Biochemical Characterization of the First Fungal ... - ACS Publications

Article pubs.acs.org/JAFC

Biochemical Characterization of the First Fungal Glycoside Hydrolyase Family 3 β‑N‑Acetylglucosaminidase from Rhizomucor miehei Shaoqing Yang,† Shuang Song,† Qiaojuan Yan,‡ Xing Fu,† Zhengqiang Jiang,*,† and Xinbin Yang† †

Department of Biotechnology, College of Food Science and Nutritional Engineering, and ‡Bioresource Utilization Laboratory, College of Engineering, China Agricultural University, Beijing 100083, China ABSTRACT: A novel β-N-acetylglucosaminidase gene (RmNag) from Rhizomucor miehei was cloned and expressed in Escherichia coli. RmNag shares the highest identity of 37% with a putative β-N-acetylglucosaminidase from Aspergillus clavatus. The recombinant enzyme was purified to homogeneity. The optimal pH and temperature of RmNag were pH 6.5 and 50 °C, respectively. It was stable in the pH range 6.0−8.0 and at temperatures below 45 °C. RmNag exhibited strict substrate specificity for p-nitrophenyl β-N-acetylglucosaminide (pNP-GlcNAc) and N-acetyl chitooligosaccharides. The apparent Km of RmNag toward pNP-GlcNAc was 0.13 mM. The purified enzyme displayed an exo-type manner as it released the only end product of GlcNAc from all the tested N-acetyl chitooligosaccharides. Besides, RmNag exhibited relatively high N-acetyl-β-D-glucosaminide tolerance with an inhibition constant Ki value of 9.68 mM. The excellent properties may give the enzyme great potential in industries. This is the first report on a glycoside hydrolyase family 3 β-N-acetylglucosaminidase from a fungus. KEYWORDS: gene cloning, β-N-acetylglucosaminidase, characterization, Rhizomucor miehei, GH family 3

■

Vibrio furnissii,18 Cellulomonas fimi,19 Symbiobacterium thermophilum,20 Aeromonas hydrophila,21 Paenibacillus sp. TS12,22 Thermotoga maritima,23 Penicillium oxalicum,24 and Penicillum chrysogenum.25 While most of them are from bacteria, there are a few reports on fungal GlcNAcases.15−17,24,25 GlcNAcases have been classified into three major glycoside hydrolyase (GH) families, 3, 20, and 84;26 most of the reported bacterial GlcNAcases belong to the GH family 3. So far, a number of bacterial GH family 3 GlcNAcases have been characterized,5,9,13,18,23 whereas no fungal GH family 3 GlcNAcase has been identified and characterized. Rhizomucor miehei, a type of thermophilic zygomycete, has been reported to produce multiple kinds of hydrolytic enzymes, such as lipase,27 galactosidase,28 and β-1,3−1,4-glucanase.29 However, no GlcNAcase has been ever reported from this species. In this work, we report gene cloning, expression, purification, and biochemical characterization of a first fungal GH family 3 GlcNAcase (RmNag) from R. miehei CAU432 with GlcNAc tolerance.

INTRODUCTION Chitin, composed of β-1,4-linked N-acetylglucosamine (GlcNAc) units, is the second most abundant natural biopolymer derived from exoskeletons of crustaceans and also from cell walls of fungi and insects.1,2 The economic utilization of chitin as a feedstock for the production of value-added products represents a profound shift in industrial carbon utilization.3 Complete enzymatic degradation of chitin requires the synergistic action of two types of chitinolytic enzymes, endo-type chitinase (EC 3.2.1.14) and exo-type β-acetylhexosaminidase, chitobiase, or β-N-acetylglucosaminidase (GlcNAcase, EC 3.2.1.52).4 Chitinase catalyzes the hydrolysis of β-1,4 linkages in chitin polymers, yielding short-chain N-acetyl chitooligosaccharides, while GlcNAcase further hydrolyzes the released oligosaccharides into N-acetylglucosamine (GlcNAc).5 It is well established that accumulation of (GlcNAc)2 inhibits the activities of most chitinases, while GlcNAcases reduce (GlcNAc)2 inhibition by hydrolyzing the disaccharide to GlcNAc, thus allowing the chitinases to act more efficiently.1 GlcNAcases are also known to be key enzymes in the production of various chitin derivatives, such as medicines, functional foods, feed additives, cosmetics, and biopesticides,6−9 and in bacterial cell wall recycling.10 Due to their wide range of industrial applications and important biological functions, GlcNAcases have drawn a great deal of attention in recent years. GlcNAcases are widely distributed in animal tissues,11 insects,12 plants,4 bacteria,9,13,14 and fungi.7,15,16 Among them, microbial enzymes attracted more attention and have been studied extensively because they can be easily scaled up for commercial production. To date, a number of GlcNAcases have been purified and characterized from various microorganisms, such as Clostridium paraputrificus M-21,13 Phoma glomerata,7 and Trichomonas vaginalis.15 Several microbial GlcNAcase genes have also been cloned and expressed, including the genes from Streptomyces thermoviolaceus OPC-520,5 Vibrio harveyi 650,9 © 2014 American Chemical Society

■

MATERIALS AND METHODS

Strains, Vectors, and Chemicals. Rhizomucor miehei CAU432 used in this study has been deposited in the China General Microbiological Culture Collection Center (CGMCC, accession number 4967). Escherichia coli JM109 and BL21 (DE3) (Stratagene, La Jolla, CA) were used for propagation of plasmids and expression of GlcNAcase gene (Stratagene, La Jolla, CA). pET-28a(+) was obtained from Novagen (Madison, WI). The pMD18-T simple vector system was purchased from TaKaRa Corporation (Japan).

