Biomolecular Interaction Assays Identified Dual Inhibitors of

Subscriber access provided by University of Florida | Smathers Libraries

Article

Biomolecular interaction assays identified novel dual inhibitors of glutaminase and glutamate dehydrogenase that disrupt mitochondrial function and prevent growth of cancer cells Min Zhu, Jinzhang Fang, Jingjing Zhang, Zheng Zhang, Jianhui Xie, Yan Yu, Jennifer Jin Ruan, Zhao Chen, Wei Hou, Gensheng Yang, Wei-Ke Su, and Benfang Helen Ruan Anal. Chem., Just Accepted Manuscript • DOI: 10.1021/acs.analchem.6b03849 • Publication Date (Web): 16 Jan 2017 Downloaded from http://pubs.acs.org on January 17, 2017

Just Accepted “Just Accepted” manuscripts have been peer-reviewed and accepted for publication. They are posted online prior to technical editing, formatting for publication and author proofing. The American Chemical Society provides “Just Accepted” as a free service to the research community to expedite the dissemination of scientific material as soon as possible after acceptance. “Just Accepted” manuscripts appear in full in PDF format accompanied by an HTML abstract. “Just Accepted” manuscripts have been fully peer reviewed, but should not be considered the official version of record. They are accessible to all readers and citable by the Digital Object Identifier (DOI®). “Just Accepted” is an optional service offered to authors. Therefore, the “Just Accepted” Web site may not include all articles that will be published in the journal. After a manuscript is technically edited and formatted, it will be removed from the “Just Accepted” Web site and published as an ASAP article. Note that technical editing may introduce minor changes to the manuscript text and/or graphics which could affect content, and all legal disclaimers and ethical guidelines that apply to the journal pertain. ACS cannot be held responsible for errors or consequences arising from the use of information contained in these “Just Accepted” manuscripts.

Analytical Chemistry is published by the American Chemical Society. 1155 Sixteenth Street N.W., Washington, DC 20036 Published by American Chemical Society. Copyright © American Chemical Society. However, no copyright claim is made to original U.S. Government works, or works produced by employees of any Commonwealth realm Crown government in the course of their duties.

Page 1 of 21

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Analytical Chemistry

Biomolecular interaction assays identified novel dual inhibitors of glutaminase and glutamate dehydrogenase that disrupt mitochondrial function and prevent growth of cancer cells Min Zhu1a, Jinzhang Fang1a, Jingjing Zhang1a, Zheng Zhang1a, Jianhui Xie1, Yan Yu1, Jennifer Jin Ruan2，Zhao Chen1, Wei Hou1,Gensheng Yang1, Weike Su1, Benfang Helen Ruan1* 1

School of Pharmacy, Zhejiang University of Technology

2

Hangzhou Jennifer Biotech. Inc.

a

Equal first authors

Key words: Glutaminase, Bio-Layer Interferometry (BLI), enzyme assay, Biomolecular interaction, cancer.

* Corresponding author Professor: Benfang Helen Ruan E-mail: [email protected] (BR); [email protected]; Tel: 86-18357023608 (BF); Fax: (0086) 571-88871098 (BF); ¤Current address: No. 18 Chaowang Road, Xiachengqu, Hangzhou, Zhejiang, China, 310014

ACS Paragon Plus Environment


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 2 of 21

Abstract: Glutaminase (KGA/ isoenzyme GAC) is an emerging and important drug target for cancer. Traditional methods for assaying glutaminase activity are coupled with several other enzymes. Such coupled assays do not permit the direct and stringent characterization of specific glutaminase inhibitors.

Ebselen was identified as a potent 9 nM KGA inhibitor in

the KGA/Glutamate Oxidase (GO)/Horse Radish Peroxidase (HRP) coupled assay, but showed very weak activity in inhibiting the growth of glutamine - dependent cancer cells. For rigorous characterization, we developed a direct kinetic binding assay for KGA using Bio-Layer Interferometry (BLI) as the detection method; Ebselen was identified as a GDH inhibitor but not a KGA inhibitor. Furthermore, we designed and synthesized several benzo[d][1,2]selenazol -3(2H)-one dimers which were subjected to SAR analysis by several glutaminolysis specific biochemical and cell based assays.

Novel glutamate dehydrogenase

(GDH) or dual KGA/GDH inhibitors were discovered from the synthetic compounds; the dual inhibitors completely disrupt mitochondrial function and demonstrate potent anticancer activity with a minimum level of toxicity.


