequentially by site directed mutagenesis (figure 3A). Recombinant proteins of all these mutants were made in bacteria and H3 clipping assays were performed with all the mutant proteins of histone H3 (figure 3B). As it is clear from the results, we detected three clipping products with all the mutants, however, with ∆1-6 mutant, we observed only two clipping products (figure 3B), suggesting that one clipping site might be located in this region. To further dissect the clipping sites, we made a long truncation in histone H3 from N-terminus; ∆1-26 H3. Recombinant human histone H3 lacking 1-26 residues from N-terminal end was expressed in bacteria and clipping assay was performed. Interestingly, upon incubation of this long truncated mutant of H3 with H3 protease, we detected only one clipping product (figure 3C & D). We further created additional truncations (∆29-34, ∆35-40, ∆41-44, ∆45-50, ∆51-55 and ∆45-55) in combination with ∆1-26 H3 mutant as shown in figure 3C and expressed them in bacteria. These mutant proteins in combination with ∆1-26 also generated only one clipping product (figure 3D#2, 3, 4, 5, 6 and 7). These results suggest that clipping of histone H3 is not a simple process as we thought. Clipping of H3 is highly dynamic process affected by the structure of histone H3. From above results it is clear that two clipping sites are present within first 26 amino acids - first one around 1-6th amino acids and second one around 26th amino acid and third one after 26th amino acid. Thus we made three new mutants by truncation of a region which we suspected as clipping region; ∆1-12, ∆23-34 and ∆35-44 of histone H3. Recombinant proteins of these long truncation mutants upon incubation with H3 protease resulted in two clipping products (figure 3F #1, 2, 3) which led us to believe that each of these three regions contains clipping site. We then created additional truncations of human histone H3 (shown in figure 3E #4, 5); ∆1-6∆23-34, ∆1-12∆23-33 to


Biochemistry

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 12 of 41

confirm our hypothesis. As expected, these double truncation mutant proteins; ∆1-6∆23-34 and ∆112∆23-33 upon incubation with protease resulted in only one clipping product (figure 3F #4, 5). We then decided to merge all these truncations (∆1-12∆23-44) thinking that it will not be clipped by the protease. However, to our surprise this mutant (∆1-6∆23-34∆35-44) also resulted in one clipping product (Figure 3F #6). These observations indicate that in absence of three regions; 1-6, 23-34 and 35-44, additional clipping site is created within human histone H3 supporting our hypothesis that activity of the protease is regulated by the overall structure of histone H3 tail. Altogether we conclude that there are three clipping sites in human histone H3 which fall within regions; 1 - 6, 23 – 34 and 35 – 44. However, in absence of these regions H3 protease can attack on other regions too suggesting that protease cuts based on the chemical nature of available amino acids as well as length of N-terminal tail of histone H3. To examine above observations further, we tested chicken liver protease activity with truncated histones that were isolated from histone mutants of yeast strains; ∆1-12, ∆13-20 and ∆21-36 (figure 3G). As shown in figure 3H, protease generated one clipping product. But when we performed time dependent H3 clipping assay with these truncated forms of yeast histone H3, we observed two clipping products with ∆13-20 and ∆2136 (figure 3I) and one clipping product with ∆1-12 mutant of yeast histone H3 which further confirms that one clipping site is located in this region. We observed that mobility of clipping products with all these mutants of yeast histone H3 in electrophoresis was quite different than clipping products of bacterially expressed human histone H3 indicating that structures as well as post-translational modifications of histone H3 are involved in regulation of clipping process. We then also examined long truncated mutant of yeast histone H3 (∆1-32 histone H3) which as we expected also got cleaved (figure 3J) in vitro by the protease. To further examine the role of post-translational modifications of histone H3 in clipping by the H3 protease, we used histone H3 that was isolated from mutant yeast strains expressing H3K-A, K-Q (mimics acetylated lysine) and K-R (mimics nonacetylated lysine) mutant forms of H3 where lysine at positions 9, 14, 18, 23 are converted into alanine, glutamine and arginine respectively (figure 3K). K-A and K-Q mutants of yeast histone H3 resulted in one clipping product upon incubation with H3 protease but upon incubation of K-R mutant of histone H3 with H3 protease, two clipping products were detected. However, to our surprise these products were different from the clipping products of wild-type yeast histone H3 in terms of their mobility in gel electrophoresis indicating that posttranslational modifications of histone H3 affect clipping sites. We then also extended our studies with following K-R mutant forms of yeast histone H3 that were isolated from mutant yeast strains expressing K4R, K9R, K14R, K18R, K23R, K27R, K36R, K37R and K42R for clipping by the H3 protease (figure 3 L). Upon incubation of above mutant forms of yeast histone H3 with protease, we observed clipping products, however molecular weight difference between clipped and unclipped H3 was very less. These mutant histone H3 proteins might be inhibitory in nature towards H3 protease but we were unable to


Page 13 of 41

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

observe complete inhibition of activity. Their mobility in electrophoresis was also different than K9, 14, 18, 23R mutants which again suggests importance of PTMs on clipping activity. Since we observed that K to R mutants of histone H3 isolated from mutant yeast strains affect clipping sites, we also examined these effects with bacterially expressed human histone H3 as described below. Histones are positively charged proteins due to abundance of lysine and arginine amino acids. Our careful sequence analysis of human histone H3 suggests that it consists of four doublets of arginine and lysine amino acids at locations; 8 - 9, 17 - 18, 26 - 27 and 63 - 64. Out of these four, first three doublets of ‘lysine and arginine’ fall in N-terminal tail region of histone H3 and fourth one in globular domain. To understand the role of these four ‘Lysine Arginine’ doublets, we mutated them to alanine individually as well as in combination (figure 3M) by site directed mutagenesis. We expressed these constructs of human histone H3 in bacteria to purify Lysine Arginine’ doublets mutant forms of recombinant histone H3. All these mutant forms of histone H3 were incubated with ‘H3 protease’ as described in material and method section and separated on SDS-PAGE to analyse the clipping products (figure 3N). Surprisingly, some of the mutants generated more than three clipping products (figure 3N). Interestingly, we also observed that molecular weight of clipping products generated from all the RK mutants of histone H3 were different than the wild-type recombinant histone H3. The differences in molecular weight in comparison to wild-type was more prominent with RK8,9AA, RK8,9,17,18AA, RK8,9,17,18,26,27AA, RK17,18,26,27,63,64AA mutant forms of human histone H3. The more than three clipping products were detected with RK17,18 AA, RK63,64AA, RK8,9,26,27AA, RK8,9,63,64AA and less than three clipping products with RK17,18,26,27AA and RK8,9,17,18,26,27AA mutants of human histone H3, indicating that clipping sites got altered upon mutation of arginine-lysine to alanine. These results suggest that arginine and lysine amino acids are also involved in regulation of histone H3 clipping. QVVAG sequence of first hairpin loop and C-terminus region of stefin B are required for inhibition of H3 protease activity Stefin B is known as reversible proteinaceous inhibitor of cysteine proteases. It belongs to a cystatin family of cysteine protease inhibitors. Stefin B also has been shown to inhibit histone H3 protease

(18, 31)

.

The N-terminus, QVVAG sequence and C-terminus of stefin B play an important role in inhibition of cysteine proteases

(32)

. To dissect the mechanism of inhibition for H3 protease by stefin B, we created

several truncation as well as point mutations in stefin B protein via site directed mutagenesis (figure 4). We first did two point mutations in N-terminal region; cysteine to serine (C3S) and glycine to arginine (G4R) of stefin B to find their role in inhibition of H3 protease activity. Role of cysteine of stefin B is quite well known for inhibition of cysteine proteases

(33)

. However, in our experiments these two

mutations; C3S and G4R did not result in complete loss of inhibition activity of stefin B (figure 4B)


Biochemistry

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 14 of 41

except that inhibition was observed slightly less with C3S in comparison to G4R mutant. The G4R mutation in stefin B has been linked with progressive myoclonus epilepsy of Unverricht–Lundborg type (EPM1)

(34)

and is important for binding with the protease

(32, 35)

. However, this mutant form of stefin B

inhibited the activity of H3 protease same as wild-type stefin B (figure 4A, B, C) suggesting that mechanism of inhibition of H3 protease activity might be different than other cysteine proteases. We then created several point mutations in QVVAG sequence of first hairpin loop of stefin B. First; we replaced each amino acid in this region with some other amino acids; Q46N, V47A, V48A, A49V, G50A, (figure 4D, E, F, G, H, I), second; truncation of entire QVVAG sequence (figure 4 K) and third; conversion of QVVAG sequence into AAAAA amino acids (figure 4L). Point mutations in QVVAG sequence did not prevent the inhibition activity of stefin B completely but it was compromised to an extent especially with A49V and G50A (figure 4G, H) mutants. Complete repression of inhibition activity was observed with QVVAG truncation and replacement of it with AAAAA, indicating that QVVAG sequence of stefin B is essential for inhibition H3 protease activity. To further explore the role of N-terminus of stefin B, 13 amino acids were removed (13N mutant) from N-terminus (figure 4I). However, this ∆13N - terminus mutant of stefin B also inhibited activity of H3 protease (figure 4I). We then also removed 10 amino acids from C-terminus end of stefin B (10C mutant). Interestingly, in absence of this C-terminus end, we observed significant decrease in inhibition activity of stefin B in comparison to wild-type stefin B (figure 4J) indicating that C-terminal end of stefin B is also required for inhibition of H3 protease. Stefin B does not interact with histone H3, QVVAG region is required by stefin B to interact with H3 protease. We have reported earlier that stefin B inhibits histone H3 protease activity by interacting with protease. However, whether or not stefin B interacts with H3 is not clear. In a study through immunoprecipitation, stefin B has been shown to interact with histone H3