Received: Revised: Accepted: Published: 5181

February 20, 2014 May 6, 2014 May 8, 2014 May 8, 2014 dx.doi.org/10.1021/jf500912b | J. Agric. Food Chem. 2014, 62, 5181−5190

Journal of Agricultural and Food Chemistry

Article

Table 1. Oligonucleotide Primers Used in This Study

a

primer

sequencea (5′−3′)

NAGF NAGR NAG5′GSP NAG5′NGSP NAG3′GSP NAG3′NGSP NAGBamHF NAGNotR

TCCGCTATTGATTGCAATTGAYCARGARAAYG TTYGTRAARGGACCCGTACCTCTGTGATG ATCGCTACGTTTCTCGCTGCTGT CGCCCCCAGCGCCATGTTGCC ATGGGCCTGGCTCAAGTTGAAG AGGCTATCAACGAGGAAAAGTTG TAATCGCGGATCCACGGTCGGTAACGATGACAATCTAGAC ATAAGAATGCGGCCGCAAAGTGACCAAGGCGGTAACTTCTC

R = A/G, Y  C/T; restriction sites incorporated into the primers are underlined.

Restriction endonucleases and DNA polymerase LA Taq were purchased from TaKaRa Corporation (Japan). DNA polymerase Pfu was obtained from Promega (Madison, WI). T4 DNA ligase was purchased from New England Biolabs (Ipswich, MA). p-Nitrophenol (pNP), p-nitrophenyl β-gluopyranoside (pNP-Glu), p-nitrophenyl β-galactopyranoside (pNP-Gal), p-nitrophenyl β-N-acetylglucosaminide (pNP-GlcNAc), and p-nitrophenyl β-N-acetylgalactosaminide (pNP-GalNAc) were obtained from Sigma Chemical Co. (St. Louis, MO). All other chemicals used in this study were of analytical grade unless otherwise stated. Cloning of Full-Length cDNA of a GlcNAcase and Sequence Analysis. DNA manipulations were performed as described by Sambrook and Russell.30 Genomic DNA was isolated from R. miehei CAU432 mycelia by the CTAB method.31 Total RNA was isolated by use of the Trizol kit (Invitrogen, Carlsbad, CA), and mRNAs were purified by use of the Oligotex mRNA midi kit (Qiagen, Germany). For mycelia collection, R. miehei CAU432 was cultivated at 50 °C for 2 days in the medium containing (grams per liter) glucose 10, tryptone 10, yeast extract 10, MgSO4·7H2O 0.3, FeSO4 0.3, and CaCl2 0.3, and then the fungal mycelia were collected by centrifugation (5000g, 10 min) and washed twice with sterilized water at 4 °C. Genomic DNA of R. miehei CAU432 was used as template for subsequent polymerase chain reaction (PCR) amplification. To clone the GlcNAcase gene, degenerate primers NAGF and NAGR (Table 1) were designed on the basis of conserved amino acid sequences IAVDQENG and KHFPGHGDT derived from other known GH family 3 GlcNAcases’ sequences by use of the CODEHOP algorithm.32 PCR conditions were as follows: a hot start at 94 °C for 5 min; 20 cycles of 94 °C for 30 s, 65−45 °C for 30 s, and 72 °C for 1 min; followed by 20 cycles of 94 °C for 30 s, 55 °C for 30 s, and 72 °C for 1 min. Target amplifications were TA cloned into pMD18-T vector and sequenced. On the basis of partial sequence information, the SMART RACE cDNA amplification kit (Clontech) was used to clone both 5′ and 3′ ends of the cDNA. For the 5′ RACE, the PCR was performed with primers NAG5′GSP and UPM, which was followed by a nested PCR using nested gene-specific primer NAG5′NGSP and NUP (Table 1). For the 3′ RACE, primers NAG3′GSP and UPM were used, followed by a nested PCR using the nested gene-specific primer NAG3′NGSP and NUP (Table 1). The PCR conditions for RACE were as follows: a hot start at 94 °C for 5 min; followed by 30 cycles of 30 s at 94 °C, 30 s at 60 °C, and 1 min at 72 °C; and finally 10 min at 72 °C. All products were purified, TA cloned, and sequenced. Compiled nucleotide sequences were subjected to BLAST analysis. The GlcNAcase (RmNag) cDNA sequence from R. miehei CAU432 was deposited in the GenBank nucleotide sequence database under accession number KC357713. Nucleotide sequence and its deduced amino acid sequence were analyzed by use of DNAMAN 6.0 software (LynnonBiosoft). Protein sequence was analyzed by SignalP 4.0 server (http://www.cbs.dtu.dk/ services/SignalP/) and Motif Scan (http://myhits.isb-sib.ch/cgi-bin/ motif_scan). BLAST analysis was performed at NCBI server (http:// blast.ncbi.nlm.nih.gov/Blast.cgi). Amino acid sequence alignment was performed by use of the ClustalW2.0 program (http://www.ebi.ac.uk/ Tools/clustalw2/index.html). Heterologous Expression of GlcNAcase Gene in E. coli. The amplified gene (RmNag) products were digested with BamHI and NotI. The resulting fragments were cloned into BamHI/NotI-digested