Page 3 of 21

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Introduction: Targeting glutaminolysis is an emerging approach to address the imminent problems of drug resistance and drug toxicity in cancer therapeutics. Glutaminolysis (Figure 1) is an important metabolic pathway in cancer cells that converts glutamine (Gln) to α-ketoglutarate (α-KG), which then feeds into the TCA cycle[1,2]. The predominant pathway in most cancer cells is through formation of glutamate (Glu) by the rate-limiting glutaminase (KGA/GAC) and then to α-ketoglutarate (α-KG) by GDH or by aminotransferase in the presence of other amino acids.

Alternative pathways (Fig. 1) are (A) transamination of Glu to α-KG or (B)

first transamination of Gln to α-ketoglutaramate (KGM) followed by hydrolysis of KGM to a-ketoglutarate by an amidase [3].

The relative contribution of each pathway varies among

[4]

different cell type and tissues . Lactate

Glucose

Glutamine

Pyruvate Acetyl CoA

B

Citrate

KGA/GAC

OAA TCA α-KG Cycle

GDH

A

ATP NADH

Figure 1.

Glutamate

NAD+

GSH GABA Lipid Protein Other amino acids

Glucose and glutamine metabolism of cancer cells. Alternative pathways are

(A) transamination of Glu to α-KG and (B) transamination of Gln to α-ketoglutaramate (KGM) followed by hydrolysis of KGM to a-ketoglutarate by an amidase As the initial enzyme in glutaminolysis, glutaminase expression is increased in many tumors from breast, brain, lung, lymph, cervix and other tissues [1]. Glutaminase inhibitors were shown to block Gln metabolism and starve Gln-dependent cancer cells to death [5-7]; this represents a promising therapeutic approach to develop an effective anti-cancer drug [2,8,9] with reduced toxic side effects. Reported glutaminase inhibitors (Figure 2) include acivicin, CK, DON, Compound 968 [10], BPTES [11], CB-839 [12], and Ebselen [13].

Acivicin and DON are Gln analogues that bind to

the active site of KGA/GAC and show high drug toxicity due, perhaps, to the lack of selectivity against other Gln-binding enzymes. Compound 968 was reported as an allosteric inhibitor of GAC, but the binding mode was not validated [10].

BPTES is a known

glutaminase allosteric inhibitor with poor solubility (0.01 µM).

CB-839 [12] is a BPTES

analog that inhibits the KGA coupled enzyme assay in a time dependent manner; it showed a KGA inhibition with IC50 values in the range of 26-300 nM.

CB-839 is in a phase I clinical



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 4 of 21

study for “triple negative” breast cancer with an IC50 of 20 nM in cell based assays, 50% tumor growth suppression in vivo at 200 mg/kg oral dosage, and complete tumor suppression when used in combination with Paclitaxel.

Figure 2. Structures of glutaminase inhibitors Recently, Ebselen was reported as a potent KGA inhibitor with IC50 ≈ 9 nM [13] based on a complicated KGA/GO/HRP three enzyme coupled biochemical assay using H2O2 generated during the reaction for quantification [14]. This is a complicated assay involving multiple steps: first KGA converts Gln to Glu which is then converted to α-ketoglutarate and H2O2 by Glutamate oxidase in the presence of O2; the resulting H2O2 is then utilized by Horseradish Peroxidase to convert Amplex red to a fluorescent compound resorufin which can be quantified at λex=567 nm and λem=602 nm.

Unfortunately as an antioxidant, Ebselen is

known to react with H2O2. In addition, even though Ebselen (IC50 ≈ 9 nM) was reported to inhibit the KGA enzyme ten times stronger than BPTES (IC50 ≈ 100-400 nM) [13], Ebselen showed very weak growth inhibition of Gln-dependent cancer cells such as A549 cells (IC50>10 µM) [15], whereas the validated KGA allosteric inhibitors BPTES and CB-839 [11,12] showed potent inhibition of A549 cancer cells (IC50 20-200 nM).

Although Ebselen was

reported to induce C6 glioma cell death under oxygen and glucose depletion, the mechanism is mediated by cellular GSH and can be reversed by addition of N-acetyl cysteine [16]. In addition, magnetic resonance studies have shown that Ebselen administration to humans results in slightly decreased Gln, Glu and Glx levels in the cingulated cortex [17]. Therefore, we suspected that the reported KGA inhibition by Ebselen might be an artifact of the complicated KGA/GO/HRP coupled assay. glutathione peroxidase inhibitor

As an antioxidant and the most potent

[18]

, Ebselen was reported to inhibit oxidases or reductases by

reacting with the active site cysteine or selenocysteine residue [19,20].

Using paper

chromatography, we demonstrated that Ebselen did not prevent KGA from hydrolyzing Gln. For future KGA inhibitor screening, we engineered a simple KGA/GDH assay because both are involved with glutaminolysis.

