Biochemical Characterization of the Mycobacterium smegmatis

Subscriber access provided by Washington University | Libraries

Article

Biochemical Characterization of the Mycobacterium smegmatis Threonine Deaminase Lorenza Favrot, Tathyana Amorim Franco, and John S Blanchard Biochemistry, Just Accepted Manuscript • DOI: 10.1021/acs.biochem.8b00871 • Publication Date (Web): 18 Sep 2018 Downloaded from http://pubs.acs.org on September 19, 2018

Just Accepted “Just Accepted” manuscripts have been peer-reviewed and accepted for publication. They are posted online prior to technical editing, formatting for publication and author proofing. The American Chemical Society provides “Just Accepted” as a service to the research community to expedite the dissemination of scientific material as soon as possible after acceptance. “Just Accepted” manuscripts appear in full in PDF format accompanied by an HTML abstract. “Just Accepted” manuscripts have been fully peer reviewed, but should not be considered the official version of record. They are citable by the Digital Object Identifier (DOI®). “Just Accepted” is an optional service offered to authors. Therefore, the “Just Accepted” Web site may not include all articles that will be published in the journal. After a manuscript is technically edited and formatted, it will be removed from the “Just Accepted” Web site and published as an ASAP article. Note that technical editing may introduce minor changes to the manuscript text and/or graphics which could affect content, and all legal disclaimers and ethical guidelines that apply to the journal pertain. ACS cannot be held responsible for errors or consequences arising from the use of information contained in these “Just Accepted” manuscripts.

is published by the American Chemical Society. 1155 Sixteenth Street N.W., Washington, DC 20036 Published by American Chemical Society. Copyright © American Chemical Society. However, no copyright claim is made to original U.S. Government works, or works produced by employees of any Commonwealth realm Crown government in the course of their duties.

Page 1 of 34 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

Biochemical Characterization of the Mycobacterium smegmatis Threonine Deaminase

Lorenza Favrot, Tathyana M. Amorim Franco, John S. Blanchard* Department of Biochemistry, Albert Einstein College of Medicine, 1300 Morris Park Avenue, Bronx, NY 10461

*Corresponding Author E-mail: [email protected]

ORCID: John S. Blanchard: 0000-0002-9195-4402

Funding: This work was supported by National Institutes of Health Grant AI060899 to J.S.B, and a Science Without Borders fellowship (CAPES) to T.M.A.F.

Notes: The authors declare no competing financial issues

Supplemental Material (5 Figures) is available for this article

1 ACS Paragon Plus Environment

Biochemistry 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Abstract: The biosynthesis of branched-chain amino acids or BCAAs (L-isoleucine, L-leucine, and L-valine)

is essential in eubacteria, but mammals are branched-chain amino acid auxotrophs,

making the enzymes in the pathway excellent targets for antibacterial drug development. The biosynthesis of L-isoleucine, L-leucine, and L-valine is very efficient, requiring only eight enzymes. Threonine dehydratase (TD), a PLP-dependent enzyme encoded by the ilvA gene, is the enzyme responsible for the conversion of L-threonine (L-Thr) to α-ketobutyrate, ammonia and water and is the first step in the biosynthesis of L-isoleucine. We have cloned, expressed and biochemically characterized the reaction catalyzed by M. smegmatis TD (abbreviated as MsIlvA) using steady-state kinetics and kinetic isotope effects. We show here that in addition to Lthreonine, L-allo-threonine and L-serine are also used as substrates by TD and all exhibit sigmoidal, non-Michaelis-Menten kinetics. Curiously, β-chloro-L-alanine was also a substrate rather than an inhibitor as expected. The enzymatic activity of TD is sensitive to the presence of allosteric regulators, including the activator L-valine or the end-product feedback inhibitor of the BCAA pathway in which TD is involved, L-isoleucine. Primary deuterium kinetic isotopes are small, suggesting Cα proton abstraction is only partially rate-limiting. Solvent kinetic isotopes were significantly larger, indicating that a proton transfer occurring during the reaction is also partially rate-limiting. Finally, we demonstrate that L-cycloserine, a general inhibitor of PLPdependent enzymes, is an excellent inhibitor of threonine deaminase.


Page 2 of 34

Page 3 of 34 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

Introduction: The biosynthetic pathway of the three branched-chain amino acids (BCAAs: L-isoleucine, Lleucine, and L-valine) is not present in mammals, while being essential for the growth and survival of most microorganisms, including Mycobacterium tuberculosis (M. tb)1-3. For this reason, enzymes involved in this biosynthetic pathway are considered attractive herbicidal and antibacterial drug targets. Only eight enzymes are necessary for the biosynthesis of the three BCAAs, making it a very efficient pathway4. Threonine dehydratase/deaminase (TD) is the first, and committed step in the biosynthesis of L-isoleucine (L-Ile),

while all the other enzymes (IlvB/N, IlvC, IlvD and IlvE) are involved in the

biosynthesis of both L-Ile and L-valine (L-Val) (Figure 1-A)4. TD catalyzes the conversion of Lthreonine (L-Thr) to α-ketobutyrate and ammonia; and can convert L-serine (L-Ser) to pyruvate and ammonia more slowly. Both a biosynthetic and a catabolic TD have been reported5, 6. The biosynthetic enzyme (encoded by the gene ilvA) is regulated by L-Ile and L-Val, which act as negative and positive allosteric effectors, respectively7, 8. The catabolic enzyme (encoded by the gene tdcB) can be activated by AMP or CMP and functions under anaerobic conditions9. In the following paragraphs, only the ilvA-encoded biosynthetic TD will be discussed. TD is a pyridoxal 5’-phosphate (PLP)-dependent enzyme, with the PLP cofactor covalently linked to an active site lysine residue through a Schiff base. The α-amino group of L-Thr first attacks the Schiff base, displacing the active site lysine and generating an external aldimine (Figure 1-B). The catalytic lysine can presumably act as a general base to deprotonate the Cα-H of the bound amino acid substrate and releasing the Cβ-hydroxyl group to generate aminocrotonate, which is still bound via the original Schiff base to the PLP cofactor. Transimination by the active site lysine regenerates the original bound form of PLP and releasing 3 ACS Paragon Plus Environment

Biochemistry 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

the aminocrotonate product. The latter tautomerizes from the enamine to the imine and is then hydrolyzed to generate the observed products: ammonia and 2-ketobutyrate. TD does not obey usual Michaelis-Menten hyperbolic kinetics but instead follows sigmoidal kinetics as a function of the substrate concentration8, 10. The addition of allosteric regulators, L-Ile or L-Val, alter the sigmoidal kinetics of the enzyme11, 12. TD was one of the first enzymes shown to be subject to allosteric control, first reported in 196113, and these studies of TD led to the development of the two-state allosteric regulation model14. More specific studies have since been carried out on TD enzymes from different microorganisms including Escheridia coli (E. coli), Arabidopsis thaliana or Bacillus subtilis (B. subtilis) 7, 8, 15-17. TD generally forms a homotetramer with four PLP molecules bound10, 18. Only the threedimensional structure of the E. coli ilvA-encoded biosynthetic TD in complex with PLP has been determined to date19, 20. The structure displays a type-II fold of PLP-dependent enzymes20. The 2.8 Å structure includes two domains connected by a thin neck-like region: a catalytic PLPbound N-terminal domain and a C-terminal regulatory domain. Except for the helix that connects them to one another, the two domains are not interacting, suggesting that the helix plays a significant role in the allosteric regulation by L-Ile and L-Val. Site-directed mutagenesis experiments and determination of the structure identified lysine 62 (K62) as the active site residue involved in the formation of the Schiff base16, 20. Recently, Sharma et al. demonstrated that down-regulation of the ilvA gene alters the growth of M. tb and modifies the cell wall lipid profile21. Additionally, the strain was found to be more susceptible to stress, including starvation, pH changes, and nitric oxide stress. Recombinant M. tb Ra (an avirulent strain) TD was also partially characterized22. Because of these phenotypes, M. tb TD is considered an attractive drug development target. Mycobacterium smegmatis (M. smeg)