pET28a(+) expression vector, and the recombinant plasmids were transformed into E. coli BL21(DE3) for protein expression. E. coli BL21(DE3) cells transformed with RmNag were inoculated into LB medium (containing 50 μg/mL kanamycin) and cultured at 37 °C on a rotary shaker (200 rpm) until the optical density OD600 reached about 0.8−1.0. Then isopropyl β-D-thiogalactopyranoside (IPTG) was added to the culture to a final concentration of 1 mM, and the culture was continuously grown at 30 °C for 12 h. Purification of Recombinant GlcNAcase. The cells were centrifuged, suspended in 50 mM phosphate buffer (pH 7.4), and disrupted by ultrasonication. Cell debris was removed by centrifugation at 10000g for 10 min. The supernatant was loaded onto a nickel− iminodiacetic acid (Ni-IDA) column (1× 5 cm) (GE Life Sciences) preequilibrated with 50 mM phosphate buffer (pH 7.4) containing 500 mM NaCl and 20 mM imidazole. The bonded proteins were then eluted by 50 mM phosphate buffer (pH 7.4) containing 500 mM NaCl and 50 mM imidazole, followed by 50 mM phosphate buffer (pH 7.4) containing 500 mM NaCl and 200 mM imidazole at a flow rate of 1 mL/min. The fractions were monitored by enzyme activity assay, and the purity of enzyme was checked by sodium dodecyl sulfate− polyacrylamide gel electrophoresis (SDS−PAGE). The purified GlcNAcase (RmNag) was used for further studies. Enzyme Assay and Protein Determination. GlcNAcase activity was determined spectrophotometrically with pNP-GlcNAc as the substrate. A 200 μL assay mixture containing 50 μL of enzyme solution, 100 μL of pNP-GlcNAc (2 mM), and 50 μL of 200 mM phosphate buffer (pH 6.5) was incubated at 50 °C for 10 min. The reaction was terminated by the addition of 200 μL of 0.5 M NaOH solution, and then the amount of pNP released was determined by measuring the absorbance at 410 nm. One unit of enzyme activity was defined as the amount of enzyme required to liberate 1 μmol of pNP/min under the assay conditions. Protein concentration was determined by Lowry method33 with bovine serum albumin (BSA) as the standard. Specific activity was expressed as units per milligram of protein. SDS−PAGE and Molecular Mass Determination. SDS−PAGE was performed according to the method of Laemmli et al.34 with 12.5% (w/v) separating gel and 4.5% stacking gel. Protein bands were visualized by Coomassie brilliant blue R-250 staining. The molecular mass of the GlcNAcase was calibrated by use of a low molecular weight calibration kit (TakaRa, Japan) containing phosphorylase b (97.0 kDa), bovine serum albumin (66.0 kDa), ovalbumin (45.0 kDa), carbonic anhydrase (30.0 kDa), trypsin inhibitor (20.1 kDa), and α-lactalbumin (14.4 kDa). The native molecular mass of the purified RmNag was determined on a Superdex-300 (GE Life Science) gel-filtration column (1.0 × 40 cm). The purified enzyme was loaded onto the column and eluted with 20 mM phosphate buffer (pH 6.5) at a flow rate of 0.3 mL/min. The calibration standard proteins used were catalase (247.0 kDa), alcohol dehydrogenase (150.0 kDa), phosphorylase b (97.2 kDa), fetuin (from fetal calf serum, 68.0 kDa), and albumin (from chicken egg white, 45.0 kDa). Effect of pH and Temperature on Activity and Stability of Purified GlcNAcase. The effect of pH on the enzyme activity was determined in different buffers (50 mM) within pH 4.5−10.5. The buffers used were citrate (pH 4.5−6.0), 2-(N-morpholino)ethanesulfonic acid (MES) (pH 5.5−6.5), phosphate (pH 6.0−8.0), 5182

dx.doi.org/10.1021/jf500912b | J. Agric. Food Chem. 2014, 62, 5181−5190


Article

Figure 1. Nucleotide and deduced amino acid sequences of GlcNAcase (RmNag) from R. miehei containing the ORF and 5′ and 3′ flanking regions. The translational initiation codon ATG is boxed in frame. The termination codon, TAA, is boxed and marked by an asterisk (*). A poly(A+) tail is doubleunderlined. The N-linked glycosylation site is marked by a dotted line. Tris-HCl (pH 7.5−9.0), and glycine−NaOH (8.5−10.5). For pH stability, the purified enzyme was incubated in different buffers mentioned above at 30 °C for 30 min, and the residual activities were measured at 50 °C in 50 mM phosphate buffer (pH 6.5).

The optimal temperature of RmNag was examined in the temperature range 25−65 °C in 50 mM phosphate buffers (pH 6.5). To determine the thermostability, the enzyme was incubated at different temperatures for 30 min, and the residual activities were measured at 50 °C in 50 mM phosphate 5183



Article

Figure 2. Multiple alignment of amino acid sequences for RmNag and other putative fungal GlcNAcases. Numbers on the left are the residue numbers of the first amino acid in each line. Abbreviations and accession numbers of those GlcNAcases are as follows: Rhizomucor miehei CAU432 (R.m. KC357713), Rhizopus delemar RA 99-880 (R.d. EIE86479), Aspergillus kawachii IFO 4308 (A.k. GAA88898.1), Aspergillus oryzae RIB40 (A.o. XP_001819886.2), Aspergillus clavatus NRRL 1 (A.c. XP_001271177.1), and Neosartorya fischeri NRRL 181 (N.f. XP_001263288.1). Identical residues are shaded in black and conserved residues are shaded in gray. buffer (pH 6.5). For thermal denaturing half-lives of RmNag, the enzyme was incubated at different temperatures (40, 45, and 50 °C) for 4 h, and then the residual activities of the samples withdrawn at different time intervals were measured in 50 mM phosphate buffer (pH 6.5) at 50 °C.

The effect of metal ions and agents on GlcNAcase activity was determined by incubating the enzyme in 50 mM phosphate buffer (pH 6.5) with various metal ions and reagents (1 mM) at 30 °C for 30 min. The residual activities were then measured by standard enzyme assay. 5184