Interestingly, using the GDH assay as the counter


Page 5 of 21

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


screen, we discovered that Ebselen is a good GDH inhibitor with an IC50 of 213 nM [15] and could inhibit the KGA/GDH coupled assay. Therefore, the KGA/GDH coupled assay can not be used to evaluate Ebselen specifically as a KGA inhibitor. For rigorous characterization of a KGA binding inhibitor, the most definitive method is the biomolecular interaction analysis which measures the direct binding of a compound to the KGA enzyme. Further because selenazol-3(2H)-one contains a 5-membered ring that is similar to the thiodiazo motif of the BPTES molecules, we investigated the possibility of converting Ebselen to an actual glutaminase inhibitor by adding a linker chain to make a series of dimers (Figure 3).

Accordingly, we developed six biochemical and cell-based

glutaminolysis-focused analyses to evaluate the synthetic compounds for their KGA and/or GDH inhibition.

Furthermore, mechanistic cell based analysis demonstrated that we have

discovered some novel GDH/ KGA dual inhibitors; these inhibitors could efficiently shut down mitochondrial function and inhibit cancer cell growth much better than the KGA or the GDH inhibitors.

Figure 3.

Chemical synthesis of benzo[d][1,2]selenazol -3(2H)-one dimers(1B-6B) with

different linkers (methods reported [18] previously with modifications) Material and methods Chemicals were purchased from Aladdin (California, U.S.A). EZMTT detection reagents were from Jennifer Biotech Inc (Hangzhou, CN).

A549, T24, HL7702 cell lines, cloning

enzymes and assay kits were purchased from (Labpal, Shanghai, China). Bovine GDH from beef liver was purchased from Rochell (5Ku). The UV absorbance was measured by Flexstation 3 (Molecular Device, USA) or by TECAN sunrise Multimode Reader (Switzerland). Biomolecular interaction analysis was performed using a ForteBio K2 instrument (Pall Corp., USA) with super streptavidin (SSA) biosensors. RPMI 1640 medium and others were purchased from M&C Gene Technology Inc. (Beijing, China).



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Trypsin and EDTA were purchased from Amresco (Solon, OH, USA). Fetal bovine serum (FBS) was purchased from Zhejiang Tianhang Biological Technology Co., Ltd. (Zhejiang, China). JC1 assay kit was purchased from Beyotime biotech. Ltd. (Shanghai, China). Glutamine oxidase was purchased from Sigma (USA). The biotinylation kit was purchased from ThermoScientific (USA).

Compounds BPTES and CB-839 were synthesized in the lab

according to the methods reported and characterized by NMR and MS. KGA assay buffer A contains 50 mM Hepes, 100 mM NaCl, 0.5 mM EDTA, 0.001% Tween, pH 7.5. KGA assay buffer B contains 50 mM Hepes, 200 mM KH2PO4, 100 mM NaCl, 0.5 mM EDTA, 0.01% BSA, 0.001% Tween 20, pH 7.5. 1. Paper chromatography analysis of Gln hydrolysis by KGA KGA (100 nM) was preincubated with compounds (10 µM) in buffer A for 1 hr at 25 ℃ with shaking, and then Gln (5 mM final) in buffer B was added and reacted at room temperature overnight.

An aliquot (5 µl) from each reaction was spotted on paper

chromatography which was developed using a mixture of butanol:formic acid:water (7:3:1) and the mobility of the amino-acids was visualized by 0.5% ninhydrin. 2. HPLC analysis of the Ebselen product formed by reaction with H2O2 Ebselen (3.3 mM) and H2O2 (3.3 mM) were mixed in water (150 µl) at 25 ℃ for overnight.

Aliquots (20 µl) of Ebselen (3.3 mM), H2O2 (3.3 mM), and the reaction mixture

were injected into XB-C18 reversed phase HPLC (4.6 mm × 250 mm, 5 μm). The column was developed with a solvent mixture of Methanol : Acetonitrile : water (62:18:20) at a flow rate of 1.0 ml/min.

The elution of each component was detected by UV absorbance at 254

nm. 3. Glutamate oxidase (GO) inhibition assay The Glutamate oxidase inhibition assay was carried out according to the literature [20] with modifications.