(23)

. To understand the interaction of stefin B with

histone H3, we employed Ni-NTA pull down assay. His-tagged human histone H3 was immobilized on Ni-NTA agarose resin and mixed with recombinant stefin B purified from bacteria. For control, stefin B was also incubated with Ni-NTA agarose resin. We observed that stefin B was detected only in flow through fraction and histone H3 in elution. In elution we did not detect histone H3 and stefin B proteins together which indicate that stefin B does not interact with histone H3 (figure 5A). This observation further suggests that inhibition of H3 clipping occurs via interaction of stefin B with H3 protease not with histone H3. We then performed another experiment, as described earlier

(18)

to understand the role of

QVVAG sequence of stefin B in inhibition of H3 protease activity. Histone H3 was immobilized on NiNTA agarose resin. Protease, wild-type stefin B, ∆QVVAG mutant form of stefin B, ‘protease plus wildtype stefin B’ and ‘protease plus ∆QVVAG mutant form of stefin B’ were applied on the ‘His-tagged


Page 15 of 41

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

histone H3 immobilized on Ni-NTA column’ individually. From each column, flow through (FT) was saved followed by washings and bound proteins were eluted with high salt buffer. The in vitro clipping assays were performed by incubation of flow through and elution fractions of each column with core histones. We detected cleavage of histone H3 with flow through (FT), wash1 and elution fractions of protease column (figure 5B). However, flow through and wash1 fractions of wild-type stefin B column inhibited the H3 clipping property of exogenously added protease but elution fractions did not inhibit activity of the protease indicating that stefin B does not interact with histone H3 (figure 5C) whereas fractions of mutant stefin B column (figure 5F) did not show inhibition activity. On the other hand, elution fractions from ‘stefin B plus protease’ column did not cleave histone H3 (figure 5D) because H3 protease in complex with stefin B was retained in flow through and wash. Whereas elution fractions from ‘protease plus mutant stefin B’ column showed cleavage of histone H3 (figure 5F) because in the absence of QVVAG sequence, stefin B does not interact with protease as it is reported earlier

(32)

that QVVAG

sequence is important for interactions between cysteine protease and stefin B. Based on above results (figure 5B-F), we can conclude that protease interact with both; histone H3 and stefin B. To further confirm above observations, we performed Glud1 (H3 protease) western with fractions of protease and mutant stefin B (∆QVVAG) columns. Result of this western blotting suggests that mutant stefin B (∆QVVAG) does not affect binding of protease with histone H3. As we detected cleavage of H3 by the elution fractions of ‘protease plus mutant stefin B’ column suggesting that QVVAG region of stefin B is involved in interaction with the protease. Discussions Histone H3 clipping protease isolated from chicken liver can act on free as well as chromatin bound histone H3

(7)

. However, the regulation and precise cutting sites are not known yet. There are several

factors that might be involved in regulation of H3 clipping such as chromatin environment, inhibitor and histone modifications

(18)

. In general, chromatin dependent epigenetic signalling mechanisms are

regulated by post-translational modifications of histones, histone variants, energy dependent chromatin remodelling complexes, recruitment of activators as well as repressors. It is quite likely that clipping of histone tails is also regulated through similar mechanisms. In search of an inhibitor for this irreversible process, we have observed earlier that stefin B, a known cysteine protease inhibitor acts as an inhibitor of H3 clipping (18). Crystal structure of a complex of stefin B and papain revealed a tripartite wedge of stefin B that fits into active site of papain to inhibit the protease activity

(32)

. However, mechanism of inhibition

H3 protease by stefin B is not clear. To address these questions, we made wild-type and mutant version of recombinant human histone H3 and stefin B proteins, for in vitro biochemical assays to study regulation of H3 clipping. The wild-type recombinant human histone H3 (expressed in bacteria) upon incubation


Biochemistry

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 16 of 41

with H3 protease was found to be cleaved at three sites. The N-terminal tails of histones undergo various post-translational modifications

(2, 36)

and proteolytic clipping

(6, 9, 37)

to regulate structure and function of

chromatin. In comparison to N-terminal tails, the studies on globular domains of histones are very limited (38-40)

. In this study we performed experiments to examine the role of globular domain in histone H3

clipping. Interestingly we observed that both; globular domain and the length of N-terminal tail of histone H3 are involved in regulation of protease activity. The clipping of H3 N-terminal tail in absence of globular domain of human histone H3 was observed to be very poor in comparison to full length human histone H3 protein suggesting that globular domain is required for efficient clipping at N-terminal tail of H3. We then decided to study the importance of globular domain of H3 in clipping activity by the protease. We know from our earlier studies that H3 protease is highly specific to histone H3

(7, 30)

. But

whether or not globular domain has any significance in regulation of protease activity was not studied. Therefore, to study the role of globular domain, we interchanged globular domains of histone H3 and histone H4 as they are known to form tetramer. We were surprised to observe that protein having Nterminal tail of H3 and globular domain of H4 also got cleaved at three sites same as intact H3 protein upon incubation with H3 protease. To further dissect the role of globular domain, we tested chimeric protein consisting of ‘N-terminal tail of histone H4 fused with globular domain of histone H3’ and to our surprise, it also got cleaved at one site by H3 protease, probably at the junction of H4 N-terminal tail and globular region of H3 as a new clipping site might got created upon fusion of H4 N-terminal tail with the globular domain of H3. To further understand the role of structural organization of N-terminal tail and globular domain, we fused globular domain of H4 with N-terminus of H3 tail. This chimeric protein resulted in only two clipping products. These results suggest that clipping of histone H3 is a highly complex process; structural organization of H3 has great impact on regulation of H3 protease activity. Based on the clipping products with mutants of globular domain of histone H3 we can conclude that activity of H3 protease is regulated through ‘75-85’ and ‘117-127’ regions of globular domain. To understand this complicated process of H3 clipping, we further created various truncations in histone H3 N-terminal tail and subsequently in vitro clipping assays performed for finding precise clipping sites. Based on our results from in vitro experiments, we believe that there are three clipping sites which correspond to amino acids; 1 to 6, around 26th and 35 to 44th. Furthermore, short truncations from Nterminal tail of histone H3, did not affect the clipping. However, ∆1-6 H3 truncated form of histone H3 generated only two clipping products, whereas, H3 mutants with long truncations resulted in less number of clipping products. This led us to conclude that clipping of H3 depends to a great extent on the length of N-terminal tail of histone H3. Post-translational modifications in core histones are known to affect accessibility of chromatin to regulatory enzymes

(2, 41, 42)

. It is quite possible that the activity of H3

protease might be regulated by post-translational modifications (PTMs) on histone H3 as it specifically


Page 17 of 41

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

acts on histone H3 N-terminal tail. To understand the role of PTMs on histone H3 clipping, we compared clipping activity with recombinant histone H3 and post-translational modified histone H3 (Chicken histone H3 and yeast histone H3). Interestingly, we observed difference in clipping pattern, suggesting that clipping of histone H3 is regulated by PTMs. The activity of H3 protease is also negatively regulated by stefin B. Stefin B is a member of cystatin family and it is reported to be involved in the inhibition of cysteine protease papain through QVVAG sequence, N-terminus and C-terminus of protein(32). We made point and truncation mutants of stefin B protein and tested inhibition activities on H3 protease. We found that C-terminus and QVVAG sequence indeed are required for inhibition of H3 protease activity as upon truncation of this region stefin B did not suppress the activity of H3 protease. Here, in this study we have also observed that stefin B does not interact with histone H3. We provide evidence that stefin B inhibits clipping of histone H3 by interacting with the protease not through histone H3. In figure 6, all factors that regulate clipping of histone H3 are summarized. Conclusions Altogether, we conclude that H3 protease cleave recombinant human histone H3 and its variants at three different sites. Post-translational modifications of histone H3 modulate clipping property of H3 protease. In absence of globular domain of H3 or H4, efficiency of protease to cleave N-terminal tail of histone H3 is highly compromised. Two regions in globular domain; 75-85 and 117-127 amino acids of human histone H3 were found to be required for clipping activity. However, complete understanding of histone H3 clipping and physiological significance of this epigenetic process under in vivo conditions requires further experimentation. Funding This work was supported by grant (number-BT/PR3997/MED/97/33/2011) from Department of Biotechnology, Govt. of India to R.S.T. CSIR is acknowledged for providing fellowship support to S.C. Acknowledgements We acknowledge Dr. Hitoshi Kurumizaka (Waseda University, Japan) for histone H3 constructs (pHCEH3.1, pHCE-H3.2, pHCE-H3.3 and pHCE-H3t). pET28a vector and pcDNA 3.1-stefinB were provided by Dr. Vikas Jain (IISER Bhopal, India) and Dr. Natasa Kopitar Jerala (Jozef Stefan Institute, Slovenia) respectively. Members of the laboratory of chromatin biology are acknowledged for helpful discussions and IISER Bhopal for infrastructure facilities. Supporting information