Article

Substrate Specificity and Kinetic Parameters. The substrate specificity of RmNag was determined by measuring the enzyme activity with various substrates including polysaccharides (1% w/v) such as chitin, chitosan, barley glucan, lichenin, laminarin, carboxymethylcellulose, birchwood xylan, and pullulan; N-acetyl chitooligosaccharides (1% w/v) with degrees of polymerization (DP) of 2−5; and pNP derivatives (1 mM) such as pNP-Gal, pNP-Glu, and pNP-GalNAG in 50 mM phosphate buffer (pH 6.5) at 50 °C for 10 min. The released reducing sugars from polysaccharides were determined by the dinitrosalicylic acid (DNS) method35 with glucose as the standard. The released GlcNAc from N-acetyl chitooligosaccharides was estimated by HPLC on an Agilent series 1200 system (Agilent) equipped with a Cosmosil column. The oven temperature was set at 45 °C, and acetonitrile/ water (3:1) solution was used as mobile phase (1 mL/min). The released pNP was measured at 410 nm. One unit of enzyme activity was defined as the amount of enzyme required to release 1 μmol of reducing sugar or GlcNAc or pNP per minute under the above conditions. The kinetic parameters of RmNag toward pNP-GlcNAc were determined by measuring the enzyme activities with different substrate concentrations in 50 mM sodium phosphate buffer (pH 6.5). The constant kinetic parameters of Km and Vmax were calculated by use of GraFit software. Hydrolytic Property of Purified GlcNAcase. Hydrolysis of N-acetyl chitooligosaccharides (GlcNAc)2−5 by the purified RmNag was performed by incubating 1 mL of 1% (w/v) various substrates dissolved in 50 mM phosphate buffer (pH 6.5) with 2 units of purified enzyme at 30 °C for 4 h. Samples were withdrawn at different time intervals, terminated by boiling for 5 min, and then qualitatively analyzed by thinlayer chromatography (TLC). For TLC analysis, samples (2 μL) were applied to a Merck silica gel 60 plate with n-butyl alcohol/acetate/water (2:1:1 v/v/v) as developing solution. The plate was first sprayed with solution I [12.5% (w/v) KOH dissolved in ethanol and 1% (v/v) acetyl acetone dissolved in n-butyl alcohol at a ratio of 1:20 (v/v)] and dried, then sprayed with solution II [3.33% (w/v) dimethylaminobenzaldehyde dissolved in a solution of ethanol/HCl/1-butanol (6:6:1 v/v/v)]. The compounds separated on the TLC plate were visualized by heating at 130 °C for a few minutes. Tolerance of Purified GlcNAcase to GlcNAc. The extent of GlcNAc inhibition on GlcNAcase activity was determined by incubation of 50 μL of enzyme solution, 100 μL of pNP-GlcNAc prepared in distilled water, 50 μL of 200 mM phosphate buffer (pH 6.5), and various amounts of GlcNAc with a final concentration of 1−20 mM at 50 °C for 10 min. Then the GlcNAcase activities were determined according to the standard enzyme assay. Ki was calculated by nonlinear regression fit of Michaelis−Menten with GraphPad Prism software.

GAA88898.1) and Aspergillus oryzae RIB40 (35%, XP_001819886.2), and very low similarities to those of other known bacterial GlcNAcases. Multiple sequence alignment of RmNag with other GH family 3 GlcNAcases in the GenBank database is indicated in Figure 2. A typical amino acid sequence, KHFPGHGDTxxDSH, that is highly conserved among GH family 3 GlcNAcases19 was found in RmNag. Expression and Purification of Recombinant RmNag. The RmNag gene was successfully expressed in E. coli BL21 as a soluble intracellular enzyme. The recombinant RmNag was purified to apparent homogeneity by Ni-IDA chromatography with purification of 7.9-fold and recovery yield of 45.8% (Table 2). Table 2. Purification Summary for Recombinant GlcNAcase (RmNag) from R. miehei specific total activitya protein activity purification recovery purification step (units) (mg) (units/mg) factor (x-fold) (%) culture supernatant Ni-IDA agarose

278.6

103.2

2.7

127.6

6.0

21.2

1 7.9

100 45.8

Enzyme reactions were carried out at 50 °C in 50 mM phosphate buffer (pH 6.5) for 10 min.

a

The specific activity of the enzyme increased from 2.7 to 21.2 units/ mg (Table 2). The molecular mass of the purified RmNag was determined to be 96 kDa on SDS−PAGE (Figure 3) while

■

RESULTS Cloning of GlcNAcase Gene from R. miehei. A partial gene fragment was obtained by PCR with degenerate primers NAGF and NAGR (Table 1). Complete cDNA sequence of the GlcNAcase (designated as RmNag) was obtained by the rapid amplification of complementary DNA ends (RACE) method. The 2849-bp RmNag cDNA sequence contains an open reading frame (ORF) of 2577 bp encoding 858 amino acids, a 146-bp 5′ untranslated region (UTR), and a 126-bp 3′ UTR, and no intron was found in the coding region (Figure 1). The mature protein has a predicted molecular mass of 96.1 kDa and a theoretical pI of 6.73. No potential signal peptide was detected in the N-terminal region of the gene. One potential N-glycosylation site was identified in the amino acid sequence of the mature protein at residues 199−202. The RmNag cDNA sequence has been submitted to NCBI GenBank under accession number KC357713. RmNag showed low similarities to those of putative GH family 3 GlcNAcases from fungi, such as Aspergillus clavatus NRRL 1 (37%, XP_001271177.1), Neosartorya fischeri NRRL 181 (37%, XP_001263288.1), Aspergillus kawachii IFO 4308 (36%,

Figure 3. SDS−PAGE analysis of proteins during the purification process of recombinant GlcNAcase (RmNag) from R. miehei. Lane M, low molecular mass standard proteins; lane 1, crude enzyme; lane 2, after Ni-IDA column.

determined to be 200.8 kDa by Superdex-300 gel-filtration chromatography (data not shown), indicating that the enzyme was a homodimer. Effect of pH and Temperature on Enzyme Activity and Stability of RmNag. The optimal pH of RmNag was found to be pH 6.5 in 50 mM phosphate buffer (Figure 4A). At pH 6.0− 7.0, the enzyme showed relatively high activity, with more than 80% of the maximum activity retained, while a rapid decline was observed at pH below 5.5 or above 7.5 (Figure 4A). The enzyme was stable in the pH range 6.0−8.0, since more than 80% enzyme activity was remained after 30 min incubation in various buffers 5185



Article

Figure 4. (A) Optimal pH and (B) pH stability of purified RmNag. The influence of pH on GlcNAcase activity was determined at 50 °C with 50 mM different buffers. Residual activities were measured after the enzyme was incubated at 30 °C for 30 min over various pH ranges. Buffers used: (■) citrate, (●) MES, (▲) phosphate, (◆) Tris-HCl, and (□) glycine−NaOH.