Briefly, Ebselen (0-20 µM final concentration) was preincubated with 0.05

mU/ml GO in GO assay buffer (10 mM HEPES, 100 mM NaCl, pH 7.4), then a mixture of 0.3 mM Glu, 0.24 unit/ml HRP and 50 µM Amplex red were added, and the reaction rate were followed every 30 min by fluorescence measurement at λex=540 nm and λem=590 nm. 4. Horseradish peroxidase (HRP) inhibition assay HRP (7 ng/ml) was incubated with Ebselen (0, 0.3, 0.8 mM, respectively) for 2 hours and then the mixture was treated with TMB stain solution (15 µl) for 30 min. Then, 1M HCl (50 µl) was added to quench the reaction, and the progress of the reaction was followed by UV absorbance at 450 nm. 5. Chemical synthesis of 1A and 1B-7B


Page 6 of 21

Page 7 of 21

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Compounds (Figure 3) were synthesized using methods reported [18] previously with modifications. The key intermediate, chlorocarbonyl phenyl hypochloroselenoite (M4), was first prepared from the commercially available anthranilic acid following the published procedure [18].

Ebselen and selenazol-3(2H)-one dimers (1B-7B) were obtained by treating

M4 with the corresponding amine and diamine, respectively. Using a 50 mL round bottom flask equipped with a stir bar, we combined aniline (0.465 g, 5.0 mmol, 1.0 equiv), triethylamine (1.5 mL, 10.7 mmol, 2.1 equiv) and DCM (17.5 mL). A solution of M4 (1.3 g, 5.1 mmol, 1.02 equiv) in DCM (10 mL) was added dropwise at 0°C. The reaction was warmed to room temperature and stirred overnight. The precipitate was then filtered and washed with 10mL DCM. The crude product was further purified by silica gel column chromatography; alternatively, it can be purified by washes through water and MeOH. Synthetic compounds were purified and characterized by LC-MS, HR-MS, 1H NMR, and/ or 13

C NMR.

Ebselen (1A): Yellow solid. m.p. 173.2-174.0 ºC. 1H-NMR (500 MHz, CDCl3) δ 8.14 (d, J = 7.5 Hz, 1H), 7.69 (d, J = 7.5 Hz, 1H), 7.66 (dd, J = 8.5, 1.5 Hz, 2H), 7.64 (d, J = 1.0 Hz, 1H), 7.50-7.42 (m, 3H), 7.29 (dd, J = 12.0, 4.7 Hz, 1H). MS: ESI (MeOH), [M+H]+ m/z: 276.0. Ethanselen (1B): Yellow solid. m.p. 295.0-295.7 ºC. 1H-NMR (500 MHz, d6-DMSO) δ 8.00 (d, J = 8.0 Hz, 2H), 7.81 (dd, J = 7.5, 1.0 Hz, 2H), 7.60-7.55 (m, 2H), 7.44-7.38 (m, 2H), 4.02 (s, 4H). MS: ESI (MeOH), [M+H] + m/z: 424.9. Butanselen (2B): Yellow solid. m.p. 234.8-236.3 ºC. 1H-NMR (500 MHz, d6-DMSO) δ 8.04 (d, J = 8.0 Hz, 2H), 7.81 (dd, J = 7.5, 1.0 Hz, 2H), 7.64-7.57 (m, 2H), 7.45-7.39 (m, 2H), 3.77 (s, 2H), 1.66 (s, 4H).MS: ESI (MeOH), [M+H] + m/z: 453.0. Hexanselen (3B): Yellow solid. m.p. 196.0-198.0 ºC. 1H-NMR (500 MHz, d6-DMSO) δ 8.04 (d, J = 8.0 Hz, 2H), 7.80 (dd, J = 7.5, 1.0 Hz, 2H), 7.63-7.57 (m, 2H), 7.45-7.39 (m, 2H), 3.71 (t, J = 7.0 Hz, 4H), 1.70-1.57 (m, 4H), 1.35 (t, J = 7.0 Hz, 4H). HR-MS: ESI (MeOH), [M+H]+ m/z: calcd: 480.9855, found: 480.9928. Octanselen (4B): Yellow solid. m.p. 176.9-178.2 ºC. 1H-NMR (500 MHz, CDCl3) δ 8.05 (d, J = 7.5 Hz, 2H), 7.66 (d, J = 8.0 Hz, 2H), 7.59(td, J = 7.5, 1.3 Hz, 2H), 7.46-7.40 (m, 2H), 3.85 (t, J = 7.0, 4H), 1.75-1.70 (m, 4H), 1.41-1.34 (m, 4H). MS: ESI (MeOH), [M+H] + m/z: 509.0. 2,2'-(thiobis(ethane-2,1-diyl))bis(benzo[d][1,2]selenazol-3(2H)-one) (5B): Yellow solid. m.p. 225.3-228.3 ºC. 1H-NMR (500 MHz, d6-DMSO) δ 8.05 (d, J = 8.0 Hz, 2H), 7.82 (d, J = 7.5 Hz, 2H), 7.64 – 7.58 (m, 2H), 7.46 – 7.39 (m, 2H), 3.95 (t, J = 7.0 Hz, 4H), 2.88 (t, J = 7.0 Hz, 4H). 13C-NMR (125 MHz, d6-DMSO) δ=166.5, 139.6, 131.5, 127.6, 127.3, 125.8, 125.7, 42.8, 31.1. HR-MS: ESI (MeOH), [M+Na]+ m/z: calcd: 506.9263, found: 506.9155.