Page 4 of 34

Page 5 of 34 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

TD shares 82% sequence identity with M. tb TD. Recombinant Mtb TD was expressed and purified; however, the protein did not display any enzymatic activity. For this reason, we focused on studying the active, recombinant M. smeg TD. In this paper, we report the cloning, expression and purification of M. smeg TD (abbreviated as MsIlvA). We characterize biochemically the reaction catalyzed by MsIlvA using steady-state kinetics and primary and solvent kinetic isotope effects. Moreover, we confirmed the effects of L-Val

and L-Ile on MsIlvA activity. Finally, we tested potential inhibitors of MsIlvA, including D-

and L-cycloserine (DCS and LCS) and β-chloro-D/L-alanine (BCDA/BCLA).


Biochemistry 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 6 of 34

Material and methods: Molecular cloning of MSMEG3183-pET28 construct and mutants: The MSMEG3183 gene was amplified from M. smeg mc2155 genomic DNA by PCR using the following set of primers (Invitrogen): 5’-AAAAAACATATGACCACCGAACTGAGCGCC-3’ AAAAAGCTTTCAGGTCAGGTAGCGGTACGTC-3’

(MSMEG3183_NdeI), (MSMEG3183_HindIII).

The

5’PCR

product was ligated into the pET28b (+) vector, containing a cleavable N-terminal poly-histidine tag, between the NdeI and HindIII restriction sites. The mutants K67A and K67Q were generated by site-directed mutagenesis using the MSMEG3183-pET28 construct as a template and the following primers (and their respective complements): TGTGCGCTCCTACGCGGTGCGCGGCGCG (K67A) and GTGCGCTCCTACCAGGTGCGCGGCG (K67Q). The sequence of MSMEG3183-pET28, as well as the presence of the mutations, were confirmed by nucleotide sequencing carried out by the Genomic Core (Albert Einstein College of Medicine). Expression and purification of MsIlvA: The MSMEG3183-pET28 plasmid was used to transform E. coli T7 express cells (New England BioLabs®). Bacterial cells were cultured at 37°C in LuriaBertani medium (BD®) supplemented with 50 µg/mL kanamycin until an OD of 0.6 was reached. Protein expression was then induced by adding 0.5 mM isopropyl-β-D-thiogalactopyranoside (IPTG, Gold Biotechnology), and further incubated overnight at 16°C. The cells were harvested by centrifugation after 24 hours of induction and the cell pellet was resuspended in buffer containing 50 mM Tris, pH 8.0, 100 mM ammonium chloride and 10 mM imidazole (buffer A). Cell lysis was carried out by addition of lysozyme (MP Biomedicals), DNAse I (Roche) and sonication. The clarified lysate was loaded onto a nickel column (equilibrated with buffer A) and


Page 7 of 34 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

washed with 10 column volumes of the same buffer. The proteins were then eluted with buffer containing 50 mM Tris, pH 8.0, 100 mM ammonium chloride and 250 mM imidazole (buffer B). The N-terminal poly-histidine tag was cleaved using thrombin (2 U/mg of protein) and the reaction was dialyzed overnight against 50 mM Tris, pH 8.0, 1 mM calcium chloride and 1 mM dithiothreitol. In a second step, MsIlvA was purified using size exclusion chromatography (HiLoadTM 26/60 SuperdexTM 75 prep grade) in buffer C (50 mM Tris, pH 8.0 containing 1 mM dithiothreitol). The fractions corresponding to MsIlvA were pooled together and concentrated to 4 mg/mL using a 3-kDa Amicon Ultra Centrifugal filter. The protein concentration was established using absorbance spectroscopy at 280 nm. The theoretical extinction coefficient was generated with the ProtParam function in the ExPASY proteomics server (ε280 = 20,860 M-1.cm1 23

) . The concentration of PLP bound to MsIlvA was determined at 415 nm (ε415 = 6,900 M-1.cm-

1 24

) . The enzyme was stored in aliquots with 20 % v/v glycerol at - 20°C.

A gel filtration experiment was carried out to determine the oligomerization state of MsIlvA using a Superose 12 gel filtration column (GE Healthcare Life Science). The calculated molecular weight of ~180 kDa was determined using the position of the eluted MsIlvA peak, suggesting that the MsIlvA forms a homotetramer (data not shown). Based on the absorbance spectroscopy values obtained at 280 and 415 nm, only two PLP molecules were bound to the homotetramer in the as-purified enzyme. MsIlvA activity assay: MsIlvA was assayed at 340 nm by coupling the catalyzed reaction with lactate dehydrogenase (LDH, 3U) from rabbit muscle (Sigma-Aldrich chemicals) in the presence of excess reduced nicotinamide adenine dinucleotide (NADH, ε340 = 6,220 M-1.cm-1). The reactions were carried out at 30°C on a Shimadzu spectrophotometer UV-2600. Different cations


Biochemistry 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

were tested at 5 mM L-Thr in 50 mM Tris, pH 8.0 and a 50 mM cation chloride final concentration. A pH profile experiment was carried out at a single, high concentration of L-Thr (15 mM) using 150 nM MsIlvA. The buffer contained 50 mM ammonium chloride and 50 mM Tris HCl, varying the pH from 6.8 to 8.9. Kinetic parameters were determined by varying the concentration of L-Thr from 0 to 15 mM using 150 nM MsIlvA and one equivalent of PLP added to the assay mixture per monomer. All reagents were dissolved in a buffer containing 50 mM Tris, pH 8.0 and 50 mM ammonium chloride. All reactions performed in triplicate were initiated by the addition of L-Thr. Kinetic data were fitted to the Hill equation (1) using Prism 7 software: =

[] (1) ( + [] )

where V is the initial velocity, Vmax is the maximal velocity, S is the substrate concentration, n the Hill coefficient and Km is the concentration of substrate that produces half of Vmax. L-Ser, L-allo-threonine (L-allo-Thr)

and BCLA were also tested as substrates of MsIlvA. The

enzymatic activity of the mutants MsIlvA K67A and K67Q were also tested using similar conditions. An alternative assay was used to test BCDA and BCLA as inhibitors of MsIlvA25. The formation of α-ketobutyrate was monitored directly at 230 nm. All reactions were carried out at 30°C in 50 mM Tris, pH 8.0 and 50 mM ammonium chloride. All reactions performed in duplicate were initiated by the addition of L-Thr. A calibration curve using different concentrations of αketobutyrate was obtained to establish the value of εα-ketobutyrate (662.4 M-1.cm-1). Effect of allosteric effectors on MsIlvA activity: The effect of L-Val and L-Ile was assayed using L-Thr

at a concentration near its Km value. Kinetic parameters were determined again in presence