(Figure 4B). RmNag was most active at 50 °C and showed a relatively wide range of optimal temperature at 40−55 °C, having more than 80% of its maximum activity (Figure 5A). The enzyme was stable up to 45 °C, as more than 90% of its activity was retained (Figure 5B). The thermal denaturing half-lives of RmNag at 40, 45, and 50 °C were determined to be 1190, 494, and 42 min, respectively (Figure 5C). The enzyme activity was markedly inhibited by more than 30% in the presence of 1 mM Ag+, Cu2+, Zn2+, Co2+, Hg2+, and SDS, while no obvious effect was observed for Ba2+, K+, Na+, and some other metal ions (Table 3). Substrate Specificity and Kinetic Parameters of Purified RmNag. The specificity of RmNag for various substrates is presented in Table 4. Among the tested chromogenic substrates, RmNag efficiently hydrolyzed only pNP-GlcNAc, with specific activity of 21.2 units/mg, and could hardly hydrolyze pNP-GalNAc (0.2 unit/mg). The enzyme showed no activity on the tested polysaccharides. Among the tested N-acetyl chitooligosaccharides, RmNag exhibited the highest activity toward (GlcNAc)3, followed by (GlcNAc)2, (GlcNAc)4, and (GlcNAc)5 (Table 4). The Michaelis−Menten constant Km and Vmax values of RmNag toward pNP-GlcNAc were determined to be 0.13 mM and 49.3 μmol·min−1·mg−1, respectively. Hydrolytic Properties of Purified RmNag on N-acetyl Chitooligosaccharides. The hydrolytic pattern of RmNag on N-acetyl chitooligosaccharides was analyzed by TLC (Figure 6). It can be seen that RmNag efficiently hydrolyzed all chitin oligomers tested (DP 2−5), yielding GlcNAc as the end product, and in the hydrolysis process, the enzyme cleaves one GlcNAc at a time until all the intermediates were converted to GlcNAc (Figure 6).

Figure 5. (A) Optimal temperature, (B) thermostability, and (C) thermal denaturing half-life of purified RmNag. The temperature profile was measured at different temperatures in 50 mM phosphate (pH 6.5). For determination of thermostability, residual activity of the treated enzyme was measured according to the standard assay after a 30 min preincubation at different temperatures. For thermal denaturing half-life, the enzyme was incubated at (◆) 40, (●) 45, and (○) 50 °C.

These results suggested that the enzyme was an exo-type enzyme acting on the nonreducing end of the substrate to release GlcNAc one by one. Tolerance of RmNag to GlcNAc. The effect of various concentrations of GlcNAc on GlcNAcase activity was studied (data not shown). The enzyme activity of RmNag was inhibited by 49.9% in the presence of 9 mM GlcNAc. RmNag was competitively inhibited by GlcNAc with a Ki value of 9.68 mM.

■

DISCUSSION GlcNAcases play important roles in chitin degradation, as well as in the cell wall recycling process of bacteria. To date, a number of GlcNAcases have been identified, gene cloned, and characterized from a wide variety of organisms, including bacteria, plants, insects, and animals.4,9,11,15 Nevertheless, there is only scant information on GlcNAcases from fungi15,24,25 and no report on 5186



Article

(79 kDa),4 T. harzianum (150 kDa)16 and P. oxalicum (160 kDa).24 The denatured molecular mass of RmNag in the present study was estimated to be 96.1 kDa on SDS−PAGE (Figure 3), while the native molecular mass was determined to be 200.8 kDa by gel filtration, indicating the enzyme is a homodimer. This is distinct from most known bacterial GH3 GlcNAcases but similar to the GlcNAcases from two fungi: P. oxalicum24 and T. harzianum.16 RmNag was most active at pH 6.5 and was stable within pH 6.0−8.0 (Figure 4). The optimal pH is similar to that of most other reported GlcNAcases in the range 6.0−7.0.9,13,15,23 RmNag was most active at 50 °C (Figure 5). The GH family 20 GlcNAcases from C. paraputrificus12 and L. edodes4 are also most active at 50 °C. However, the optimal temperature of RmNag is lower than that of the GH family 3 enzymes from thermophilic bacteria S. thermoviolaceus (60 °C)5 and T. maritima (65−75 °C).23 It is worth noting that RmNag exhibited a wide range of temperature optimum at 40−55 °C and was stable up to 45 °C, with a thermal denaturing half-life of 494 min (Figure 5). Generally, GH family 3 GlcNAcases have broad substrate specificity, while GH family 20 GlcNAcases exhibit strict substrate specificity.19,37 However, the differences of GlcNAcases from each other still exist, even within the same GH family.13 RmNag showed the highest activity toward pNP-GlcNAc among the tested pNP drivatives and appeared to have the highest activity against (GlcNAc)3 (the activities for GlcNAc2 and GlcNAc 3 are almost the same) among tested N-acetyl chitooligosaccharides (Table 4). This property is similar to fungal GH family 20 GlcNAcases, which have the highest catalytic efficiency for (GlcNAc)2 among natural substrates and do not hydrolyze or hardly hydrolyze long-chain chitomaterials,4 but is different from most other reported bacterial GH family 3 GlcNAcases. For example, the specific activity of NagA, a GH family 3 GlcNAcase from S. thermoviolaceus, increased with the DP of the N-acetyl chitooligosaccharides substrates.5 GlcNAcase from S. thermophilum showed much lower specific activity for pNP-GlcNAc than for N-acetyl chitooligosaccharides substrates (DP 2−5).20 It appears that the GlcNAcases reported to date possess two major types of substrate specificity. The first type of enzymes prefers to hydrolyze N-acetyl chitobiose, while the other type of enzymes favors chitooligomers (DP 3−6) over N-acetyl chitobiose. However, GlcNAcases from both GH families 3 and 20 are randomly distributed in the two types from this classification aspect. GlcNAcases from T. harzianum,16 S. thermophilum,20 and L. edodes4 belong to the first type, while GlcNAcases from S. thermoviolaceus5 and V. harveyi9 are classified into the second type. RmNag belongs to neither of the two types of GlcNAcase, but it is closer to the first type as it exhibited almost equal highest activities for (GlcNAc)3 and (GlcNAc)2 and low activities for (GlcNAc)4 and (GlcNAc)5 (Table 4). Many GlcNAcases are also called N-acetylhexosaminidases as they showed high activity toward pNP-GalNAc.4,20,21,23 However, RmNag showed a trace amount of activity for pNP-GalNAc. The GlcNAcase from S. thermoviolaceus also showed no activity for pNP-GalNAc.5 RmNag exhibited no activity toward chitin polymers, which is in accordance with most other reported GH family 3 GlcNAcases.5,23 However, there are still a few GlcNAcases showing chitin-degrading ability in both GH families 3 and 20.4,9,13 Thus, RmNag exhibited unique enzymatic properties with respect to all the reported GlcNAcases. Degradation pattern of RmNag toward N-acetyl chitooligosaccharides was analyzed by TLC. RmNag hydrolyzed chitin oligomers (DP 2−5), yielding GlcNAc as the sole end product