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 8 of 21

2,2'-(thiobis(propane-3,1-diyl))bis(benzo[d][1,2]selenazol-3(2H)-one) (6B) : Yellow solid. 1 H NMR (500 MHz, d6-DMSO) δ 8.05 (d, J = 8.0 Hz, 2H), 7.81 (d, J = 7.5 Hz, 2H), 7.63 – 7.57 (m, 2H), 7.44 – 7.40 (m, 2H), 3.80 (t, J = 7.0 Hz, 4H), 2.57 (t, J = 7.0 Hz, 4H), 1.93 – 1.86 (m, 4H). HR-MS: ESI (MeOH), [M+Na]+ m/z: calcd: 512.9576, found: 512.9000 6. Cloning and purification of the human KGA enzyme Human KGA gene (AF327434.1, GI:12044393) encoding amino acids 128 through 669 was PCR amplified from A549 genomic DNA using primers containing NdeI and XhoI restrictions sites at the 5’ and 3’ ends, respectively.

Forward and reverse primer sequences

were as follows: AATTCATATGGAAAATAAAATAAAACAGGG and AATTCTCGAGCAACAATCCATCAAGATTC. The purified PCR product was restriction digested and ligated into the pET-22b vector to generate the pET-hKGA plasmid.

After

DNA sequencing, the plasmid was transformed into an E. coli BL-21 strain. The recombinant C-terminal His-tagged hKGA protein was expressed after 1 mM IPTG induction for 3 hours and puriﬁed using nickel afﬁnity chromatography.

The purified protein was

analyzed by SDS-PAGE, which showed a single band with a molecular weight of 62 kDa, and further was stored in buffer (25 mM HEPES, 200 mM NaCl, 5 μM BME, 10% glycerol) at -80 ˚C. 7. Bovine GDH activity assay The bovine GDH assay was optimized by measuring the linear dose response of the enzymatic reaction initial velocities. To bovine GDH (0 -1.5 U/mgL final), a mixture of NADP+ (200 μM), glutamate (16 mM) and the EZMTT detection reagent in 50 mM Tris-Cl (pH 8.2) was added. The UV absorbance changes at 450 nm were measured every 2 min to collect linear initial velocity. For the bovine GDH inhibition assay in 50 mM Tris-Cl (pH 8.2) at 25︒C, 3-fold dilutions of compounds (0 - 26 μM) were preincubated with the GDH enzyme for 0.5 hours, and a mixture of glutamate (10 mM final), NADP+ (200 μM final) and the EZMTT detection reagent were added and reacted for 2 hrs to measure the GDH activity. 8. KGA/GDH coupled assay The compound was premixed with human KGA protein (1 nM) in 100 μl Hepes buffer A for 15 min. To the 96-well plate, Gln (20 mM) in 100 μl Hepes buffer B was added and the reaction was shaken at 25 ℃ for 3 h. The glutamate formation was then measured in a GDH coupled assay by adding a mixture containing GDH (8 nM), NADP+ (20 μM), and the EZMTT detection reagent [15].

After the solution was incubated at 25 ℃ for 5 min, the

absorbance at 450 nm was measured against the reference wavelength of 620 nm. 9. Biomolecular interaction assay using the BLI detection method


Page 9 of 21

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Biomolecular interaction analysis of compounds binding to the biotinylated KGA protein was performed using a ForteBio K2 instrument with Super Streptavidin (SSA) biosensors. KGA was biotinylated by mixing a three-fold molar excess of Sulfo-NHS-Biotin with KGA protein (1.0 mg/ml) at room temperature for 30 min and then at 4 ℃ for overnight. The biotinylated KGA protein was purified on size exclusion chromatography and contained 1-2 biotins per KGA molecule, as measured by streptavidin gel-shift assay.

SSA biosensors

were then loaded with the biotinylated KGA protein by dipping the sensor into sample plate wells containing 200 µl of 50 μg/ml KGA in PBS buffer for 5 min. For the kinetic binding assay, PBST buffer (PBS + 0.02% tween 20) containing 1% DMSO was used. The KGA coated sensor was first dipped into the blank buffer for 2 minutes to obtain a baseline signal, then into a compound sample for 5 min to measure the on-rate, and finally into the blank buffer again for 3-5 min to obtain the dissociation rate.