Biochemistry

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 18 of 41

His-tagged and GST-tagged proteins were purified as shown in supplementary figure S1 and S2 respectively. FigureS1. Ni-NTA purification of bacterially expressed recombinant human histone H3, its variants, H3H4 fusion proteins, GST-tagged purification of N-terminal tail, globular domain of histone H3 and RK mutants of histone H3. (A) Ni-NTA purification of (i) histone H3.1 (ii) H3.2 (iii) H3.3 and (iv) H3t. (B) Ni-NTA purification of (i) fusion of N-terminal tail of histone H3 with globular domain of histone H4 (ii) fusion of H4 globular domain at N-terminus of histone H3 tail (iii) fusion of N-terminal tail (31 amino acids) of H4 with globular domain of histone H3. (C). GST-tagged purification of (i) N-terminal tail of histone H3 (44 amino acids with GST tag at N-terminus as well as at C-terminus) and (ii) globular domain of histone H3 (Star marked band represents globular domain of H3) (D). Ni-NTA purification of arginine lysine to alanine mutants (i) RK8,9AA (ii) RK17,18AA (iii) RK26,27AA (iv) RK63,64AA (v) RK8,9AA,RK26,27AA and (vi) RK17,18AA, RK26,27AA. FigureS2. GST-tagged purification of bacterially expressed recombinant human stefin B and its mutants (A) Purification of (i) WT as well as point mutants of stefin B (ii) C3S stefin B (iii) Q46N stefin B (iv) QVVAG to A5 stefin B (B) Purification of truncation mutants (i) ∆QVVAG stefin B (ii) ∆10 C-terminus stefin B.


Page 19 of 41

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

References

1. 2. 3. 4. 5. 6.

7. 8.

9.

10.

11.

12. 13.

14. 15. 16.

17.

18. 19.

Luger, K., Mader, A. W., Richmond, R. K., Sargent, D. F., and Richmond, T. J. (1997) Crystal structure of the nucleosome core particle at 2.8 A resolution, Nature 389, 251-260. Kouzarides, T. (2007) Chromatin modifications and their function, Cell 128, 693-705. Ausio, J. (2006) Histone variants--the structure behind the function, Briefings in functional genomics & proteomics 5, 228-243. Vignali, M., Hassan, A. H., Neely, K. E., and Workman, J. L. (2000) ATP-dependent chromatinremodeling complexes, Molecular and cellular biology 20, 1899-1910. Siegfried, Z., and Simon, I. (2010) DNA methylation and gene expression, Wiley interdisciplinary reviews. Systems biology and medicine 2, 362-371. Duncan, E. M., Muratore-Schroeder, T. L., Cook, R. G., Garcia, B. A., Shabanowitz, J., Hunt, D. F., and Allis, C. D. (2008) Cathepsin L proteolytically processes histone H3 during mouse embryonic stem cell differentiation, Cell 135, 284-294. Mandal, P., Verma, N., Chauhan, S., and Tomar, R. S. (2013) Unexpected histone H3 tail-clipping activity of glutamate dehydrogenase, J Biol Chem 288, 18743-18757. Allis, C. D., Bowen, J. K., Abraham, G. N., Glover, C. V., and Gorovsky, M. A. (1980) Proteolytic processing of histone H3 in chromatin: a physiologically regulated event in Tetrahymena micronuclei, Cell 20, 55-64. Santos-Rosa, H., Kirmizis, A., Nelson, C., Bartke, T., Saksouk, N., Cote, J., and Kouzarides, T. (2009) Histone H3 tail clipping regulates gene expression, Nature structural & molecular biology 16, 17-22. Vossaert, L., Meert, P., Scheerlinck, E., Glibert, P., Van Roy, N., Heindryckx, B., De Sutter, P., Dhaenens, M., and Deforce, D. (2014) Identification of histone H3 clipping activity in human embryonic stem cells, Stem Cell Res 13, 123-134. Falk, M. M., Grigera, P. R., Bergmann, I. E., Zibert, A., Multhaup, G., and Beck, E. (1990) Footand-mouth disease virus protease 3C induces specific proteolytic cleavage of host cell histone H3, Journal of virology 64, 748-756. Tesar, M., and Marquardt, O. (1990) Foot-and-Mouth-Disease Virus Protease-3c Inhibits Cellular Transcription and Mediates Cleavage of Histone-H3, Virology 174, 364-374. Purohit, J. S., Tomar, R. S., Panigrahi, A. K., Pandey, S. M., Singh, D., and Chaturvedi, M. M. (2013) Chicken liver glutamate dehydrogenase (GDH) demonstrates a histone H3 specific protease (H3ase) activity in vitro, Biochimie 95, 1999-2009. Xue, Y., Vashisht, A. A., Tan, Y. L., Su, T., and Wohlschlegel, J. A. (2014) PRB1 Is Required for Clipping of the Histone H3 N Terminal Tail in Saccharomyces cerevisiae, Plos One 9. Howe, C. G., and Gamble, M. V. (2015) Enzymatic cleavage of histone H3: a new consideration when measuring histone modifications in human samples, Clin Epigenetics 7. Tvardovskiy, A., Wrzesinski, K., Sidoli, S., Fey, S. J., Rogowska-Wrzesinska, A., and Jensen, O. N. (2015) Top-down and Middle-down Protein Analysis Reveals that Intact and Clipped Human Histones Differ in Post-translational Modification Patterns, Molecular & cellular proteomics : MCP 14, 3142-3153. Duarte, L. F., Young, A. R., Wang, Z., Wu, H. A., Panda, T., Kou, Y., Kapoor, A., Hasson, D., Mills, N. R., Ma'ayan, A., Narita, M., and Bernstein, E. (2014) Histone H3.3 and its proteolytically processed form drive a cellular senescence programme, Nature communications 5, 5210. Mandal, P., Chauhan, S., and Tomar, R. S. (2014) H3 clipping activity of glutamate dehydrogenase is regulated by stefin B and chromatin structure, Febs J 281, 5292-5308. Su, X. B., and Pillus, L. (2016) Functions for diverse metabolic activities in heterochromatin, Proceedings of the National Academy of Sciences of the United States of America.


Biochemistry

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

20.

21.

22. 23.

24. 25.

26.

27.

28. 29. 30.

31. 32.

33.

34. 35.

36.

Khairalla, A. S., Omer, S. A., Mahdavi, J., Aslam, A., Dufailu, O. A., Self, T., Jonsson, A. B., Georg, M., Sjolinder, H., Royer, P. J., Martinez-Pomares, L., Ghaemmaghami, A. M., Wooldridge, K. G., Oldfield, N. J., and Ala'Aldeen, D. A. A. (2015) Nuclear trafficking, histone cleavage and induction of apoptosis by the meningococcal App and MspA autotransporters, Cell Microbiol 17, 10081020. Kim, K., Punj, V., Kim, J. M., Lee, S., Ulmer, T. S., Lu, W. E., Rice, J. C., and An, W. (2016) MMP-9 facilitates selective proteolysis of the histone H3 tail at genes necessary for proficient osteoclastogenesis, Genes & development 30, 208-219. Chauhan, S., and Tomar, R. S. (2015) Efficient expression and purification of biologically active human cystatin proteins, Protein expression and purification 118,10-17. Ceru, S., Konjar, S., Maher, K., Repnik, U., Krizaj, I., Bencina, M., Renko, M., Nepveu, A., Zerovnik, E., Turk, B., and Kopitar-Jerala, N. (2010) Stefin B interacts with histones and cathepsin L in the nucleus, J Biol Chem 285, 10078-10086. Shechter, D., Dormann, H. L., Allis, C. D., and Hake, S. B. (2007) Extraction, purification and analysis of histones, Nature protocols 2, 1445-1457. Hewish, D. R., and Burgoyne, L. A. (1973) Chromatin sub-structure. The digestion of chromatin DNA at regularly spaced sites by a nuclear deoxyribonuclease, Biochemical and biophysical research communications 52, 504-510. Grillo, C., Coppari, S., Turano, C., and Altieri, F. (2002) The DNA-binding activity of protein disulfide isomerase ERp57 is associated with the a(') domain, Biochemical and biophysical research communications 295, 67-73. Tanaka, Y., Tawaramoto-Sasanuma, M., Kawaguchi, S., Ohta, T., Yoda, K., Kurumizaka, H., and Yokoyama, S. (2004) Expression and purification of recombinant human histones, Methods 33, 3-11. Edmondson, D. G., Smith, M. M., and Roth, S. Y. (1996) Repression domain of the yeast global repressor Tup1 interacts directly with histones H3 and H4, Genes & development 10, 1247-1259. Gardner, K. E., Zhou, L., Parra, M. A., Chen, X. A., and Strahl, B. D. (2011) Identification of Lysine 37 of Histone H2B as a Novel Site of Methylation, Plos One 6. Mandal, P., Azad, G. K., and Tomar, R. S. (2012) Identification of a novel histone H3 specific protease activity in nuclei of chicken liver, Biochemical and biophysical research communications 421, 261-267. Green, G. D., Kembhavi, A. A., Davies, M. E., and Barrett, A. J. (1984) Cystatin-like cysteine proteinase inhibitors from human liver, The Biochemical journal 218, 939-946. Stubbs, M. T., Laber, B., Bode, W., Huber, R., Jerala, R., Lenarcic, B., and Turk, V. (1990) The refined 2.4 A X-ray crystal structure of recombinant human stefin B in complex with the cysteine proteinase papain: a novel type of proteinase inhibitor interaction, The EMBO journal 9, 19391947. Pol, E., and Bjork, I. (2001) Role of the single cysteine residue, Cys 3, of human and bovine cystatin B (stefin B) in the inhibition of cysteine proteinases, Protein science : a publication of the Protein Society 10, 1729-1738. Lehesjoki, A. E. (2003) Molecular background of progressive myoclonus epilepsy, The EMBO journal 22, 3473-3478. Pol, E., and Bjork, I. (2003) Contributions of individual residues in the N-terminal region of cystatin B (stefin B) to inhibition of cysteine proteinases, Biochimica et biophysica acta 1645, 105-112. Goll, M. G., and Bestor, T. H. (2002) Histone modification and replacement in chromatin activation, Genes & development 16, 1739-1742.