Page 8 of 34

Page 9 of 34 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

of 1 mM L-Val or 30 µM L-Ile by varying the concentration of L-Thr from 0 to 15 mM and fixing the concentration of MsIlvA at 150 nm. To determine the reversibility of the inhibition by L-Ile, MsIlvA was inhibited with 1 mM L-Ile and varying concentrations of L-Val from 0 to 15 mM were added to the assay mixture. Primary kinetic isotope effect: The primary kinetic isotope effect was determined using varying concentrations (0.35-15 mM) of L-Thr or L-d5-Thr (perdeuterated L-Thr, Cambridge Isotope Laboratories, Inc). The reactions were carried out in triplicate at 30°C using 50 mM Tris, pH 8.0 containing 50 mM ammonium chloride. Because of the sigmoidal kinetic observed, the data could not be fitted to the typical KIE equation24. Each data set, using L-Thr or L-d5-Thr, were fitted to the Hill equation to obtain the Km and kcat values. To determine D(V) and D(V/K), the equations (2) and (3) were used. Only the last 5 data points (3.75-15 mM L-Thr or L-d5-Thr) are displayed on Figure 4-A. () =

(/) =

() (2) ()

() ()

(3)

Proton inventory and solvent kinetic isotope effect: A control reaction using 50 mM Tris, pH 8.0 containing 50 mM ammonium chloride and 9 % v/v glycerol was performed to simulate the viscosity effect caused by D2O. The proton inventory was carried out at a saturating concentration of L-Thr using 150 nM MsIlvA in a buffer containing 50 mM Tris, pH 8.0, 50 mM ammonium chloride and increasing fractions of D2O. Solvent kinetic isotope effects were carried out using either H2O and D2O (95 %) buffers under similar conditions used to determine the


Biochemistry 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

kinetic parameters. L-Thr concentrations were varied from 0.31 to 15 mM. A similar analysis to the primary KIE experiment was carried out to determine D2O(V) and D2O(V/K). Inactivation of MsIlvA by DCS and LCS: The inactivation experiment using LCS was carried out using 150 nM MsIlvA (1:1 PLP) incubated with different concentrations of LCS (250, 500, 750 and 1000 µM) at room temperature. The complex was added to the reaction mixture containing LDH and excess NADH in 50 mM Tris, pH 8.0 containing 50 mM ammonium chloride. The reaction was initiated by the addition of L-Thr and the remaining activity was recorded every ten minutes over 40 minutes. All measurements were carried out in duplicate and fitted to the following equation (4) using Prism 7 software: ln

!

" =

− $ × & = − )) × & (4) 1 + ' " [(]

where Et corresponds to the activity of MsIlvA after incubation with LCS at time t, E0 corresponds to the initial activity without LCS, [I] corresponds to the concentration of inhibitor, KI is an estimate of inhibitor binding affinity, kinac is the first-order inactivation rate constant and kapp is the inactivation rate at any inhibitor concentration. Kitz-Wilson plots of ln(2)/kapp vs 1/[LCS] lead to the observation of a straight line whose slope corresponds to KI/kinac and the yintercept to 1/kinac26. MsIlvA was also incubated with DCS at different concentrations (5, 10, and 20 mM) for one hour at room temperature. The activity was then assayed at 340 nM using similar conditions used to determine the kinetic parameters. UV-visible spectrum of MsIlvA inhibited by LCS: The spectra were recorded at 30°C on a Shimadzu spectrophotometer UV-2600. The spectrophotometer was blanked with assay buffer. Ten-millimeter quartz cuvettes were used to carry out the experiment. MsIlvA (150 µM) was


Page 10 of 34

Page 11 of 34 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

inhibited with 5 mM LCS and the UV-visible spectrum was recorded between 300 and 550 nm at different times points (0, 10, 20, 30, 45, 60, 75, 90, 120, 150, 180, 240 and 360 min). Mass spectrometry of MsIlvA inhibited by LCS: MsIlvA (150 µM) was incubated with 5 mM LCS overnight at 25°C. The sample was then buffer exchanged three times with 50 mM Tris, pH 8.0, using a 3-kDa Amicon Ultra Centrifugal filter to remove any excess LCS. A control sample was also carried out without the addition of LCS. LC-MS and MS/MS were performed on an Agilent 100 HPLC and ThermoFinnigan LTQ ion trap mass spectrometer. Mobiles phase A and B were 0.1 % v/v formic acid in water (A) and acetonitrile (B), respectfully. The flow rate was 0.05 mL/min and a 1.00 X 100 mm Diamond Hydride Cogent column was used in Aqueous Normal Phase mode. The gradient is as follows: first 3 min 90 % B; from 3 to 25 min 90 to 40 % B; hold at 40 % B for 10 min; 35 to 37 min 5 % B; 37 to 40 min 90 % B and held at 90 % B for 5min. The LTQ was operated in positive ionization mode and MS data was collected 5 min after injection of sample (first 5 min diverted to waste). The mass range scanned was from 50.0 to 500.0 m/z with a maximum injection time of 100 msec. Tandem MS/MS was obtained as PMP-isoxazole was eluting, precursor mass 332.0 m/z, using a CID energy of 15.


Biochemistry 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Results and Discussion: Effects of various cations on MsIlvA activity: MsIlvA shares 82% sequence identity with MtbIlvA. Recombinant MtbIlvA was expressed in E. coli and purified but the protein did not exhibit any enzymatic activity (data not shown). For this reason, all efforts were focused on MsIlvA. Recombinant MsIlvA including a N-terminal poly-histidine tag was expressed in E. coli and purified using nickel affinity and gel filtration chromatography. The enzymatic activity of MsIlvA was assayed at 340 nm by coupling the catalyzed reaction with lactate dehydrogenase (LDH) in presence of excess NADH as previously described10. The MsIlvA enzymatic activity was affected by the presence of different cations (Figure 2-A). All monovalent cations enhance the activity by 50 to 75 %. Among the divalent cations, only Ca2+ and Mg2+ resulted in an increase of the enzymatic activity (60-70 %) whereas Mn2+ inhibits the activity. Ammonium ion was tested further since it was the cation leading to the highest increase in activity. The enzymatic reaction varies as a function of ammonium ion concentration, with an optimal activity observed at 50 mM ammonium chloride (Figure 2-B). Thus, experiments described were all carried out at this concentration. The effect of ammonium chloride was also observed in the case of the E. coli TD10. The presence of monovalent cations has been shown to stimulate the enzymatic activity in the case of TD from plants17. However, Wessel et al. observed that the presence of divalent cations such as Ca2+ and Mg2+ results in inhibition of TD.