A series

dilution of compounds was tested in duplicate to obtain a dose response. The kinetic binding curves were obtained using double subtraction methods; the sample reference are blank PBST solution containing 1% DMSO, and the sensor reference was immobilized with biotinylated alanine. The KD data were analyzed using ForteBio Data analysis software; sensorgrams (n=6) were analyzed by kinetic fit, using 1:1 binding mode and global fit grouped by sensor. The KD values with R2 ≥ 0.5 were accepted as preliminary binding evidence. In BLI-based assays, most small molecules showed a KD between 10-4 - 10-7 M; if KD < 100 nM (10-7 M), the small molecule is identified as a potent and strong binder. 10. Cell proliferation assay. Cell proliferation was measured using EZMTT assay [15], after treatment with compounds or growth in Gln-deficient or rich media for 5 days. 96-well plate.

Briefly, cells (104/well) were plated on a

After setting aside the cells for 4 hours in rich media for adherence, cells

were treated with compounds or Gln-deficient media for 3-5 days.

NAD(P)H production in

viable cells was measured using the EZMTT method with 1 hour incubation time [15]. Results are representative of at least 2 independent experiments in triplicates. 11. JC-1 assay JC-1 assay is used to measure mitochondrial membrane potential changes in A549 cell line after compound (0.3 and 1 μM concentration) treatment.

A549 cells were treated with

compound overnight, washed once with the dilution buffer, incubated with 20 µM JC1 at 37 ℃ for 20 min, and then washed twice with dilution buffer.

Rich medium (50 µl) was

added to the treated cells for immediate JC-1 fluorescence imaging and by a plate reader measurement; the disruption of the mitochondrial membrane potential was based on the fluorescence ratio of the Green fluorescence measured at EX 490 nm and EM 530 nm versus



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 10 of 21

the Red fluorescence at EX 555 nm and EM 590 nm). 12． Statistical analysis Statistical analysis of the samples was performed using a one-way analysis of variance (ANOVA), and P-values < 0.05 were considered statistically significant. All data are reported as the means ± the standard deviation (SD) unless otherwise stated. Results and discussion 1. Ebselen did not inhibit KGA, but inhibited GO and HRP and reacted with H2O2. Ebselen was reported as a potent KGA inhibitor with an IC50 of 9 nM, but showed essentially no inhibition of Gln-dependent A549 cells. To confirm the inhibition of KGA by Ebselen, we carried out paper chromatography analysis of the KGA enzymatic reaction products. As shown in Figure 4A, Gln and Glu were separated by paper chromatograph with Rf values of 0.39 (Gln) and 0.42 (Glu), respectively.

In the presence of KGA, > 90%

Gln was hydrolyzed to Glu. In the presence of 10 µM BPTES, no conversion of Gln to Glu was observed, indicating that KGA activity was completely inhibited by BPTES. However, in the presence of 10 µM Ebselen, 90% conversion of Gln to Glu was still observed, indicating that KGA activity was not inhibited by Ebselen. Therefore, the reported 9 nM KGA inhibition by Ebselen may be due to the inhibition of redox enzymes (GO or HRP) or depletion of the read-out molecule H2O2. . As shown in Figure 4B, after incubating Ebselen with H2O2 at room temperature overnight, both the Ebselen (tR 5 min) and the H2O2 (tR 3.1 min) peaks disappeared, and a new peak at tR 3.5 min formed; this demonstrated that indeed Ebselen can react with H2O2 as reported previously. To test the inhibition of GO by Ebselen, we first obtained the linear dose response range for GO as shown in Figure 4C, then used a concentration of GO within the linear range to test the Ebselen inhibition. Under the optimal conditions, Ebselen showed an IC50 of 3 µM in inhibiting GO, as shown in Figure 4D. In addition, we tested the inhibition of HRP by Ebselen. Figure 4E shows the linear dose response range for HRP; and Ebselen inhibits HRP with an IC50 of 800 µM as shown in Figure 4F. These results demonstrated that Ebselen is not a potent inhibitor of KGA with an IC50 near 9 nM.