Table 3. Effect of Metal Ions and Reagents on Activity of RmNag metal ion or reagent (1 mM)

specific activitya (units/mg)

relative activity (%)

control Fe3+ Cr2+ Ag+ Cu2+ Ni2+ Mg2+ Sn2+ Zn2+ Mn2+ Co2+ Ba2+ Hg2+ K+ Na+ SDS EDTA β-mercaptoethanol

21.1 18.2 13.5 0.2 0.2 13.8 17.5 12.0 2.7 20.7 4.8 21.5 2.5 22.4 21.4 0.3 14.3 18.5

100 86.1 63.8 0.8 0.7 65.2 83.0 56.7 12.8 98.2 22.5 102 11.8 106 101 1.4 67.6 87.5

Activity was determined at 50 °C in 50 mM phosphate buffer (pH 6.5) for 10 min.

a

Table 4. Substrate Specificity of Purified RmNag substrate

specific activitya (units/mg)

relative activity (%)

pNP-GlcNAc pNP-GalNAc (GlcNAc)2 (GlcNAc)3 (GlcNAc)4 (GlcNAc)5

21.2 0.2 1.06b 1.11 0.88 0.68

100 0.7 5.0 5.2 4.1 3.2

a

Specific activities toward N-acetyl chitooligosaccharides were determined by measuring the released GlcNAc by HPLC. Reactions were performed in 50 mM phosphate buffer (pH 6.5) at 50 °C for 10 min. bSpecific activity was divided by 2, as the hydrolysis of 1 mol of (GlcNAc)2 can release 2 mol of GlcNAc.

fungal GlcNAcases belonging to GH family 3. Here, to the best of our knowledge, is the first report on a fungal GlcNAcase belonging to GH family 3. GlcNAcases have been classified into three GH families, 3, 20, and 84, in the CAZy database on the basis of their amino acid sequence similarities.26 GH families 3 and 84 GlcNAcases are mainly distributed in various bacteria and metazoan cells, respectively, while GH family 20 GlcNAcases are versatile enzymes mainly abundant in fungi and insects.36 Analysis of the nucleotide sequence of RmNag indicated that the deduced amino acid sequence contained a typical motif, KHFPGHGDTxxDSH (KHFPGHGDTMVDSH) (Figure 1), which is highly conserved among GH family 3 GlcNAcases.19 Besides, multiple amino acid sequence alignment revealed that RmNag showed the highest identity with a putative GH family 3 GlcNAcase from A. clavatus NRRL 1 (Figure 2). These results suggest that RmNag should be a novel member of GH family 3 GlcNAcases. Hence it may represent the first fungal GH family 3 GlcNAcase. The molecular masses of most reported bacterial GH family 3 GlcNAcases are mainly distributed in the range 36− 89 kDa,11,18,20,23 while those of fungal GlcNAcases (GH family 20) are somewhat higher, mainly above 70 kDa, such as the enzymes from Trichoderma harzianum P1 (72 kDa),17 Lentinula edodes 5187



Article

Figure 6. TLC analysis of hydrolytic products of N-acetyl chitooligosaccharides by purified RmNag. Reactions were performed in 50 mM phosphate buffer (pH 6.5) at 30 °C for various times.

In conclusion, this study reported the gene cloning, expression, and biochemical characterization of the first fungal GH family 3 GlcNAcase. The recombinant enzyme exhibited maximal activity at pH 6.5 and 50 °C. It hydrolyzed N-acetyl chitooligosaccharides to yield mainly GlcNAc as the only final product, and it exhibited relative high GlcNAc tolerance with a Ki value of 9.68 mM. These excellent properties may enable the enzyme to have great potential in industry.

(Figure 6). During the hydrolytic reaction, all substrates were hydrolyzed exolytically, that is, (GlcNAc)n (n < 5) was first converted to (GlcNAc)n−1 and equivalent amount of GlcNAc, and then the intermediate product (GlcNAc)n−1 was further converted to GlcNAcn−2 and equivalent amount of GlcNAc, and the reaction continued until all the intermediate products were converted to the final end product GlcNAc (Figure 6). These results clearly indicated that RmNag released GlcNAc from the nonreducing end of the substrate and exhibited an exo-type cleavage mechanism. Similar results were also reported for the GlcNAcases from A. hydrophila,21 T. maritima,23 and V. harveyi,9 which belong to GH families 20, 3, and 20, respectively. High concentration of GlcNAc tolerance is an advantage for GlcNAcases in the complete enzymatic hydrolysis of chitin. However, most reported GlcNAcases are inhibited by their hydrolysis product (GlcNAc), with Ki values ranging from 0.2 to 2 mM.12,18 The enzyme in the present study exhibited relatively high tolerance to GlcNAc, with a Ki value of 9.68 mM, which is much higher than that of the GlcNAcases from V. furnissii (Ki = 0.21 mM),18 A. oryzae (Ki = 1.6 mM),38 T. harzianum (Ki = 1.6 mM),39 and Spodoptera frugiperda (Ki = 2.0 mM).12 GlcNAcase from Trichinella spiralis was also GlcNAc-tolerant, with a Ki value of 15.75 mM, which represents the highest tolerance to GlcNAc.40 The high GlcNAc tolerance is an attractive feature, which may enable the enzyme great potential in chitin conversion industry, especially for biofuel production.