Steady-state kinetics of MsIlvA using various substrates: To optimize further the assay, a pH profile was carried out (Figure S1). Initial velocities of MsIlvA were monitored at a single, high concentration of L-Thr between pH 6.8 and 8.9. The pH exhibits no significant effect on MsIlvA activity and pH 8.0 was used for all further experiments. Initial velocities of MsIlvA were


Page 12 of 34

Page 13 of 34 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

measured as a function of L-Thr concentration (Figure 3). As observed in the case of E coli and B. subtilis enzymes, MsIlvA does not obey usual Michaelis-Menten kinetics, but instead follows a sigmoidal function8, 10. The following kinetic parameters were determined after fitting initial rates to the Hill equation: Km = 1.66 ± 0.04 mM, kcat = 9.4 ± 0.1 s-1 and the Hill coefficient n = 2.36 ± 0.11 (Table 1). The Hill coefficient value confirms that MsIlvA requires cooperativity to function. The Km value is in the same range as the one determined by Sharma et al (10.9 mM) for MtbIlvA, although they did not observe the sigmoidal function for the substrate22. The Km values for L-Thr for the E. coli and B. subtilis enzymes were 8.0 mM and 9.6 mM, respectively8, 10. L-allo-Thr,

a stereoisomer of L-Thr rarely found in nature, is also used as a substrate of

MsIlvA. Similar to L-Thr, a sigmoidal function was observed. Initial velocities were fitted to the Hill equation, yielding the following parameters: Km = 2.9 ± 0.2 mM, kcat = 5.7 ± 0.2 s-1 and Hill coefficient n = 1.47 ± 0.10 (Table 1). It can be noted that a lag phase of about two minutes was observed when monitoring the absorbance at 340 nm. The Km value is in the same range as the one determined for L-Thr but the kcat value is 60 % of the rate of L-Thr. To date, only Nishimura et al. have demonstrated that TD from sheep liver could catalyze the deamination of L-allo-Thr at 25 % of the rate of L-Thr27, 28. TD has been shown to utilize L-Ser as a substrate, yielding pyruvate, instead of αketobutyrate, and ammonia27-30. For this reason, MsIlvA was tested using 0 to 150 mM L-Ser as a substrate. Initial rates were again fitted to the Hill equation and the following parameters were obtained: Km = 106.3 ± 5.5 mM, kcat = 32.6 ± 1.6 s-1 and Hill coefficient n = 2.19 ± 0.08 (Table 1). MsIlvA poorly catalyzes the deamination of L-Ser. Similar to these results, Sharma and colleagues demonstrated that L-Ser was an inefficient substrate of MtbIlvA (Ra)22.


Biochemistry 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

BCDA is a known mechanism-based inhibitor of alanine racemase, a PLP-dependent enzyme involved in peptidoglycan biosynthesis. Several studies elucidated its mechanism of inhibition3133

. BCDA first attacks the Schiff base, then undergoes a deprotonation on the α position and an

elimination of the chloride atom, leading to the formation of a 2-aminoacrylate intermediate. The latter is thought to dissociate from the active site, generating 2-aminoacrylate and again the internal aldimine. 2-aminoacrylate is then hydrolyzed to ammonia and pyruvate. Because of the high electrophilicity of 2-aminoacrylate, the internal aldimine can attack the intermediate during turnover and results in the formation of a covalent adduct, inactivating the enzyme. Manning and co-workers established that BCDA exhibits potent antibacterial activity34. Although this inhibitor displays significant effects against M. tb, Prosser et al. recently show that the main target of BCDA is glutamate racemase, another enzyme involved in the peptidoglycan biosynthesis35, 36. However, glutamate racemase contains two cysteines in the active site that act as acid-base catalysts and therefore does not require the use of PLP, preventing a similar mechanism to the inactivation of alanine racemase from occurring. Instead, it was shown that BCDA covalently modifies one of the catalytic cysteines, leading to the inactivation of glutamate racemase36. BCDA and BCLA were first tested as inhibitors of MsIlvA using an alternative assay in which the formation of α-ketobutyrate was monitored at 230 nm25. Nonetheless, concentrations up to 10 mM did not exhibit any inhibition of enzymatic activity (data not shown). The two compounds were then tested as substrates of MsIlvA, but enzymatic activity was only detected with BCLA. Initial rates were fitted to the Hill equation, yielding the following constants: Km = 3.01 ± 0.09 mM, kcat = 27.2 ± 0.5 s-1 and Hill coefficient n = 2.03 ± 0.08 (Table 1). Substrate


Page 14 of 34

Page 15 of 34 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

inhibition was observed at higher concentrations (data not shown). MsIlvA can catalyze the conversion of BCLA to pyruvate and ammonia and again displays selectivity for L-stereoisomers.

Identification of K67 as active site lysine: Efforts were pursued to crystallize MsIlvA and to determine its three-dimensional crystal structure. Although several crystals were obtained, only low diffraction data sets were collected, and we were not able to solve the structure. Instead, a model was generated using E. coli TD (PDB code: 1TDJ) as a template and the automated protein structure homology-modelling server, SWISS-MODEL37. The generated model is displayed in Figure S2. In the E. coli TD structure, PLP was observed bound to lysine 62 (K62)20. Site-directed mutagenesis experiments confirmed that K62 is the active site residue involved in the formation of the Schiff base16, 20. Based on the structural superimposition, K67 appears to be the active site residue involved in the formation of the Schiff base in MsIlvA (Figure S2). The mutants MsIlvA K67A and K67Q were tested and did not exhibit any enzymatic activity, nor were either mutant form yellow, as observed for the wild-type enzyme (data not shown), confirming the hypothesis that K67 is the active site lysine that forms the Schiff base.

Primary kinetic isotope effects: The primary kinetic isotope effect was determined by comparing the rates of deamination of L-Thr and perdeuterated L-Thr (abbreviated as L-d5-Thr). The following kinetic isotope effects were measured: D(V) = 1.1 ± 0.1 and D(V/K) = 1.6 ± 0.1 (Figure 4-A). Both primary KIE constants are modest, with the effects on V/K larger than the effect on V. This suggests that Cα proton abstraction is only partially rate-limiting in the initial reaction


Biochemistry 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 16 of 34

leading to the dehydration step but does not contribute significantly to the rate-limiting step for the overall catalytic reaction.

Solvent KIE and proton inventory: Solvent kinetic isotope experiments are commonly performed to determine the rate-limiting nature of proton transfers during a catalytic reaction. First, a control reaction including 9 % v/v glycerol was carried out to simulate the viscosity effect caused by D2O, but did not show any effect on the rate of the reaction. The solvent kinetic isotope effect was measured by varying L-Thr concentrations in H2O or 95 % D2O (Figure 4-B). The following constants were determined:

D O 2 (V)

= 1.3 ± 0.1 and

D O 2 (V/K)

= 3.7 ± 0.1. The

larger D2O(V/K) indicates that the first step of the MsIlvA mechanism is the rate-limiting reaction. Proton inventory experiments allowed us to quantify the number of protons involved in the solvent isotopic-dependent step. A proton inventory was carried out at a saturating concentration of L-Thr in a buffer containing increasing fractions of D2O (Figure 4-C). In the case of MsIlvA, the proton inventory is linear, suggesting that only one proton is involved in the solvent isotope sensitive step in catalysis.