Page 11 of 21

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Figure 4. Ebselen is not a KGA inhibitor, even though it showed inhibition in KGA/GO/ HRP coupled assay: A) Gln hydrolysis by KGA in the presence of inhibitors, demonstrating Ebselen could not inhibit KGA; B) HPLC analysis of H2O2, Ebselen and the reaction product of H2O2 and Ebselen, demonstrating that Ebselen could diminish H2O2 level; C) Linear dose response curve in GO assay; D) Inhibition of GO activity by Ebselen (IC50 3 µM); E) Linear dose response curve in HRP assay; F) Inhibition of HRP activity by Ebselen. 2. KGA biochemical assay using GDH as the coupled enzyme We configured a human KGA/GDH coupled enzymatic assay, because both enzymes are involved in the initial steps of glutaminolysis before the TCA cycle. Under optimized assay conditions, the reaction initial velocities showed linear dose response to human KGA enzyme concentration (Figure 5A), and also the assay showed excellent reproducibility with a measured Z factor of 0.85 (Figure 5B). The dose response of Gln concentration to KGA enzyme initial reaction velocities was curve-fitted using the Michaelus Menton equation (Figure 5C); the obtained Gln KM of 2.78 ± 0.26 mM for the recombinant KGA is similar to that of the native KGA enzyme [21].

Figure 5. KGA/GDH coupled assay showed linear dose response to KGA concentration and high assay reproducibility.



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

3. Enzyme activity and kinetic binding (BLI) assays demonstrated that Ebselen inhibits GDH but not KGA In our E. coli GDH, bovine GDH and human KGA/GDH assays, the initial reaction velocities showed linear dose response to its corresponding enzyme concentrations; under the same optimal conditions, Ebselen showed an IC50 of 200 nM for the GDH (Figure 6A, B) and 900 nM in KGA/GDH coupled assay (Figure 6C); the IC50 values are not time-dependent and the same IC50s were observed without or with up to 2 hrs preincubations (data not presented), indicating Ebselen is a reversible inhibitor of GDH. In such coupled assays that involve two enzymes, inhibition of either enzyme will give positive results. Therefore, in order to confirm that Ebselen is a KGA inhibitor [11], we tested the compound using a direct kinetic binding assay to the KGA enzyme alone; this direct KGA binding assay will resolve this ambiguity. For rigorous characterization, all inhibitors from the KGA/GDH coupled assay were further characterized based on their direct kinetic binding to a single enzyme (KGA) immobilized on an SSA biosensor detected by BLI methods. The kinetic binding assay to KGA enzyme was developed and validated using its substrate (Glutamate) and its inhibitor (BPTES). Human KGA showed dose dependent direct binding to its substrate Gln (KD 4 µM) and its known inhibitor BPTES (KD 0.2 µM), but no binding for Ebselen ((Figure 6D-F).

Figure 6.

Reproducible binding was observed.

Enzyme activity and kinetic binding (BLI) assays demonstrated that Ebselen

inhibits GDH but not KGA:

Ebselen inhibited A) E. coli GDH, B) Bovine GDH, C)

Human KGA/GDH coupled assays.

Kinetic binding of KGA to D) Gln (1-100 µM), E)

BPTES (0.1-10 µM) and F) Ebselen (0.1-10 µM) in PBST buffer containing 1% DMSO. (red, low conc. 1X ; blue, middle conc. 10X ; black, high conc.100X) . 4.

Chemical Synthesis of novel compound 5B and other dimers for SAR analysis Since BPTES contains a 5-atom thiodiethyl linker, we mainly focused on the synthesis of Using Glide and DS drug design software and the GAC/BPTES co-crystal structure

5B. [22,23]

, we did a preliminary autodock of the designed 5B and Ebselen into the GAC/BPTES


Page 12 of 21

Page 13 of 21

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


pocket (Figure 7); the two Libdock scores for 5B (130, 150) are better than that for Ebselen (102, 109), indicating that 5B is likely to fit in the allosteric site of GAC. 5B-6B are novel compounds that are fully characterized by HPLC, 1HNMR, 13CNMR, MS, HR-MS.

For

SAR studies, we also included the synthesis of dimers with shorter linker size such as 1B, 2B, and 3B. The chemical synthesis of 1B has been reported and 1B was identified as the most potent inhibitor targeting Thioredoxin reductase (TrxR)[18].

Here, based on rigorous biological tests

using seven assays as shown in Table 1 and Figures 8,9,10, we identified the nature of the inhibitory activity of compounds 1A, 1B-6B as glutaminolysis inhibitors.

Figure 7. Autodock of 5B into the allosteric site of BPTES/GAC co-crystal structure. Pink and brown colors show the GAC polypeptide; the middle green is BPTES; the light blue is 5B. 5.

3B-6B were identified as novel KGA/GDH dual inhibitors The structure activity relationships (SAR; Table 1; Figure 8) were built by testing the

compounds in enzyme activity assays (GDH assays, KGA/GDH coupled assay), kinetic binding assays (GDH, KGA), and cell-based assays (cancer cells and normal cells).