■

AUTHOR INFORMATION

Corresponding Author

*Phone +86 10 62737689; fax +86 10 82388508; e-mail [email protected]. Funding

This work was supported by grants from the National Science Fund for Distinguished Young Scholars (31325021) and National Natural Science Foundation of China (Project 31101238). Notes

The authors declare no competing financial interest.

■

REFERENCES

(1) Tharanathan, R. N.; Kittur, F. S. Chitin: The undisputed biomolecule of great potential. Crit. Rev. Food Sci. Nutr. 2003, 43, 61−87. (2) Da Silva, L. C. A.; Honorato, T. L.; Franco, T. T.; Rodrigues, S. Optimization of chitosanase production by Trichoderma koningii sp.

5188



Article

and a β-N-acetylglucosaminidase/β-glucosidase from Cellulomonas f imi. FEMS J. 2006, 273, 2929−2941. (20) Ogawa, M.; Kitagawa, M.; Tanaka, H.; Ueda, K.; Watsuji, T.; Beppu, T.; Kondo, A.; Kawachi, R.; Oku, T.; Nishio, T. A β-Nacetylhexoosaminidase from Symbiobacterium thermophilum: Gene cloning, overexpression, purification and characterization. Enzyme Microbiol. Technol. 2006, 38, 457−464. (21) Lan, X.; Zhang, X.; Kodaira, R.; Zhou, Z.; Shimosaka, M. Gene cloning, expression, and characterization of a second β-N-acetylhexoosaminidase from the chitinolytic bacterium Aeromonas hydrophila strain SUWA-9. Biosci. Biotechnol. Biochem. 2008, 72, 492−498. (22) Sumida, T.; Ishii, R.; Yanagisawa, T.; Yokoyama, S.; Ito, M. Molecular cloning and crystal structural analysis of a novel β-Nacetylhexoosaminidase from Paenibacillus sp. TS12 capable of degrading glycosphingolipids. J. Mol. Biol. 2009, 392, 87−99. (23) Choi, K. H.; Seo, J. Y.; Park, K. M.; Park, C. S.; Cha, J. Characterization of glycosyl hydrolase family 3 β-N-acetylglucosaminidases from Thermotoga maritima and Thermotoga neapolitana. J. Biosci. Bioeng. 2009, 108, 455−459. (24) Ryslava, H.; Kalendova, A.; Doubnerova, V.; Skocdopol, P.; Kumar, V.; Kukacka, Z.; Pompach, P.; Vaněk, O.; Slámová, K.; Bojarová, P.; Kulik, N.; Ettrich, R.; Křen, V.; Bezouška, K. Enzymatic characterization and molecular modeling of an evolutionarily interesting fungal β-N-acetylhexoosaminidase. FEBS J. 2011, 278, 2469−2484. (25) Slámová, K.; Kulik, N.; Fiala, M.; Krejzová-Hofmeisterová, J.; Ettrich, R.; Křen, V. Expression, characterization and homology modeling of a novel eukaryotic GH84 β-N-acetylglucosaminidase from Penicillium chrysogenum. Protein Expression Purif. 2014, 95, 204− 210. (26) Cantarel, B. L.; Coutinho, P. M.; Rancurel, C.; Bernard, T.; Lombard, V.; Henrissat, B. The Carbohydrate-Active enZymes database (CAZy): An expert resource for glycogenomics. Nucleic Acids Res. 2009, 37, 233−238. (27) Maheshwari, R.; Bharadwaj, G.; Bhat, M. K. Thermophilic fungi: Their physilology and enzymes. Microbiol. Mol. Biol. Rev. 2000, 64, 461− 488. (28) Katrolia, P.; Jia, H.; Yan, Q.; Song, S.; Jiang, Z.; Xu, H. Characterization of a protease-resistant α-galactosidase from the thermophilic fungus Rhizomucor miehei and its application in removal of raffinose family oligosaccharides. Bioresour. Technol. 2012, 110, 578− 586. (29) Tang, Y.; Yang, S.; Yan, Q.; Cui, J.; Jiang, Z. High-level production, purification and characterization of a novel (lichenase) from the thermophilic Rhizomucor miehei with high specific activity. J. Agric. Food Chem. 2012, 60, 2354−2361. (30) Sambrook, J.; Russell, D. W. Molecular Cloning: A Laboratory Manual, 2nd ed.; Cold Spring Harbor Laboratory: Cold Spring Harbor, NY, 2001. (31) Lodhi, M. A.; Ye, G. N.; Weeden, N. F.; Reisch, B. I. A simple and efficient method for DNA extractions from grape vine cultivars and Vitis species. Plant Mol. Biol. Rep. 1994, 12, 6−13. (32) Rose, T. M.; Henikoff, J. G.; Henikoff, S. CODEHOP (COnsensus-DEgenerate Hybrid Oligonucleotide Primer) PCR primer design. Nucleic Acids Res. 2003, 31, 3763−3766. (33) Lowry, O. H.; Rosebrough, N. J.; Farr, A. L.; Randall, R. J. Protein measurement with the folin phenol reagent. J. Biol. Chem. 1951, 193, 265−275. (34) Laemmli, U. K. Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 1970, 227, 680−685. (35) Miller, G. L. Use of dinitrosalicylic acid reagent for determination of reducing sugar. Anal. Chem. 1959, 31, 426−428. (36) Liu, T.; Yan, J.; Yang, Q. Comparative biochemistry of GH3, GH20 and GH84 β-N-acetyl-D-hexosaminidases and recent progress in selective inhibitor discovery. Curr. Drug Targets 2012, 13, 512−525. (37) Lee, R. C.; Hrmova, M.; Burton, R. A.; Lahnstein, J.; Fincher, G. B. Bifunctional family 3 glycoside hydrolases from barley with α-Larabinofuranosidase and β-D-xylosidase activity. Characterization, primary structures, and COOH-terminal processing. J. Biol. Chem. 2003, 278, 5377−5387.