Detailed Chemical Mechanism of MsIlvA: The isotope effects described above allow us to characterize in detail the chemical mechanism of IlvA. As shown in Scheme 1, the initial step in all PLP-dependent enzymatic reactions is the transimination, by the incoming amino acid substrate, of the enzyme-PLP Schiff base internal aldimine to generate the substrate-PLP external aldimine. The deprotonated lysine residue that is expelled is then able to abstract the Cα proton of the covalently bound substrate to generate a highly resonance-stabilized carbanion whose electrons ultimately are drawn towards the pyridinium nitrogen of PLP. This quininoid


Page 17 of 34 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

intermediate has a distinct visible absorbance feature from either the PLP or PMP form of the cofactor. This initial chemical step in the reaction is responsible for the primary kinetic isotope effect using suitably deuterated substrates. The D(V/K) of 1.6 that we determined reflects the degree to which this step is rate-limiting in the sequence of steps up to the first irreversible step and this is most likely the next step in the reaction; the loss of the Cβ hydroxyl group. The magnitude of D(V/K) suggests that Cα proton removal is only partially rate-limiting in the deprotonation and dehydration sequence, and the near unit value of

D

(V) suggests that

deprotonation is not rate-limiting in the overall reaction. The solvent kinetic isotope effects are quite informative about the potential rate-limiting nature of the dehydration step. The electrons on the quininoid intermediate are then used to assist in the cleavage of the Cβ-OH bond through resonance rearrangement and protonation of the leaving hydroxide by the protonated K67 generated from the previous step. This proton transfer from K67 to the Cβ hydroxyl group is the likely source of the large solvent kinetic isotope effect on V/K, D2O(V/K), of 3.7, and suggests that this step is rate-limiting in the first two chemical steps, deprotonation and dehydration, whose rate constants appear in the expression for V/K. This also argues that the deprotonation and dehydration steps are kinetically distinct, since if the reaction was concerted, the primary and solvent kinetic isotope effects on V/K would both be expected to be large. We assume that the dehydration step is irreversible and subsequent steps only contribute to V. The solvent kinetic isotope effect on this parameter,

D O 2 (V)

is relatively quite small, suggesting that while

dehydration is the rate-limiting step in the first two chemical steps, it is not rate-limiting in the overall reaction. The product external aldimine is now decomposed to regenerate the resting enzyme-PLP internal aldimine and generate the free product, aminocrotonate. The remaining two steps are non-enzymatic, involving first the tautomerization of eneamine to the imine, 2-


Biochemistry 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

iminobuyrate. The final step is the hydrolysis of this imine to generate 2-ketobutyrate and ammonia. These last three steps, transimination, tautomerization and hydrolysis are likely to be slower that the initial transimination, proton abstraction and Cβ-OH bond cleavage as evidenced by the kinetic isotope effects.

Allosteric control of MsIlvA activity: Over the years, many studies demonstrated that TD is sensitive to positive (L-Val) and negative (L-Ile) allosteric effectors7, 8, 15-17, 38. Generally, L-Val is an activator and enhances the affinity of L-Thr to the enzyme, reducing the cooperativity. On the contrary, the end-product of the BCAA pathway is a feedback inhibitor: L-Ile decreases the affinity of the substrate and yields an increase in cooperativity. In the case of B. subtilis TD, LVal did not significantly activate the enzyme, although it did decrease the cooperativity8. However, at higher concentrations of L-Val, some inhibition was observed. The effect of L-Val and L-Ile on the MsIlvA enzymatic activity was tested using L-Thr at a concentration near Km. Addition of L-Val (0-10 mM) leads to nearly 50 % increase in MsIlvA activity (Figure 5-A). To confirm the effect, the kinetic parameters of MsIlvA were determined in presence of 1 mM L-Val (Figure 5-B). The following kinetic parameters were obtained after fitting initial velocities to the Hill equation: Km = 1.21 ± 0.05 mM, kcat = 13.46 ± 0.19 s-1 and Hill coefficient n = 1.08 ± 0.03. The low value for the Hill coefficient suggests that MsIlvA in presence of L-Val closely obeys hyperbolic Michaelis-Menten kinetics. The Km value decreases while the kcat value rises, confirming that L-Val is an activator of MsIlvA. Addition of increasing concentrations of L-Ile result in the inhibition of the enzymatic activity. Less than 2 % activity remained after addition of 500 µM L-Ile (Figure 6-A). The kinetic parameters of MsIlvA were determined in presence of 30 µM L-Ile: Km = 2.99 ± 0.03 mM, kcat = 18 ACS Paragon Plus Environment

Page 18 of 34

Page 19 of 34 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

9.26 ± 0.08 s-1 and Hill coefficient n = 3.07 ± 0.08 (Figure 6-B). The Km and Hill coefficient values increase while the kcat value slightly decreases, confirming that L-Ile is an inhibitor of MsIlvA. MsIlvA was inhibited by L-Ile (less than 10 % remaining activity) and increasing concentrations of L-Val were added to test whether or not the inhibition of MsIlvA can be reversed by L-Val addition (Figure 6-C). The activity was recovered completely (activity normalized to the enzyme in absence of effectors) by using 15 mM L-Val.

Inactivation of MsIlvA by DCS and LCS: D-cycloserine (DCS) is a broad-spectrum antibiotic isolated from a Streptomyces species39. DCS has been shown to inhibit both alanine racemase and D-alanine-D-alanine ligase in Staphylococcus aureus, two enzymes involved in peptidoglycan biosynthesis40. Other targets have been identified, including D-amino acid transaminase and dialkylglycine decarboxylase41-43. Two metabolomics profiling experiments using NMR and stable isotope mass spectrometry established that D-alanine-D-alanine ligase is the main target of DCS in mycobacteria44, 45. DCS is currently used as a second-line drug in the treatment of multidrug-resistant tuberculosis, however, the drug exhibits various toxic side effects; likely due to DCS acting as a partial agonist of neuronal N-methyl-D-aspartate or NMDA46. L-cycloserine (LCS) is a synthetic compound, which inhibits γ-aminobutyric acid aminotransferase, dialkylglycine decarboxylase and methionine γ-lyase43,

47, 48

. More recently,

Franco et al. elucidated the mechanism of inhibition of MtIlvE, a branched-chain aminotransferase and PLP-dependent enzyme involved in the last step of the biosynthetic pathway of BCAAs, by DCS and LCS49.


Biochemistry 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Since DCS and LCS are known inhibitors of PLP-dependent enzymes, both compounds were tested on MsIlvA. MsIlvA was first incubated with DCS at different concentrations (5, 10, and 20 mM) for one hour at room temperature. The addition of 20 mM DCS led to a 35% decrease of activity, indicating that DCS is not a very efficient inhibitor of MsIlvA (Figure S3). On the other hand, the incubation of MsIlvA with different concentrations of LCS yielded to a 77% loss of enzymatic activity (Figure 7-A). No loss of activity was detected in the control reaction in which the enzyme was left at room temperature and enzymatic activity was recorded every 10 minutes for 40 min. Linearity of the semilogarithmic plots of the residual MsIlvA enzymatic activity versus time at different concentrations of LCS suggests that the inactivation obeys pseudo-firstorder kinetics. Kitz-Wilson plot of t1/2 vs 1/[LCS] lead to the observation of a straight line (Figure 7-A, inset). This result reveals that at the minimum, one molar equivalent of LCS binds to one molecule of the enzyme to reach inactivation49. Linear regression leads to the determination of KI (7.86 mM) and kinac (7.6 × 10-3 s-1) values. LCS appears to be a better inhibitor than DCS due to the stereospecificity of MsIlvA. Similar observations have been reported in the case of MtIlvE and serine palmitoyltransferase from Sphigomonas paucimobili (S. paucimobili), another PLPdependent enzyme involved in the sphingolipid biosynthetic pathway49, 50.