Page 20 of 41

Page 21 of 41

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

37.

38.

39. 40. 41. 42.

Dhaenens, M., Glibert, P., Lambrecht, S., Vossaert, L., Van Steendam, K., Elewaut, D., and Deforce, D. (2014) Neutrophil Elastase in the capacity of the "H2A-specific protease", Int J Biochem Cell B 51, 39-44. Ng, H. H., Feng, Q., Wang, H. B., Erdjument-Bromage, H., Tempst, P., Zhang, Y., and Struhl, K. (2002) Lysine methylation within the globular domain of histone H3 by Dot1 is important for telomeric silencing and Sir protein association, Genes & development 16, 1518-1527. Mersfelder, E. L., and Parthun, M. R. (2006) The tale beyond the tail: histone core domain modifications and the regulation of chromatin structure, Nucleic acids research 34, 2653-2662. Xu, F., Zhang, K., and Grunstein, M. (2005) Acetylation in histone H3 globular domain regulates gene expression in yeast, Cell 121, 375-385. Bannister, A. J., and Kouzarides, T. (2011) Regulation of chromatin by histone modifications, Cell research 21, 381-395. Lalonde, M. E., Cheng, X., and Cote, J. (2014) Histone target selection within chromatin: an exemplary case of teamwork, Genes & development 28, 1029-1041.


Biochemistry

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 22 of 41

Figure legends Figure1. Histone H3 protease sequentially cleaves recombinant human histone H3 (expressed in bacteria) at three sites and at two sites on histone H3 isolated from chicken and S. cerevisiae. (A) Western blotting of human histone H3 variants (H3.1, H3.2, H3.3 and H3t) after clipping with H3 protease. (B) I. Clipping analysis of recombinant human histone H3 (H3.2) by SDS-PAGE, followed by western blotting. II. SDSPAGE analysis and western of recombinant human histone H3 after time point clipping of H3 by H3 protease. (C) I. Activity assay with chicken core histones analysed by SDS-PAGE and western. II. Time point activity assay with chicken core histones examined by SDS-PAGE and western. (D) I and II present activity assay and time point activity assay of yeast core histones. (E). Diagrammatic representation of how H3 protease works on (I) recombinant unmodified histone H3 and (II) modified histone H3. The – and + sign indicates absence and presence of H3 protease respectively in the clipping reaction. Band 1, 2 and 3 indicates clipping products. Anti-histone H3 C-terminal antibody was used to detect clipping products by western blotting. Figure2. Proteolytic clipping of recombinant human histone H3 is regulated by globular domain. Clipping assays were performed with GST-tagged N-terminal tail of H3, GST-tagged globular domain of H3, histone H4 and fusion protein of histone H3 and H4. (A) Schematic representation of fusion proteins showing the location of mutations. (B) SDS-PAGE analysis of clipping products obtained after activity assay with mutants mentioned in table 2A, recombinant histone H3 and histone H4. Protease activity assay of GST-tagged globular domain of H3 was further analysed with western (anti H3 C-terminal antibody). (C). Schematic shows truncation mutants of H3 globular domain and the number of products obtained after clipping of respective mutants by H3 protease. (D) Western blotting analysis of H3 globular domain mutant proteins (after clipping) listed in ‘C’ using anti H3 C-terminal antibody. The – and + sign indicates absence and presence of H3 protease respectively. Arrows indicate clipping products of respective fusion protein. Figure3. Proteolytic clipping of histone H3 is regulated by length of histone H3 tail and post-translational modifications. Clipping assays were performed with recombinant human histone H3, post-translational modified yeast histone H3 and their mutants as listed in A, C, E, G and M. (A) Schematics of WT and truncation mutants of H3 and the number of clipping products detected after clipping with H3 protease. (B) Recombinant histone H3 and its truncation mutants are cleaved by H3 protease at three sites except ∆1-6 H3 mutant. (C). List of ∆1-26 H3 mutant in combination with other truncations and number of cleaved bands detected after clipping. (D) Detection of cleaved bands by western blotting of mutants listed in ‘C’ after incubation with H3 protease which resulted in one clipping product. (E) Table


Page 23 of 41

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

representing long truncations from N-terminal tail of histone H3. (F) Incubation of mutants listed in ‘E’ with H3 protease, mutants (1, 2 and 3) resulted in 2 clipping products and their combination mutants (4, 5 and 6) in 1 clipping product. (G-H) Clipping of histones, isolated from wild-type and mutant Saccharomyces cerevisiae strains, by H3 protease. In figure 3(G) different colour markings on schematic of N-terminal tail of histone H3 represents different post translational modifications. (I). Time point activity assays with histones, isolated from wild-type and mutant S. Cerevisiae strains by histone H3 protease. (J) Activity assay with ∆1-32 mutant of yeast histone H3. (K) Activity assays with yeast histone H3 mutants where lysine at 9,14,18,23 positions converted into alanine, glutamine and arginine. (L) Activity assays with K to R yeast mutants of histone H3 at positions 4, 9, 14, 18, 23, 27, 36, 37 and 42. (M) Table shows arginine (R) and lysine (K) to alanine (A) mutations. These constructs were expressed in bacteria to make recombinant histone H3 and tested for clipping by H3 protease. (N). Western blotting to detect cleaved products of all mutants described in table-3(M) using anti H3 antibody specific for Cterminal end. The – and + sign indicates absence and presence of H3 protease in the reaction. Figure4. The QVVAG sequence and C-terminal end of stefin B are required for inhibition of H3 protease activity. To examine inhibition property of stefin B, assays were performed by incubation of core histones isolated from chicken brain with protease and stefin B inhibitor and H3 clipping was analysed by running whole reaction mix on SDS-PAGE. (A) Assays performed with wild-type stefin B, and mutant stefin B; (B) C3S, (C) G4R, (D) Q46N, (E) V47A, (F) V48A, (G) A49V, (H) G50A, (I) ∆13 from N-terminus, (J) ∆10 from C-terminus, (K) ∆QVVAG and (L) QVVAG to AAAAA. Inhibition of H3 clipping was quantified by densitometry of H3 band using ImageJ software. Disappearance of H3 band in gel indicates ‘NO’ inhibition and appearance of means inhibition of H3 clipping. Arrow indicates position of mutations created. The – and + sign indicates absence and presence of H3 protease in the reaction. Figure5. Stefin B interacts with H3 protease and QVVAG sequence plays a crucial role in stefin Bprotease interaction. Recombinant His-tagged histone H3 was immobilized on Ni-NTA column. Protease, stefin B (WT and mutant) and combination of stefin B and protease were allowed to bind with immobilized H3. Clipping of H3 was analysed by SDS-PAGE with fractions of each chromatography. (A) Recombinant H3 conjugated affinity chromatography fractions of stefin B. In vitro activity assays of histone H3 with fractions of (B) Only protease. (C) Only stefin B. (D) Combination of protease and stefin B together. (E) ∆QVVAG mutant of stefin B. (F) ∆QVVAG stefin B and protease together. Exogenous protease was added for clipping assays with fractions of WT stefin B and ∆QVVAG stefin B columns. Western blotting using anti-Glud1 antibody was performed with the fractions of ∆QVVAG stefin B and protease together. ‘C’ stands for salt control, which is used to show inhibitory effect of salt on H3 protease activity. Elutions were performed with 300 mM and 500 mM NaCl containing buffer. For


Biochemistry

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 24 of 41

quantification of intact H3, ImageJ software was used. Un-undigested, In-Input for column, W1-First wash, W-Last wash. Dig -Positive control for clipping. E1 -Elution 1, E2- Elution 2. Figure6. Model of histone H3 clipping by H3 protease (H3p). Sequential clipping of (A) recombinant histone H3, (B) chicken histone H3 and (C) S. cerevisiae histone H3 and their mutants (C and D). Different colour dots on N-terminal tail of histone H3 represent post-translational modifications. (E) Length of histone H3 N-terminal tail affects H3 protease clipping activity. (F) Globular domain (75-85 and 117-127) affects H3 clipping. Protease does not cleave into globular domain of histone H3. (G) Point mutations of arginine and lysine together to alanine in recombinant histone H3 affects H3 clipping activity of H3 protease but weakly. (H) QVVAG sequence of stefin B is required for inhibition of H3 protease activity.