Table 1: Biological activity of BPTES and selenazol-3(2H)-one dimers

Compounds

BPTES 1A 1B 2B

Enzyme Functional assay1 IC50 (μM)

Kinetic KGA enzyme Binding1 KD (μM)

Bovine GDH

E.coli GDH

KGA/ E.coli GDH

Steady state

Curve fitting

R2

NO

NO

0.4

0. 4

0.4

0.74

0.8

0.2

0.9

NO

NO

1.5

0.2

1.6

NO

NO

1.3

0.2

0.6

NO

NO



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

3B 4B 5B 6B CB839 EGCG

Page 14 of 21

0.8

0.3

0.2

0.2

0.1

0.64

20

0.5

0.4

0.4

0.2

0.51

1.6

0.4

0.1

0.14

0.13

0.89

13

2.3

1.5

6.3

6.3

0.80

NO

NO

1.6

0.1

0.1

0.86

0.7

0.05

3

NB

NB

NB

NB, no binding; NO, no inhibition; each compound was tested in triplicates and repeated for at least 3 times. Bold is to emphasize the important data. 1 The standard deviations are 10% in the enzyme activity assay (IC50) and direct binding assay (KD). The known KGA allosteric inhibitors BPTES and CB-839 were used to validate the assays in Table 1 and Figure 8A, a, B, b. Both compounds did not inhibit the GDH enzyme, but inhibited in the KGA/GDH coupled assay (IC50 400 nM). In addition, both compounds showed binding to KGA in BLI kinetic assay (KD 200 nM). Under the same assay conditions, compounds 3B, 4B, 5B and 6B inhibited both GDH and KGA/GDH coupled assays with similar IC50’s as shown in Table 1 and Figure 8C, c, D, d, E, e, F, f, and also showed direct binding to KGA in BLI assay.

Therefore, compounds

3B-6B were identified as novel KGA/GDH dual specific inhibitors. Compounds 1A, 1B, 2B inhibited the GDH activity 3-10 fold better than those of the KGA/GDH assays (Figure 8g, i, h).

However, in the direct KGA binding assays, no binding

of these compounds to KGA enzyme was observed (Figure 8G, I, H). Therefore, compounds 1A, 1B, 2B were identified as GDH inhibitors. In summary, the kinetic binding data matches the enzyme activity assay as shown in Table 1 and Figure 8.

GDH inhibitors (1A, 1B, 2B), which do not inhibit KGA, showed

better potency in the GDH assay than in the KGA/GDH coupled assay.

KGA/GDH dual

inhibitors (3B, 4B, 5B, 6B) showed better or similar potency in the KGA/GDH couple assay than in the GDH assay; inhibition of KGA provided additional inhibitory effect in KGA/GDH activity assay.


Page 15 of 21

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Figure 8. Identification of the GDH, KGA or the novel dual KGA/GDH inhibitors. A-H) BLI based kinetic binding assay.

Binding of KGA to A) BPTES, B) CB-839, C) 3B, D) 4B,

E) 5B, F) 6B, G) 1A,H)1B, I) 2B in PBST buffer. (red 0.1 µM, blue 1 µM, black10 µM) . a-h) IC50 of the corresponding compounds in GDH and in KGA/GDH assays. 6.

A549 and T24 cell lines are strongly Glutamine-dependent. To evaluate the Gln-dependence of the cancer cell lines, we did a viability test in both rich

medium and Gln-deficient medium for 5 days (Figure 9).

Nearly complete growth inhibition

was observed for cancer cell lines (A549 and T24) in Gln-deficient media. Interestingly, because the EZMTT cell viability detection reagents do not have inhibitory effect to the cells [15]

, we treated the A549 or T24 cells grown in Gln-deficient medium for 5 days with the

EZMTT reagents for overnight, and found significant growth signals, indicating glutamine starvation alone did not kill the cells completely, especially the T24 cells. This perhaps can be explained by the existence of alternative or interactive metabolic pathways.

For example,

under glutamine starvation conditions, the TCA cycle might be partially fueled by Acyl-CoA from glucose or fatty acid metabolic pathways or by glutamic acid through glutamate dehydrogenase and/or aminotransferase pathways.



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Figure 9. The Gln-dependence of A549 and T24 cell lines was measured based on the growth difference in rich media (A, C) and in Gln-deficient media (B, D) for 5 days. E) Cell viability (growth in the Gln-deficient versus in the rich media) was measured after incubation with the EZMTT reagent for 1 hr and for 24 hrs. The mean and SEM of multiple measurements are plotted. Results are representative of at least two independent experiments. Comparisons of treated and untreated conditions were performed by unpaired t test: *, P

Biomolecular Interaction Assays Identified Dual Inhibitors of

Recommend Documents