Mechanism of inactivation by LCS: When PLP is covalently bound to the catalytic lysine residue of a PLP-dependent enzyme, forming the internal aldimine, a typical UV-visible spectrum with an absorbance maximum (415 nm) can be observed24. Several groups demonstrated that addition of DCS or LCS leads to a decrease of absorbance at 415 nm because of the loss of the Schiff base49, 50. The inactivation of MsIlvA by LCS was monitored over 6 hours using UV-visible


Page 20 of 34

Page 21 of 34 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

spectroscopy (Figure 7-B). The control containing only MsIlvA is displayed in cyan (top line) and exhibits a peak at 415 nm. The color of the MsIlvA-LCS solution converted from yellow to colorless over time. Over the course of the experiment, a concomitant increasing can be observed near 320 nm. In other PLP-dependent enzymes, this maximum is observed when the PLP Schiff base is converted to the pyridoxamine 5’-phosphate or PMP-form of the enzyme. However, the TD enzymes does not normally go through a PMP-form. The formation of this maximum near 330 nm, however suggests that a PMP derivative appears in presence of LCS. In the case of other PLP-dependent enzymes, a PMP-D/LCS adduct including an intact cycloserine ring was formed following incubation with either inhibitor42, 43, 47, 49, 50. It appears that MsIlvA obeys a similar mechanism of inactivation by LCS. Over the first 30 minutes, an isobestic point is observed at approximately 390 nm (Figure 7B, Figure S4). However, this isobestic point is not observed after 30 min. Lowther and coworkers reported a similar observation in the case of S. paucimobili serine palmitoyltransferase50. Based on a previous study, the 380 nm isobestic point was hypothesized to correspond to an oxime intermediate between PLP and LCS51. On the other hand, they speculated that the 330 peak was consistent with the hydrolysis of the PMP-LCS derivative, leading to PMP and the ring opening of cycloserine51. To determine the structure of the PMP-LCS complex formed during the inactivation of MsIlvA, the enzyme was incubated overnight with LCS until complete inhibition was observed and monitored using liquid chromatography mass spectrometry (LC-MS) and tandem MS/MS. A control sample was also carried out without the addition of LCS. A peak at m/z 332.0 corresponding to the predicted mass of a PMP-isoxazole complex in which the cycloserine ring stays intact, was observed (Figure S5-A). Tandem MS/MS exhibits a pattern identical to the one


Biochemistry 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 22 of 34

observed for MtIlvE or γ-aminobutyric acid aminotransferase inhibited by D/LCS, confirming the formation of a PMP-isoxazole complex (Figure S5-B)47,

49

. The major peak at m/z 234.1

corresponds to the loss of a phosphate.

Conclusions: Threonine deaminase is the first, and committed, step in the biosynthesis of Lisoleucine and was one of the first enzymes for which allosteric regulatory was demonstrated by the end-product of the pathway. It has been studied kinetically for its allosteric properties, but detailed mechanistic studies were lacking. Here we provide evidence for a stepwise deprotonation/dehydration sequence based on our analysis of isotope effects. We also demonstrate that L-cycloserine is a powerful suicide inactivator that generates a covalent PMPisoxazole complex. Since other enzymes downstream of IlvA, namely the ilvB/N-encoded acetolactate synthase and ilvC-encoded ketol acid isomeroreductase are known targets for existing herbicides, it seems likely the enzymes of bacterial and plant branched-chain amino acid biosynthesis represent a novel and target-rich environment for antibacterial development.

Acknowledgement: We would like to acknowledge Dr. Subray Hegde for helpful discussions on the manuscript and Mr Eddie Nieves for assistance in performing the mass spectrometry in the Proteomics Core that was supported by a grant from the NIH (S10-RR-029398)


Page 23 of 34 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

Table: Substrates

Km (mM)

kcat (s-1)

Hill coefficient n

kcat/Km (M-1. s-1)

L-Thr

1.66 ± 0.04

9.42 ± 0.11

2.36 ± 0.11

5.67 x 104

L-allo-Thr

2.86 ± 0.20

5.69 ± 0.20

1.47 ± 0.10

1.99 x 104

L-Ser

106.30 ± 5.50

32.59 ± 1.66

2.19 ± 0.08

0.03 x 104

BCLA

3.01 ± 0.09

27.15 ± 0.53

2.03 ± 0.08

9.02 x 104

Table 1: Kinetic parameters for different substrates of MsIlvA.


Biochemistry 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Figures

Figure 1: A) Biosynthetic pathway of L-Ile and L-Val. B) Mechanism of MsIlvA.


Page 24 of 34

Page 25 of 34

Figure 2: Effect of monovalent and divalent cations on MsIlvA enzymatic activity. A) Initial velocities were assayed at 340 nm using 50 mM cation and 150 nM MsIlvA coupled with LDH. The activity is normalized to the enzyme in absence of cation. Error bars (corresponding to standard deviations [s.d.]) were calculated from duplicate reactions. B) Effect of ammonium chloride concentration on MsIlvA activity. Initial velocities were assayed using 150 nM MsIlvA coupled with LDH. Error bars (s.d.) were calculated from triplicate reactions.

12 10 8

k (s-1)

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

6 4 2 0 0

5

10

15

20

[L-Thr] (mM)

Figure 3: Sigmoidal plot of MsIlvA initial velocities versus L-Thr concentrations. Error bars (s.d.) were calculated from triplicate reactions. Initial rates were fitted to the Hill equation and the following kinetic parameters were obtained: Km = 1.66 ± 0.04 mM, kcat = 9.42 ± 0.11 s-1 and Hill coefficient n = 2.36 ± 0.11.


Biochemistry 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 26 of 34

Figure 4: Kinetic isotope effects and proton inventory. A) Primary KIE of MsIlvA with varying protonated (circles) or deuterated (triangles) L-Thr concentrations. Error bars (s.d.) were calculated from triplicate reactions. The following constants were obtained: D(V) = 1.1 ± 0.1 and D

(V/K) = 1.6 ± 0.1. B) Solvent KIE of MsIlvA with varying L-Thr concentrations in H2O

(squares) or 95 % D2O (circles). Error bars (s.d.) were calculated from triplicate reactions. The following constants were obtained:

D O 2 (V)

= 1.3 ± 0.1 and

D O 2 (V/K)

= 3.7 ± 0.1. C) Proton

inventory of 15 mM L-Thr with 150 nM MsIlvA in a buffer containing 50 mM Tris, pH 8.0, 50 mM ammonium chloride and increasing fractions of D2O. Error bars (s.d.) were calculated from triplicate reactions.

Figure 5: Effects of L-Val on MsIlvA activity. A) Effect of increasing L-Val concentrations on MsIlvA activity. The activity is normalized to the enzyme in absence of L-Val and the error bars (s.d.) were calculated from triplicate reactions. B) Sigmoidal plot of MsIlvA initial velocities 26 ACS Paragon Plus Environment

Page 27 of 34 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

versus L-Thr concentrations in absence (circles) or presence of 1 mM L-Val (squares). The error bars (s.d.) were calculated from triplicate reactions.

Figure 6: Effects of L-Ile on MsIlvA activity. A) Effect of increasing L-Ile concentrations on MsIlvA activity. The activity is normalized to the enzyme in absence of L-Ile. The error bars (s.d.) were calculated from triplicate reactions. B) Sigmoidal plot of MsIlvA initial velocities versus L-Thr concentrations in absence (circles) or presence of 30 µM L-Ile (triangles). The error bars (s.d.) were calculated from triplicate reactions. C) Recovery of MsIlvA-L-Ile activity by L27 ACS Paragon Plus Environment

Biochemistry 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Val. The enzyme was inhibited with 1 mM L-Ile, then increasing concentrations of L-Val from 0 to 15 mM were added. The activity is normalized to the enzyme in absence of L-Val and L-Ile. The error bars (s.d.) were calculated from triplicate reactions.