Page 25 of 41

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

Table 1. Primers used for cloning and site directed mutagenesis (point mutations and truncation mutations) of stefin B. S.No.

Primers

Sequence

1.

EcoRI stefin B Forward

CTGAATTCATGATGTGCGG

2.

XhoI stefin B Reverse

GTCTCGAGTCAGAAATAGGTCA

3.

SB C3S Forward

TCCATGATGAGCGGGGCGCCCTCCGC

4.

SB C3S Reverse

GGGCGCCCCGCTCAT CATGGATCCGC

5.

SB G4R Forward

CCATGATGTGCAGGGCGCCCTCCGCC

6.

SB G4R Reverse

GAGGGCGCCCTGCACATCATGGATCCG

7.

SB Q46N Forward

CAAGAGCAACGTGGTCGCGGGGACAAAC

8.

SB Q46N Reverse

CGCGACCACGTTGCTCTTGAATGACACG

9.

SB V47A Forward

CAAGAGCCAGGCGGTCGCGGGGACAAAC

10.

SB V47A Reverse

GTCCCCGCGACCGCCTGGCTCTTGAATGAC

11.

SB V48A Forward

GAGCCAGGTGGCGGCGGGGACAAACTACTTC

12.

SB V48A Reverse

GTTTGTCCCCGCCGCCACCTGGCTCTTGAATG

13.

SB A49V Forward

CCAGGTGGTCGTGGGGACAAACTACTTCATC

14.

SB A49V Reverse

GTTTGTCCCCACGACCACCTGGCTCTTGAATG

15.

SB G50A Forward

GGTGGTCGCGGCGACAAACTACTTCATCAAG

16.

SB G50A Reverse

GAAGTAGTTTGTCGCCGCGACCACCTGGCTC

17.

SB∆QVVAG Forward

CATTCAAGAGCACAAACTACTTCATCAAGGTGC

18.

SB∆QVVAG Reverse

GTAGTTTGTGCTCTTGAATGACACGGCCTTAAAC

19.

SB∆QVVAG to AAAAA Forward

CATTCAAGAGCGCGGCGGCCGCGGCGACAAACTACTTCATCAAGGTGC

20.

SB∆QVVAG to AAAAA Reverse

GTAGTTTGTCGCCGCGGCCGCCGCGCTCTTGAATGACACGGCCTTAAAC

21.

∆C terminus SB Forward

CTGAATTCATGATGTGCGG

22.

∆C terminus SB Reverse

CTCTCGAGTCAGTTGGTCTGGTAG

23.

∆N terminus SB Forward

CTGAATTCATGGCCGAGACCCAG

24.

∆N terminus SB Reverse

CTCTCGAGTCAGAAATAGGTCAG


Biochemistry

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 26 of 41

Table 2. Primers used for cloning and site directed mutagenesis (point mutations, truncation mutations and fusion proteins) in histone H3.

S.No.

Primers

Sequences

1.

∆1 - 6 Forward

GCCATATGGCTCGGAAATCCACCGGC

2.

∆1 - 6 Reverse

GCGGATCCTACGCTCTTTCTCCGCG

3.

∆7 - 12Forward

CGTACTAAACAGACAGGTAAAGCGCCACGCAAGCAG

4.

∆7 - 12 Reverse

GCGTGGCGCTTTACCTGTCTGTTTAGTACGAGCC

5.

∆13 - 17 Forward

GGAAATCCACCGGCAAGCAGCTGGCTACCAAGGC

6.

∆13 - 17 Reverse

GTAGCCAGCTGCTTGCCGGTGGATTTCCGAGCTG

7.

∆18 - 22 Forward

GTAAAGCGCCACGCAAGGCTGCTCGCAAGAGCGCG

8.

∆18 - 22 Reverse

CTTGCGAGCAGCCTTGCGTGGCGCTTTACCGCCGG

9.

∆23 - 28 Forward

GCAGCTGGCTACCGCGCCGGCTACCGGCGGCGTG

10.

∆23 - 28 Reverse

CGGTAGCCGGCGCGGTAGCCAGCTGCTTGCGTGG

11.

∆29 - 34 Forward

GCTCGCAAGAGCGTGAAAAAGCCTCACCG

12.

∆29 - 34 Reverse

GGCTTTTTCAC GCTCTTGCGAGCAGCCTTG

13.

∆29 -33 Reverse

GGCTTTTTCACGCCGCTCTTGCGAGCAGCCTTG

14.

∆35 - 40 Forward

GCTACCGGCGGCTACCGCCCGGGCACTGTG

15.

∆35 - 40 Reverse

GCCCGGGCGGTAGCCGCCGGTAGCCGGCGC

16.

∆41 - 44 Reverse

CAGAGCCACAGT ACGGTGAGGCTTTTTC

17.

∆45 -50 Forward

CCGCCCGGGCATCCGCCGCTACCAAAAG

18.

∆45 -50 Reverse

GTAGCGGCGGATGCCCGGGCGGTAACG

19.

∆51 -55 Forward

GCTCTGCGCGAGAAGTCGACTGAGTTGCTG

20.

∆51 -55 Reverse

CTCAGTCGACTTCTCGCGCAGAGCCACAGTG

21.

∆45 -55 Forward

CGTTACCGCCCGGGCAAGTCGACTGAGTTGCTGATTCGG

22.

∆45 -55 Reverse

CAACTCAGTCGACTTGCCCGGGCGGTAACGGTGAGGCTT

23.

∆56- 64 Forward

GAGATCCGCCGCTACAAGCTGCCGTTCCAGCGC

24.

∆56- 64 Reverse

CTGGAACGGCAGCTT GTAGCGGCGGATCTCGCGCAG

25.

∆65- 74 Forward

GAGTTGCTGATTCGGATCGCCCAAGACTTCAAGACCG

26.

∆65- 74 Reverse

GTCTTGGGCGAT CCGAATCAGCAACTCAGTCGACTTTTG

27.

∆75- 85 Forward

GGTGCGAGAACAGAGCTCTGCGGTG

28.

∆75- 85 Reverse

CAGAGCTCTG TTCTCGCACCAGGCG

29.

∆86-96 Forward

GACCGATCTTCGCTTCAGCGAGGCCTACTTGGTAGGGCTC


Page 27 of 41

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

30.

∆86-96 Reverse

CAAGTAGGCCTCGCT GAAGCGAAGATCGGTCTTGAAGTCTTGGGC

31.

∆97-107 Forward

GCGCTGCAGGAGGCTACAAACCTTTGCGCCATCCATGCTAAGCG

32.

∆97-107 Reverse

GGCGCAAAGGTTTGT AGCCTCCTGCAGCGCCATCACCGC

33.

∆108-116 Forward

CTCTTTGAGGACCGAGTGACTATTATGCCC

34.

∆108-116 Reverse

CATAATAGTCACTCG GTCCTCAAAGAGCCCTAC

35.

∆117-127 Forward

CATCCATGCTAAGGCTCGCCGCATTCGCGG

36.

∆117-127 Reverse

GAATGCGGCGAGC CTTAGCATGGATGGCGCAAAG

37.

∆128-136 Forward

CCAAAGACATCCAGCTCTAGGATCCTCTAGAGTCGACCTGCAG

38.

∆128-136 Reverse

CGACTCTAGAGGATCCTA GAGCTGGATGTCTTTGGGCATAATAGTCACTCGC

39.

∆1-26 Forward

GCCATATGAAGAGCGCGCCGGCTAC

40.

∆1-26 Reverse


41.

∆1-26 ∆29-34 Forward

CATATGAAGAGCGTGAAAAAGCCTCACCGTTACCGCCCG

42.

∆1-26 ∆29-34 Reverse

GTGAGGCTTTTTCACGCTCTTCATATGGCTGCCGCGC

44.

∆1-12 Forward

GCCATATGGGTAAAGCGCCACGCAAGCAG

45.

∆1-12 Reverse


46.