under solid-state fermentation. Food Bioprocess. Technol. 2012, 5, 1564− 1572. (3) Sweeney, M. D.; Xu, F. Biomass converting enzymes as industrial biocatalysts for fuels and chemicals: Recent developments. Catalysts 2012, 2, 244−263. (4) Konno, N.; Takahashi, H.; Nakajima, M.; Takeda, T.; Sakamoto, Y. Characterization of β-N-acetylhexosamidase (LeHex20A), a member of glycoside hydrolase family 20, from Lentinula edodes (shiitake mushroom). AMB Express 2012, 2, 29. (5) Tsujibo, H.; Hatano, N.; Mikami, T.; Hirasawa, A.; Miyamoto, K.; Inamori, Y. A novel β-N-acetylhexoosaminidase from Streptomyces thermoviolaceus OPC-520: Gene cloning, expression, and assignment to family 3 of the glycosyl hydrolases. Appl. Environ. Microbiol. 1988, 64, 2920−2924. (6) Horsch, M.; Mayer, C.; Sennhauser, U.; Rast, D. M. β-NAcetylhexosamidases: A target for the design of antifungal agents. Pharmacol. Therapeut. 1997, 76, 187−218. (7) Zhuravleva, N. V.; Luk′yanov, P. A.; Pivkin, M. V. N-Acetyl-β-Dhexosamidase secreted by the marine fungus Phoma glomerata. Appl. Biochem. Microbiol. 2004, 40, 448−453. (8) Zeng, X.; Sun, Y.; Ye, H.; Liu, J.; Uzawa, H. Synthesis of pnitrophenyl sulfated disaccharides with β-D-(6-sulfo)-GlcNAc units using β-N-acetylhexosaminidase from Aspergillus oryzae in a transglycosylation reaction. Biotechnol. Lett. 2007, 29, 1105−1110. (9) Suginta, W.; Chuenark, D.; Mizuhara, M.; Fukamizo, T. Novel β-Nacetylglucosamidases from Vibrio harveyi 650: Cloning, expression, enzymatic properties, and subsite identification. BMC Biochem. 2010, 11, 40. (10) Votsch, W.; Templin, M. F. Characterization of a β-Nacetylhexosaminidase of Escherichia coli and elucidation of its role in muropeptide recycling and β-lactamase induction. J. Biol. Chem. 2000, 275, 39032−39038. (11) Gomes, J. E., Jr.; Souza, D. S. L.; Nascimento, R. M.; Lima, A. L. M.; Melo, J. A. T.; Rocha, T. L.; Miller, R. N. G.; Franco, O. L.; Grosside-Sa, M. F.; Abreu, L. R. D. Purification and characterization of liverderived β-N-acetylhexosaminidase from marine mammal Sotalia f luviatilis. Protein J. 2010, 29, 188−194. (12) Tomiya, N.; Narang, S.; Park, J.; Abdul-Rahman, B.; Choi, O.; Singh, S.; Hiratake, J.; Sakata, K.; Betenbaugh, M. J.; Palter, K. B.; Lee, Y. C. Purification, characterization, and cloning of a Spodoptera f rugiperda Sf9 β-N-acetylhexosamidase that hydrolyzes terminal β-N-acetylglucosamine on the N-glycan core. J. Biol. Chem. 2006, 28, 19545−19560. (13) Li, H.; Morimoto, K.; Katagiri, N.; Kimura, T.; Sakka, K.; Lun, S.; Ohmiya, K. A novel β-N-acetylglucosaminidase of Clostridium paraputrif icum M-21 with high activity on chitobiose. Appl. Microbiol. Biotechnol. 2002, 60, 420−427. (14) Ferrara, M. C.; Cobucci-Ponzano, B.; Carpentieri, A.; Henrissat, B.; Rossi, M.; Amoresano, A.; Moracci, M. The identification and molecular characterization of the first archaeal bifunctional exo-βglucosidase/N-acetyl-β-glucosaminidase demonstrate that family GH116 is made of three functionally distinct subfamilies. Biochim. Biophys. Acta 2014, 1840, 367−377. (15) Sanon, A.; Tournaire-Arellano, C.; Younes El Hage, S.; Bories, C.; Caujolle, R.; Loiseau, P. M. N-Acetyl-β-D-glucosamidase from Trichomonas vaginalis: Substrate specificity and activity of inhibitors. Biomed. Pharmacother. 2005, 59, 245−248. (16) Koga, K.; Iwamoto, Y.; Sakamoto, H.; Hatano, K.; Sano, M.; Kato, I. Purification and characterization of β-N-acetylhexoosaminidase from Trichoderma harzianum. Agric. Biol. Chem. 1991, 55, 2871−2823. (17) Peterbauer, C. K.; Lorito, M.; Hayes, C. K.; Harman, G. E.; Kubicek, C. P. Molecular cloning and expression of the nag1 gene (Nacetyl-β-D-glucosaminidase-encoding gene) from Trichoderma harzianum P1. Curr. Genet. 1996, 30, 325−331. (18) Chitlaru, E.; Roseman, S. Molecular cloning and characterization of a novel β-N-acetylhexoosaminidase from Vibrio f urnissii. J. Biol. Chem. 1996, 271, 33433−33439. (19) Mayer, C.; Vocadlo, D. J.; Mah, M.; Rupitz, K.; Stoll, D.; Warren, R. A. J.; Withers, S. G. Characterization of a β-N-acetylhexoosaminidase 5189



Article

(38) Rajnochova, E.; Dvorakova, J.; Hun kova, Z.; Kren, V. Reverse hydrolysis catalysed by β-N-acetylhexosaminidase from Aspergillus oryzae. Biotechnol. Lett. 1997, 19, 869−872. (39) Nieder, V.; Kutzer, M.; Kren, V.; Gallego, R. G.; Kamerling, J. P.; Elling, L. Screening and characterization of β-N-acetylhexosaminidases for the synthesis of nucleotide-activated disaccharides. Enzyme Microb. Technol. 2004, 34, 407−414. (40) Bruce, A. F.; Gounaris, K. Characterisation of a secreted N-acetylβ-hexosaminidase from Trichinella spiralis. Mol. Biochem. Parasitol. 2006, 145, 84−93.

5190


Biochemical Characterization of the First Fungal ... - ACS Publications

Recommend Documents