Figure 7: Inhibition of MsIlvA by LCS. A) Remaining activity (ln(%)) of MsIlvA incubated over time at different concentrations of LCS: 0 µM (filled circles), 250 µM (filled squares), 500 µM (filled triangles), 750 µM (transparent triangles), 1000 µM (transparent circles). The activity is normalized to the enzyme in absence of LCS. The error bars (s.d.) were calculated from triplicate reactions. The inset corresponds to the Kitz-Wilson plot and displays t1/2 vs 1/[LCS]. The values for t1/2 were calculated from the inactivation rate at any inhibitor concentration (determined by the slopes corresponding to each LCS concentrations on Figure 7-A). B) UV-visible spectrum of MsIlvA incubated with LCS over time. Top line (cyan) corresponds to MsIlvA without inhibitor. Then spectra from top to bottom (cyan to magenta) were recorded at the following time points: 0, 10, 20, 30, 45, 60, 75, 90, 120, 150, 180, 240 and 360 min.


Page 28 of 34

Page 29 of 34 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

Scheme 1:

Scheme 1: Proposed chemical mechanism of MsIlvA.


Biochemistry 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

References: [1] Grandoni, J. A., Marta, P. T., and Schloss, J. V. (1998) Inhibitors of branched-chain amino acid biosynthesis as potential antituberculosis agents, J Antimicrob Chemother 42, 475-482. [2] Hondalus, M. K., Bardarov, S., Russell, R., Chan, J., Jacobs, W. R., Jr., and Bloom, B. R. (2000) Attenuation of and protection induced by a leucine auxotroph of Mycobacterium tuberculosis, Infect Immun 68, 2888-2898. [3] Singh, V., Chandra, D., Srivastava, B. S., and Srivastava, R. (2011) Downregulation of Rv0189c, encoding a dihydroxyacid dehydratase, affects growth of Mycobacterium tuberculosis in vitro and in mice, Microbiology 157, 38-46. [4] Amorim Franco, T. M., and Blanchard, J. S. (2017) Bacterial Branched-Chain Amino Acid Biosynthesis: Structures, Mechanisms, and Drugability, Biochemistry 56, 5849-5865. [5] Umbarger, H. E., and Brown, B. (1957) Threonine deamination in Escherichia coli. II. Evidence for two L-threonine deaminases, J Bacteriol 73, 105-112. [6] Yu, X., Li, Y., and Wang, X. (2013) Molecular evolution of threonine dehydratase in bacteria, PLoS One 8, e80750. [7] Eisenstein, E. (1995) Allosteric regulation of biosynthetic threonine deaminase from Escherichia coli: effects of isoleucine and valine on active-site ligand binding and catalysis, Arch Biochem Biophys 316, 311-318. [8] Shulman, A., Zalyapin, E., Vyazmensky, M., Yifrach, O., Barak, Z., and Chipman, D. M. (2008) Allosteric regulation of Bacillus subtilis threonine deaminase, a biosynthetic threonine deaminase with a single regulatory domain, Biochemistry 47, 11783-11792. [9] Simanshu, D. K., Savithri, H. S., and Murthy, M. R. (2006) Crystal structures of Salmonella typhimurium biodegradative threonine deaminase and its complex with CMP provide structural insights into ligand-induced oligomerization and enzyme activation, J Biol Chem 281, 39630-39641. [10] Eisenstein, E. (1991) Cloning, expression, purification, and characterization of biosynthetic threonine deaminase from Escherichia coli, J Biol Chem 266, 5801-5807. [11] Umbarger, H. E. (1956) Evidence for a negative-feedback mechanism in the biosynthesis of isoleucine, Science 123, 848. [12] Umbarger, H. E., and Brown, B. (1958) Isoleucine and valine metabolism in Escherichia coli. VII. A negative feedback mechanism controlling isoleucine biosynthesis, J Biol Chem 233, 415-420. [13] Changeux, J. P. (1961) The feedback control mechanisms of biosynthetic L-threonine deaminase by L-isoleucine, Cold Spring Harb Symp Quant Biol 26, 313-318. [14] Monod, J., Wyman, J., and Changeux, J. P. (1965) On the Nature of Allosteric Transitions: A Plausible Model, J Mol Biol 12, 88-118. [15] Eisenstein, E., Yu, H. D., and Schwarz, F. P. (1994) Cooperative binding of the feedback modifiers isoleucine and valine to biosynthetic threonine deaminase from Escherichia coli, J Biol Chem 269, 29423-29429. [16] Eisenstein, E., Yu, H. D., Fisher, K. E., Iacuzio, D. A., Ducote, K. R., and Schwarz, F. P. (1995) An expanded two-state model accounts for homotropic cooperativity in biosynthetic threonine deaminase from Escherichia coli, Biochemistry 34, 9403-9412. 30 ACS Paragon Plus Environment

Page 30 of 34

Page 31 of 34 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

[17] Wessel, P. M., Graciet, E., Douce, R., and Dumas, R. (2000) Evidence for two distinct effector-binding sites in threonine deaminase by site-directed mutagenesis, kinetic, and binding experiments, Biochemistry 39, 15136-15143. [18] Koerner, K., Rahimi-Laridjani, I., and Grimminger, H. (1975) Purification of biosynthetic threonine deaminase from Escherichia coli, Biochim Biophys Acta 397, 220-230. [19] Gallagher, D. T., Eisenstein, E., Fisher, K. E., Zondlo, J., Chinchilla, D., Yu, H. D., Dill, J., Winborne, E., Ducote, K., Xiao, G., and Gilliland, G. L. (1998) Polymorphous crystallization and diffraction of threonine deaminase from Escherichia coli, Acta Crystallogr D Biol Crystallogr 54, 467-469. [20] Gallagher, D. T., Gilliland, G. L., Xiao, G., Zondlo, J., Fisher, K. E., Chinchilla, D., and Eisenstein, E. (1998) Structure and control of pyridoxal phosphate dependent allosteric threonine deaminase, Structure 6, 465-475. [21] Sharma, R., Keshari, D., Singh, K. S., Yadav, S., and Singh, S. K. (2016) MRA_1571 is required for isoleucine biosynthesis and improves Mycobacterium tuberculosis H37Ra survival under stress, Sci Rep 6, 27997. [22] Sharma, R., Keshari, D., Singh, K. S., and Singh, S. K. (2017) Biochemical and functional characterization of MRA_1571 of Mycobacterium tuberculosis H37Ra and effect of its down-regulation on survival in macrophages, Biochem Biophys Res Commun 487, 892897. [23] Gasteiger, E., Gattiker, A., Hoogland, C., Ivanyi, I., Appel, R. D., and Bairoch, A. (2003) ExPASy: The proteomics server for in-depth protein knowledge and analysis, Nucleic Acids Res 31, 3784-3788. [24] Amorim Franco, T. M., Hegde, S., and Blanchard, J. S. (2016) Chemical Mechanism of the Branched-Chain Aminotransferase IlvE from Mycobacterium tuberculosis, Biochemistry 55, 6295-6303. [25] Davis, L. (1965) A spectrophotometric method for the assay of threonine dehydratase, Anal Biochem 12, 36-40. [26] Kitz, R., and Wilson, I. B. (1962) Esters of methanesulfonic acid as irreversible inhibitors of acetylcholinesterase, J Biol Chem 237, 3245-3249. [27] Nishimura, J. S., and Greenberg, D. M. (1961) Purification and properties of L-threonine dehydrase of sheep liver, J Biol Chem 236, 2684-2691. [28] Goldstein, L., Knox, W. E., and Behrman, E. J. (1962) Studies on the nature, inducibility, and assay of the threonine and serine dehydrase activities of rat liver, J Biol Chem 237, 28552860. [29] Phillips, A. T. (1968) Mechanism of the inactivation of threonine dehydratase during the dehydration of serine, Biochim Biophys Acta 151, 523-526. [30] Chargaff, E. S., D.B. . (1943) Studies on the mechanism of demaination of serine and threonine in biological systems, J Biol Chem 151. [31] Wang, E. A., and Walsh, C. (1981) Characteristics of beta, beta-difluoroalanine and beta, beta, beta -trifluoroalanine as suicide substrates for Escherichia coli B alanine racemase, Biochemistry 20, 7539-7546. [32] Esaki, N., and Walsh, C. T. (1986) Biosynthetic alanine racemase of Salmonella typhimurium: purification and characterization of the enzyme encoded by the alr gene, Biochemistry 25, 3261-3267. 31 ACS Paragon Plus Environment