∆23-33 Forward

CCACGCAAGCAGCTGGCTACCGGCGTGAAAAAGCCTCACCGTTACCGCCCG

47.

∆23-33 Reverse

CGGTGAGGCTTTTTCACGCC GGTAGCCAGCTGCTTGCGTGGCGCTTTAC

48.

∆23-34 Forward

CCACGCAAGCAGCTGGCTACCGTGAAAAAGCCTCACCGTTACCGCCCG

49.

∆23-34 Reverse

CGGTGAGGCTTTTTCACGGTAGCCAGCTGCTTGCGTGGCGCTTTAC

50.

∆35 - 44 Forward

GCTACCGGCGGCACTGTGGCTCTGCGCGAGATC

51.

∆ 35 - 44 Reverse

CAGAGCCACAGTGCCGCCGGTAGCCGGCGC

52.

∆1- 6,23- 44 H3 Forward

CTGGCTACCACTGTGGCTCTGCGC

53.

∆1- 6,23- 44H3 Reverse

GAGCCACAGTGGTAGCCAGCTGCTTGCG

54.

XhoI H3 GD Forward

GCCTCGAGACTGTGGCTCTGC

55.

BamHI H3 GD Reverse

GCGGATCCCTACGCTCTTTCTCC

56.

NdeI H4 NT Forward

GCCATATGTCTGGTCGTGGTAAAG

57.

XhoI H4 NT Reverse

GCCTCGAGCTTGGTGATACCC

58.

H431XhoIH3 GD Forward

GGTATCACCAAGACTGTGGCTCTGCGC

59.

H431XhoIH3 GD Reverse

GAGC CACAGTCTTGGTGATACCCTGGATG

60.

XhoI H4 GD Forward

GCCTCGAGCCGGCTATCCGTCGTC

61.

BamHI H4 GD Reverse

GCGGATCCTTAACCACCGAAACCGTACAGGGTAC


Biochemistry

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 28 of 41

62.

NdeI H3 44 NT Forward

GCCATATGGCTCGTACTAAACAGACAGCTCGG

63.

XhoI H3 44 NT Reverse

GACTCGAGGCCCGGGCGG

64.

1- 44 H3 XhoI H4Forward

CGCCCGGGCAAACCGGCCATTCGTCGC

65.

1- 44 H3 XhoI H4 Reverse

GGCCGGTTTGCCCGGGCGGTAACGGTG

66.

NdeI H4 GD Forward

GCCATATGCCGGCTATCCGTCGTCTG

67.

XhoI H4 GD Reverse

GCCTCGAGACCACCGAAACCGTACAG

68.

XhoI H3 44 Forward

GCCTCGAGGCTCGTACTAAACAGACAGCTC

69.

BamHI H3 44 Reverse

GCGGATCCTTAGCCCGGGCGG

70.

H4GD XhoI H3 44 Forward

GGTTTCGGTGGTGCTCGTACTAAACAGACAGCTCGG

71.

H4GD XhoI H3 44 Reverse

CTGTTTAGTACGAGCACCACCGAAACCGTACAGGGTACGACC

72.

EcoRI NH3 Forward

GCGAATTCATGGCTCGTACTAAACAGACAGC

73.

XhoI NH3 Reverse

GCCTCGAGCTAGCCCGGGC

74.

EcoRI NH3 Forward

GCCGAATTCATGGCTCGTACTAAACAGACAGCTCGGAAATCC

75.

HindIII NH3 Reverse

GCAAGCTTGCCCGGGCGGTAACG

76.

HindIII GST Forward

GCCAAGCTTAGCGGAAGTGGCAGCGGAATGTCCCCTATACTAGGTTATTG

77.

XhoI GST Reverse

GCCTCGAGTTATTTTGGAGGATGGTCGCCACCACCAAACGTGG

78.

EcoRI GDH3 FP

GCGAATTCATGACTGTGGCTCTGCGC

79.

XhoI GDH3 RP

GCCTCGAGCTACGCTCTTTCTCCGCG

80.

RK8,9AA Forward

CTAAACAGACAGCTGCGGCATCCACCGGCGGTAAAGCG

81.

RK8,9AA Reverse

CCGCCGGTGGATGCCGCAGCTGTCTGTTTAGTACG

82.

RK17,18AA Forward

GTAAAGCGCCAGCCGCGCAGCTGGCTACCAAG

83.

RK17,18AAReverse

GCCAGCTGCGCGGCTGGCGCTTTACC

84.

RK26,27AAForward

CAAGGCTGCTGCCGCGAGCGCGCCGGCTAC

85.

RK63,64AAForward

CTGAGTTGCTGATTGCGGCGCTGCCGTTCCAGCGCC

86.

RK63,64AAReverse

GCTGGAACGGCAGCGCCGCAATCAGCAACTCAGTCGACTTTTG


Page 29 of 41

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

Table 3.Yeast strains used in this study

S.No.

Strains

1.

WT histone H3

2.

H3 ∆1-12

3.

H3 ∆13-20

4.

H3 ∆21-36

5.

H3 ∆1-32

6.

H3 K9,14,18,23R

7.

H3 K9,14,18,23Q

8.

H3 K9,14,18,23A

9.

H3 K4R

10.

H3 K9R

11.

H3 K14R

12.

H3 K18R

13.

H3 K23R

14.

H3 K27R

15.

H3K36R

16.

H3 K37R

17.

H3 K42R

Genotypes MATa his3Δ200 leu2Δ0 lys2Δ0 trp1Δ63 ura3Δ0 met15Δ0 can1::MFA1pr-HIS3 hht1hhf1::NatMX4 hht2-hhf2::[HHTS-HHFS]-URA3 MATa his3Δ200 leu2Δ0 lys2Δ0 trp1Δ63 ura3Δ0 met15Δ0 can1::MFA1pr-HIS3 hht1hhf1::NatMX4 hht2-hhf2::[HHTS ∆1-12-HHFS]-URA3 MATa his3Δ200 leu2Δ0 lys2Δ0 trp1Δ63 ura3Δ0 met15Δ0 can1::MFA1pr-HIS3 hht1hhf1::NatMX4 hht2-hhf2::[HHTS ∆13-20-HHFS]-URA3 MATa his3Δ200 leu2Δ0 lys2Δ0 trp1Δ63 ura3Δ0 met15Δ0 can1::MFA1pr-HIS3 hht1hhf1::NatMX4 hht2-hhf2::[HHTS ∆21-36-HHFS]-URA3 MATa his3Δ200 leu2Δ0 lys2Δ0 trp1Δ63 ura3Δ0 met15Δ0 can1::MFA1pr-HIS3 hht1hhf1::NatMX4 hht2-hhf2::[HHTS ∆1-32-HHFS]-URA3 MATa his3Δ200 leu2Δ0 lys2Δ0 trp1Δ63 ura3Δ0 met15Δ0 can1::MFA1pr-HIS3 hht1hhf1::NatMX4 hht2-hhf2::[HHTS K9,14,18,23R-HHFS]-URA3 MATa his3Δ200 leu2Δ0 lys2Δ0 trp1Δ63 ura3Δ0 met15Δ0 can1::MFA1pr-HIS3 hht1hhf1::NatMX4 hht2-hhf2::[HHTS K9,14,18,23Q-HHFS]-URA3 MATa his3Δ200 leu2Δ0 lys2Δ0 trp1Δ63 ura3Δ0 met15Δ0 can1::MFA1pr-HIS3 hht1hhf1::NatMX4 hht2-hhf2::[HHTS K9,14,18,23A-HHFS]-URA3 MATa his3Δ200 leu2Δ0 lys2Δ0 trp1Δ63 ura3Δ0 met15Δ0 can1::MFA1pr-HIS3 hht1hhf1::NatMX4 hht2-hhf2::[HHTS K4R-HHFS]-URA3 MATa his3Δ200 leu2Δ0 lys2Δ0 trp1Δ63 ura3Δ0 met15Δ0 can1::MFA1pr-HIS3 hht1hhf1::NatMX4 hht2-hhf2::[HHTS K9R-HHFS]-URA3 MATa his3Δ200 leu2Δ0 lys2Δ0 trp1Δ63 ura3Δ0 met15Δ0 can1::MFA1pr-HIS3 hht1hhf1::NatMX4 hht2-hhf2::[HHTS K14R-HHFS]-URA3 MATa his3Δ200 leu2Δ0 lys2Δ0 trp1Δ63 ura3Δ0 met15Δ0 can1::MFA1pr-HIS3 hht1hhf1::NatMX4 hht2-hhf2::[HHTS K18R-HHFS]-URA3 MATa his3Δ200 leu2Δ0 lys2Δ0 trp1Δ63 ura3Δ0 met15Δ0 can1::MFA1pr-HIS3 hht1hhf1::NatMX4 hht2-hhf2::[HHTS K23R-HHFS]-URA3 MATa his3Δ200 leu2Δ0 lys2Δ0 trp1Δ63 ura3Δ0 met15Δ0 can1::MFA1pr-HIS3 hht1hhf1::NatMX4 hht2-hhf2::[HHTS K27R-HHFS]-URA3 MATa his3Δ200 leu2Δ0 lys2Δ0 trp1Δ63 ura3Δ0 met15Δ0 can1::MFA1pr-HIS3 hht1hhf1::NatMX4 hht2-hhf2::[HHTS K36R-HHFS]-URA3 MATa his3Δ200 leu2Δ0 lys2Δ0 trp1Δ63 ura3Δ0 met15Δ0 can1::MFA1pr-HIS3 hht1hhf1::NatMX4 hht2-hhf2::[HHTS K37R-HHFS]-URA3 MATa his3Δ200 leu2Δ0 lys2Δ0 trp1Δ63 ura3Δ0 met15Δ0 can1::MFA1pr-HIS3 hht1hhf1::NatMX4 hht2-hhf2::[HHTS K42R-HHFS]-URA3


Figure 1

Biochemistry H3.2

H3.1

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42

(A).

H3p

−

−

+

H3.3

+

−

Page 30 of 41

H3t

+

−

+ α C terminal H3

Time point activity assay

(B). (I)

rH3

H3p

− +

+

rH3

(II)

−

+

-

rH3

Band 1 Band 2 Band 3

(E).

Recombinant H3

(I)

Coomassie

Western

rH3

H3p

Band 1

H3

Band 2 α C terminal H3

H3

Band 3

H3

Time point activity assay

(C). Chicken core

(I) histones H3p H3 H2B H2A H4

−

+

Chicken core histones −

+

(II)

-

H3 H2B H2A H4

H3

+ (II)

Post translational modified H3 H3p H3

Band 1 Band 2 Coomassie

Western α C terminal H3

Yeast core histones

(D). (I)

H3p −

(II) +

Time point activity assay +

α C terminal H3 ACS Paragon Plus Environment

H3 H3

PageFigure 31 of 241

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42

Biochemistry

(A). Diagrammatic representation of H3 mutants

No.

Chimeric protein (H3 and H4)

Bands after clipping

1.

H3 tail GST

Weak clipping

2.

GST H3 tail

Weak clipping

GST

H3(1-44)

3.

GST H3 globular domain

-

GST

H3

4.

H3(1-44)+GD of H4

3

5.

H4 (1-31)+GD of H3

1

6.

H4 of GD+ H3(144)

2

GST

H3(1-44)

H4

H3 (1-44)

H3

H4 (1-31)

H3 (1-44)

H4

(B). H3 H3p

−

+

2

1 −

+

−

3

3 +

−

+

−

−

5

H4

4

+

+


−

+

−

6 +

−

+

Figure 2 continues..

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42

Biochemistry

Page 32 of 41

(C) No.

Histone H3 and it’s mutants


1.

∆45 -50

3

α1

α2

α3

(X=∆45-50)

2.

∆51-55

3

α1

α2

α3

(X=∆51-55)

3.

∆56-64

3

αN

α1

α2

α3

(X=∆56-64)

4.

∆65-74

3

αN

α2

α3

(X=∆65-74)

5.

∆75-85

0

αN

α2

α3

(X=∆75-85)

6.

∆86-96

3

αN

α1

α3

(X=∆86-96)

7.

∆97-107

3

αN

α1

α3

(X=∆97-107)

8.

∆108-116

3

αN

α1

α3

(X=∆108-116)

9.

∆117-127

0

αN

α1

α2

(X=∆117-127)

10.

∆128-136

clipped

αN

α1

α2

(X=∆128-136)

(D)

1 H3p

−

2 +

−

Diagrammatic representation of H3 mutants

H3

+

−

+

4

3 −

+

−

+

−

+

−

8

7

6

5

+

−


+

−

10

9 +

−

+

−

+

Figure 3. Page 33 of 41 (A). Histone No.

1 2 3 1. 4 5 2. 6 7 8 3. 9 10 4. 11 12 5. 13 14 6. 15 16 7. 17 18 8. 19 20 9. 21 22 23 C). 24No. 25 26 27 1. 28 29 2. 30 31 32 3. 33 34 4. 35 36 37 5. 38 39 6. 40 41 7. 42

H3 and it’s mutants

Biochemistry Bands after clipping

(B).

Diagrammatic representation of H3 mutants 1

2

H3p −

WT H3

3

∆1- 6

2

∆7-12

3

∆1-6 ∆7-12

αN

α1

α2

α3

αN

α1

α2

α3

αN

α1

α2

α3

+

−

3

∆18-22

3

∆23-28

3

∆29-34

3

∆35- 40

3

∆41- 44

3

Histone H3 mutants


∆1-26

1

∆1-26

∆1-26, ∆29-34

1

∆1-26

∆1-26, ∆35- 40

1

∆ 1-26

∆1-26, ∆41- 44

1

∆ 1-26

∆1-26, ∆45 -50

1

∆ 1-26

∆1-26, ∆51-55

1

∆ 1-26

∆1-26, ∆45- 55

1

∆13-17 ∆18-22

∆23-28 ∆29-34 ∆35-40 ∆41-44

αN

α1

α2

α3

αN

α1

α2

α3

αN

α1

α2

α3

αN

α1

α2

α3

αN

α1

α2

α3

αN

α1

α2

α3

−

+

−

−

H3p

α1

α2

α3

αN

α1

α2

α3

∆ 1-26

αN

α1

α2

α3

αN

α1

α2

α3

α1

α2

α3

α1

α2

α3

α1

α2

α3

Y

ACS Paragon Plus Environment Z

−

+

7 +

−

+

9 +

−

2

1

αN

X

+

6

+

−

+

3 +

H3p

−

(X=∆45-50) (Y=∆51-55) (Z=∆45-55)

−

4 +

6

5

∆41-44

−

8

H3p −

∆35-40

4

(D).


∆ 29-34

+

5 H3p

∆13-17

3

+

−

−

7 +

−

+

+

Figure 3 continues..

E).

1 No.

Histone H3 mutants

Biochemistry Bands after clipping

2 3 ∆1-12 2 ∆1-12 4 1. 5 6 2. ∆23-34 2 7 8 ∆35- 44 2 9 3. 10 ∆1- 6 ∆23114. 1 ∆1-6 34 12 13 ∆1-12 1 ∆1-12 145. ∆23-33 15 ∆1- 6 ∆23166. 1 ∆ 1-6 44 17 18 S. Bands G).19No. 20 cerevisiae after 21 H3 and clipping it’s 22 mutants 23 24 H3 1 25 1. 26 27 2. ∆1-12 1 ∆1-12 28 29 ∆13-20 1 30 3. 31 32 4. ∆21-36 1 33 34 35 36 37 (L). K4R K14R K18R K9R 38 H3p − + − + − + − + 39 40 41 42

Page 34 of 41 1

(F).


H3p

αN

α1

α2

α3

αN

α1

α2

α3

αN

α1

α2

α3

∆23-34

αN

α1

α2

α3

∆23-33

αN

α1

α2

α3

αN

α1

α2

α3

+

∆35-44

∆ 23-44

H3p −

+

−

(H). 1 H3p −

−

−

+

2 +

−

+

5

4

3 ∆23-34

2

−

6 +

−

+

4

3 +

−

+

−

+

Diagrammatic representation of H3 mutants +

(I). -

∆13-20

∆21-36

αN

α1

α2

α3

αN

α1

α2

α3

αN

α1

α2

α3

αN

α1

α2

α3

WT

∆1-12 ∆13-20

∆21-36

K23R

−

+

K27R −

+

K36R −

+

K37R −

+

H3 Tail K-R

K42R

−

+


−

+

(J).

∆1-32

H3p −

+

(K). H3 tail K-A

−

+

H3 tail K-Q −

+

H3 tail K-R − +

Figure 3 continues… Page 35 of 41 (M) Histone H3 and it’s No. mutants 1 2 1. WT H3 3 4 2. RK8,9AA 5 6 3. RK17,18 AA 7 8 4. RK26,27AA 9 10 5. RK63,64AA 11 12 6. RK8,9,17,18AA 13 14 7. RK8,9,26,27AA 15 16 8. RK8.9.63.64AA 17 18 19 9. RK17,18,26,27AA 20 21 10. RK17,18,63,64AA 22 23 11. RK26,27,63,64AA 24 25 12. RK8,9,17,18,26,27AA 26 27 13. RK17,18,26,27,63,64AA 28 29 14. RK8,9,17,18,26,27,63,64AA 30 31 (N). 1 3 4 2 32 H3p − + − + − + − + 33 34 35 36 37 9 11 10 38 − + − + − + 39 40 41 42

Biochemistry Diagrammatic representation of H3 mutants

RK8,9AA RK17,18AA

RK26,27AA

RK8,9AA

RK17,18AA RK26,27AA

RK8,9AA RK8,9AA

RK17,18AA

RK26,27AA

RK17,18AA RK26,27AA RK8,9AA

RK8,9AA

−

−

+

1 −

+

−

−

α3

αN

α1

α2

α3

αN

α1

α2

α3

αN

α1

α2

α3

αN

α1

α2

α3

αN

α1

α2

α3

αN

α1

α2

α3

αN

α1

α2

α3

αN

α1

α2

α3

αN

α1

α2

α3

αN

α1

α2

α3

αN

α1

α2

α3

RK17,18AA

RK26,27AA

αN

α1

α2

α3

RK17,18AA

RK26,27AA

αN

α1

α2

α3

7 +

13 +

α2

RK26,27AA

−

12 +

α1

RK17,18AA

6

1

5

αN

+

−

8 +

−

14 − +


RK63,64AA

+

Figure 4.