Biochemistry 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

[33] Roise, D., Soda, K., Yagi, T., and Walsh, C. T. (1984) Inactivation of the Pseudomonas striata broad specificity amino acid racemase by D and L isomers of beta-substituted alanines: kinetics, stoichiometry, active site peptide, and mechanistic studies, Biochemistry 23, 5195-5201. [34] Manning, J. M., Merrifield, N. E., Jones, W. M., and Gotschlich, E. C. (1974) Inhibition of bacterial growth by beta-chloro-D-alanine, Proc Natl Acad Sci U S A 71, 417-421. [35] David, S. (2001) Synergic activity of D-cycloserine and beta-chloro-D-alanine against Mycobacterium tuberculosis, J Antimicrob Chemother 47, 203-206. [36] Prosser, G. A., Rodenburg, A., Khoury, H., de Chiara, C., Howell, S., Snijders, A. P., and de Carvalho, L. P. (2016) Glutamate Racemase Is the Primary Target of beta-Chloro-dAlanine in Mycobacterium tuberculosis, Antimicrob Agents Chemother 60, 6091-6099. [37] Biasini, M., Bienert, S., Waterhouse, A., Arnold, K., Studer, G., Schmidt, T., Kiefer, F., Gallo Cassarino, T., Bertoni, M., Bordoli, L., and Schwede, T. (2014) SWISS-MODEL: modelling protein tertiary and quaternary structure using evolutionary information, Nucleic Acids Res 42, W252-258. [38] Chen, L., Chen, Z., Zheng, P., Sun, J., and Zeng, A. P. (2013) Study and reengineering of the binding sites and allosteric regulation of biosynthetic threonine deaminase by isoleucine and valine in Escherichia coli, Appl Microbiol Biotechnol 97, 2939-2949. [39] Neuhaus, F. C. (1967) D-Cycloserine and O-Carbamyl-D-Serine, In Antibiotics, Volume I, Mechanism of Action (Gottlieb, D., and Shaw, P. D., Eds.), pp 40-83, Springer-Verlag Berlin, New York. [40] Strominger, J., Ito, E., and Threnn, R. H. (1960) Competitive Inhibition of Enzymatic Reactions by Oxamycin, J Am Chem Soc 82, 998-999. [41] Soper, T. S., and Manning, J. M. (1981) Different modes of action of inhibitors of bacterial D-amino acid transaminase. A target enzyme for the design of new antibacterial agents, J Biol Chem 256, 4263-4268. [42] Peisach, D., Chipman, D. M., Van Ophem, P. W., Manning, J. M., and Ringe, D. (1998) Dcycloserine inactivation of D-amino acid aminotransferase leads to a stable noncovalent protein complex with an aromatic cycloserine-PLP derivative, Journal of the American Chemical Society 120, 2268-2274. [43] Malashkevich, V. N., Strop, P., Keller, J. W., Jansonius, J. N., and Toney, M. D. (1999) Crystal structures of dialkylglycine decarboxylase inhibitor complexes, Journal of Molecular Biology 294, 193-200. [44] Prosser, G. A., and de Carvalho, L. P. (2013) Metabolomics Reveal d-Alanine:d-Alanine Ligase As the Target of d-Cycloserine in Mycobacterium tuberculosis, ACS Med Chem Lett 4, 1233-1237. [45] Halouska, S., Fenton, R. J., Zinniel, D. K., Marshall, D. D., Barletta, R. G., and Powers, R. (2014) Metabolomics analysis identifies d-Alanine-d-Alanine ligase as the primary lethal target of d-Cycloserine in mycobacteria, J Proteome Res 13, 1065-1076. [46] Hood, W. F., Compton, R. P., and Monahan, J. B. (1989) D-Cycloserine - a Ligand for the NMethyl-D-Aspartate Coupled Glycine Receptor Has Partial Agonist Characteristics, Neurosci Lett 98, 91-95.


Page 32 of 34

Page 33 of 34 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

[47] Olson, G. T., Fu, M. M., Lau, S., Rinehart, K. L., and Silverman, R. B. (1998) An aromatization mechanism of inactivation of gamma-aminobutyric acid aminotransferase for the antibiotic L-cycloserine, Journal of the American Chemical Society 120, 2256-2267. [48] Kuznetsov, N. A., Faleev, N. G., Kuznetsova, A. A., Morozova, E. A., Revtovich, S. V., Anufrieva, N. V., Nikulin, A. D., Fedorova, O. S., and Demidkina, T. V. (2015) Pre-steadystate Kinetic and Structural Analysis of Interaction of Methionine gamma-Lyase from Citrobacter freundii with Inhibitors, Journal of Biological Chemistry 290, 671-681. [49] Amorim Franco, T. M., Favrot, L., Vergnolle, O., and Blanchard, J. S. (2017) MechanismBased Inhibition of the Mycobacterium tuberculosis Branched-Chain Aminotransferase by d- and l-Cycloserine, ACS Chem Biol 12, 1235-1244. [50] Lowther, J., Yard, B. A., Johnson, K. A., Carter, L. G., Bhat, V. T., Raman, M. C., Clarke, D. J., Ramakers, B., McMahon, S. A., Naismith, J. H., and Campopiano, D. J. (2010) Inhibition of the PLP-dependent enzyme serine palmitoyltransferase by cycloserine: evidence for a novel decarboxylative mechanism of inactivation, Mol Biosyst 6, 1682-1693. [51] Ikushiro, H., Hayashi, H., and Kagamiyama, H. (2004) Reactions of serine palmitoyltransferase with serine and molecular mechanisms of the actions of serine derivatives as inhibitors, Biochemistry 43, 1082-1092.


Biochemistry 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Table of Contents Graphic

K62/67


Page 34 of 34

Biochemical Characterization of the Mycobacterium smegmatis

Recommend Documents