(A). Wild type stefin B

Biochemistry (B). C3S stefin B

Page 36 of 41

- - - - - - - - - - - - QVVAG - - - - - - - - - KAKHDELTYF

+ 0.2

0.4

0.6

0.8

1.0

2.0 µg C3S

120

% of intact H3

100 80 60 40

20 0 Un Dig 0.2 0.4 0.6 0.8 1

2

µg of C3S stefin B

- - - - - - - - - -- - NVVAG -- - - - - - - - - KAKHDELTYF

+ 0.2

0.4

0.6

0.8

120 100

% of intact H3

% of intact H3

% of intact H3

1 MCGAPSATQPAT - - - - - - - - - - --QVVAG - - - - - - - - - KAKHDELTYF MSGAPSATQPAT 2 3 + _0.2 0.4 0.6 0.8 1.0 2.0 µg SB 4 H3 5H3 H2B H2B 6 H2A H2A 7 H4 H4 8 9 120 10 100 11 12 80 13 60 14 15 40 16 20 17 0 18 Un Dig 0.2 0.4 0.6 0.8 1 2 19 µg of stefin B 20 (C). G4R stefin B 21 (D). Q46N stefin B 22 MCGAPSATQPAT 23 MCRAPSATQPAT - - - - - - - - - - - -QVVAG - - - - - - - - - KAKHDELTYF 24 + 25 0.2 0.4 0.6 0.8 1.0 2.0 µg G4R 26 H3 H3 27 H2B H2B 28 H2A H2A 29 H4 H4 30 31 120 32 100 33 80 34 35 60 36 40 37 38 20 39 0 ACS Paragon Plus Environment 40 Un Dig 0.2 0.4 0.6 0.8 1 2 41 µg of G4R stefin B 42

80 60

40 20 0 Un Dig 0.2 0.4 0.6 0.8 1 2 µg of Q46N stefin B

1.0

2.0 µg Q46N

Figure 4 continues…. Page 37 of 41 (E). V47A stefin B

Biochemistry (F). V48A stefin B

% of intact H3

% of intact H3

% of intact H3

% of intact H3

1 MCRAPSATQPAT - - - - - - - - - - - QAVAG - - - - - - - - - KAKHDELTYF MCGAPSATQPAT - - - - - - - - - - - QVAAG - - - - - - - - - KAKHDELTYF 2 + + 3 0.2 0.4 0.6 0.8 1.0 2.0 µg V48A 0.2 0.4 0.6 0.8 1.0 2.0 µg V47A 4 H3 H3 5 H2B 6H2B H2A H2A 7 H4 8H4 9 120 120 10 100 11 100 12 80 80 13 60 60 14 40 15 40 16 20 20 17 0 18 0 Un Dig 0.2 0.4 0.6 0.8 1 2 19 Un Dig 0.2 0.4 0.6 0.8 1 2 µg of V48A stefin B 20 µg of V47A stefin B (G). A49V stefin B (H). G50A stefin B 21 22 MCGAPSATQPAT - - - - - - - - - -- QVVAA - - - - - - - - - KAKHDELTYF 23 MCRAPSATQPAT - - - - - - - - - -- QVVVG - - - - - - - - - KAKHDELTYF 24 + + 25 0.2 0.4 0.6 0.8 1.0 2.0 µg A49V 0.2 0.4 0.6 0.8 1.0 2.0 µg G50A 26 H3 H3 27 H2B H2B 28 H2A H2A 29 H4 H4 30 31 120 120 32 33 100 100 34 80 80 35 60 36 60 37 40 40 38 20 20 39 ACS Paragon Plus Environment 40 0 0 41 Un Dig 0.2 0.4 0.6 0.8 1 2 Un Dig 0.2 0.4 0.6 0.8 1 2 42 µg of A49V stefin B µg of G50A stefin B

Figure 4 continues…. (I). ∆13 N-terminus stefin B

Biochemistry (J). ∆10 C-terminus stefin B

Page 38 of 41

100

100

% of intact H3

% of intact H3

33 34 35 36 37 38 39 40 41 42

% of intact H3

% of intact H3

MCGAPSATQPAT - - - - - - - - - - - QVVAG - - - - - - - - - XXXXXXXXXX 1 XXXXXXXXXXXX - - - - - - - - - - - QVVVG - - - - - - - - - KAKHDELTYF 2 + + 3 0.2 0.4 0.6 0.8 1.0 2.0 µg ∆10C ter 0.2 0.4 0.6 0.8 1.0 2.0 µg ∆13 N ter 4 H3 H3 5 H2B H2B 6 H2A H2A 7 H4 H4 8 9 120 120 10 11 100 100 12 80 80 13 60 14 60 15 40 40 16 20 20 17 18 0 0 19 Un Dig 0.2 0.4 0.6 0.8 1 2 Un Dig 0.2 0.4 0.6 0.8 1 2 20 µg of ∆10 C terminus stefin B µg of ∆13 N terminus stefin B 21 (K). ∆QVVAG stefin B 22 (L). QVVAG to AAAAA stefin B 23 MCGAPSATQPAT - - - - - - - - - - AAAAA - - - - - - - - - - KAKHDELTYF 24 MCGAPSATQPAT - - - - - - - - - - XXXXX - - - - - - - - - - KAKHDELTYF 25 + + 26 0.2 0.4 0.6 0.8 1.0 2.0 µg ∆QVVAG 0.2 0.4 0.6 0.8 1.0 2.0 µg QVVAG to 5A 27 H3 H3 28 H2B H2B 29 H2A H2A 30 H4 H4 31 120 120 32

80 60 40 20


0 Un Dig 0.2 0.4 0.6 0.8 1 2 µg of ∆1QVVAG stefin B

80 60 40 20 0

Un Dig 0.2 0.4 0.6 0.8 1 2 µg of QVVAG to 5A stefin B

Test

(B). Protease only

Biochemistry

% of intact H3

1 2 3 4 Un In FT W1 W E1 E2 C E1 E2 H3 H3 5 H2B 6 H2A 7 Stefin B H4 8 120 9 100 10 H3 80 11 H3 protease 60 12 13 40 SB 14 20 ∆QVVAG SB 15 0 16 Un In FT W1 W E1 E2 C E1 E2 C 17 18 Protease and (D). (E). ∆QVVAG stefin B 19 stefin B 20 21 22 23 24 25 Un Dig In FT W1 W E1 E2 C E1 E2 C Un In FT W1 W E1 E2 C E1 E2 C 26 27 28 29 120 120 30 100 31 100 32 80 80 33 60 60 34 40 40 35 20 36 20 0 37 0 Un In FT W1 W E1 E2 C E1 E2 C Un Dig In FT W1 W E1 E2 C E1 E2 C 38 39 ACS Paragon Plus Environment 40 41 42

◊

◊ ◊ ◊ ◊ ◊◊◊

(C). Stefin B only

E1 E2

C

Un In FT W1 W E1 E2 C E1 E2 C

(F). Protease and ∆QVVAG stefin B

Un Dig In FT W1 W E1 E2 C E1 E2 C

H3 H2B H2A H4

120

% of intact H3

% of intact H3

E2 C

◊◊ ◊◊◊

120 100 80 60 40 20 0

◊◊ ◊◊

% of intact H3

◊◊ ◊◊◊

Un Dig FT W1 W E1

C

% of intact H3

Control

Figure 5. (A). In FT W Beads FT W Beads Page 39 of 41

100 80 60 40

20 0 Un Dig In FT W1 W E1 E2 C E1 E2 C In

αGlud1

FT W

E1

E2

C

E1

E2

Figure 6.

Biochemistry (H)

(A)

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42

Page 40 of 41

rH3

H3p

(G)

x3

H3p

Stefin B

rH3 x3

rH3 x3

H3p ∆QVVAG Stefin B

x 2 or x 3 or x4

rH3 RK to AA mutation

x3

(F) H3p

(B)

1

1

2

2

H3p

Chicken H3

H3 protease

x2

GST globular domain of H3 1

(C) Yeast WT H3

(E) H3p

x2 Yeast ∆1-12 H3

H3p

∆75-85 H3

1

2

(D)

Yeast ∆13-20 H3 x2

3

x3 H3p

1

Yeast ∆21-36 H3 x2

2

x2

Yeast K-R H3

x2 1


2

∆117-127 H3

Page 41 of 41

Biochemistry

For table of contents use only 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42

Stefin B X H3 protease

H3 X

Mutant Stefin B


Biochemical Analysis Reveals the Multifactorial ... - ACS Publications

Recommend Documents