Environ. Sci. Technol. 2003, 37, 1422-1431
Bioreactive Barriers: A Comparison of Bioaugmentation and Biostimulation for Chlorinated Solvent Remediation J. M. LENDVAY,† F. E. LO ¨ FFLER,f M. DOLLHOPF,| M. R. AIELLO,| G. DANIELS,§ B. Z. FATHEPURE,⊥ M. GEBHARD,§ R. HEINE,# R. HELTON,| J. SHI,# R. KRAJMALNIK-BROWN,f C. L. MAJOR, JR.,‡ M. J. BARCELONA,‡ E . P E T R O V S K I S , § R . H I C K E Y , |,£ J . M . T I E D J E , | A N D P . A D R I A E N S * ,‡ Department of Environmental Science, University of San Francisco, San Francisco, California 94117, Environmental and Water Resources Engineering, The University of Michigan, Ann Arbor, Michigan 48109, GeoTrans, Inc., 710 Avis Drive, Ann Arbor, Michigan 48108, Center for Microbial Ecology, Michigan State University, East Lansing, Michigan 48824, Department of Microbiology and Molecular Genetics, Oklahoma State University, Stillwater, Oklahoma 74078, EFX Systems, 3900 Collins Road, Lansing, Michigan 48910, The RETEC Group, 3900 Collins Road, Lansing, Michigan 48910, and School of Civil and Environmental Engineering, Georgia Institute of Technology, Atlanta, Georgia 30332
A side-by-side comparison of bioaugmentation, biostimulation, and a recirculation-only control was implemented in a chloroethene-contaminated aquifer. The objective was to develop a contaminant mass balance based on the analysis of groundwater and aquifer solids and to quantify key dechlorinating populations during treatment to determine their relation to the rate of chloroethenes removed. The bioaugmentation strategy, using a Dehalococcoides-containing PCE-to-ethene dechlorinating inoculum enriched from the same aquifer, resulted in a nearstoichiometric dechlorination of both sorbed and dissolved chloroethenes to ethene within 6 weeks. In the biostimulation plot, continuous lactate and nutrient injection resulted in dechlorination but only following a 3-month lag period. Molecular tools targeting the 16S rRNA genes of Dehalococcoides and Desulfuromonas spp. were used to qualitatively monitor the distribution and quantitatively (RealTime PCR) measure the abundance of the dechlorinating populations during the test. In the bioaugmentation plot, Dehalococcoides populations increased 3-4 orders of magnitude throughout the test area. Dehalococcoides populations also increased in the biostimulation plot but at a slower rate and immediately before the onset of rapid dechlorination. Terminal Restriction Fragment Length * Corresponding author phone: (734)763-1464; fax: (734)763-2275; e-mail:
[email protected]. † University of San Francisco. ‡ The University of Michigan. § GeoTrans, Inc. | Michigan State University. ⊥ Oklahoma State University. # EFX Systems. £ The RETEC Group. f Georgia Institute of Technology. 1422
9
ENVIRONMENTAL SCIENCE & TECHNOLOGY / VOL. 37, NO. 7, 2003
Polymorphism analysis indicated that the inoculum only impacted the bioaugmentation plot. This work extends the knowledge gained from previous field studies which reported qualitative relationships between the occurrence of Dehalococcoides populations and ethene production. Furthermore, the results demonstrate that bioreactive barriers capitalizing on reductively dechlorinating populations to control the migration of chloroethene plumes can be effectively designed once hydrologic information is incorporated.
1. Introduction During the past decade, chloridogenesis (also known as dechlororespiration or chlororespiration) has been identified as an ecologically important respiratory process, whereby chlorinated compounds are used as metabolic electron acceptors (1). Laboratory studies with mixed chloroethenedechlorinating cultures suggested that Dehalococcoides spp. are the most important microbial populations involved in ethene formation (2, 3). Two Dehalococcoides populations, Dehalococcoides ethenogenes strain 195 and Dehalococcoides sp. strain FL2, have been shown to dechlorinate PCE and TCE, respectively, to ethene (4, 5). To date, Dehalococcoides species have been found in ethene-producing cultures and at sites where complete dechlorination to ethene occurred (6). Other populations have been identified with more limiting dechlorination activities, such as Desulfuromonas spp. which reduce both PCE and TCE to cis-DCE. Whereas complete reduction of chloroethenes to ethene can be effectively stimulated using molecular hydrogen as the electron donor, the members of the PCE-dechlorinating Desulfuromonas group use acetate rather than hydrogen as electron donor for PCE to cis-DCE dechlorination (5, 7). Chloridogenic populations are desired in bioremediation of chlorinated solvents because they exhibit high dechlorination rates, can catalyze complete dechlorination to the nontoxic end product ethene, outcompete other hydrogenotrophic populations at low dissolved hydrogen concentrations (e.g. sulfate reducers, methanogens, acetogens), and use electron donors efficiently (e.g. the majority of the reducing equivalents generated in electron donor oxidation is consumed in reductive dechlorination) (7-9). Field studies demonstrating the effectiveness of in situ stimulation or augmentation with chloridogenic consortia to remediate contaminant plumes are limited. A recently completed pilot demonstration at Dover Air Force Base, Delaware, consisting of biostimulation followed by bioaugmentation with an enrichment culture capable of complete dechlorination of TCE to ethene indicated the potential for this strategy (10). Whereas biostimulation using lactate and nutrient mixtures resulted predominantly in the formation of cis-DCE, bioaugmentation effected the formation of ethene without accumulation of VC. Bioaugmentation with another mixed PCE-to-ethene transforming culture (KB-1) at Kelly AFB (Texas) resulted in contaminant half-lives on the order of hours in the field, with transient accumulation of VC (11). 16S rRNA gene-based molecular characterization demonstrated that Dehalococcoides populations were not detectable in the Kelly AFB aquifer samples. However, after bioaugmentation with the KB-1 culture, Dehalococcoides-like populations present in the inoculum were qualitatively detected within the test area (11). Dybas et al. (12) demonstrated the potential for application of a pure culture, Pseudomonas stutzeri KC, for the development of biocurtains to contain and treat carbon tetrachloride (CT) plumes. Implementation 10.1021/es025985u CCC: $25.00
2003 American Chemical Society Published on Web 02/27/2003
of the bioaugmentation strategy with strain KC following a pH adjustment resulted in microbial colonization of the aquifer and effective degradation of CT without accumulation of chloroform. The purpose of the current field study was (i) to conduct a side-by-side comparison of the effectiveness of bioaugmentation, biostimulation, and a recirculation-only control, (ii) to develop a contaminant mass balance based on the analysis of groundwater and aquifer solids, and (iii) to quantify key dechlorinating populations after the bioaugmentation and biostimulation treatments to determine the extent of their growth and its relation to the rate of chloroethenes removed.
2. Experimental Methodology 2.1. Site Description. The Bachman Road Residential Wells Site consists of a PCE plume derived from former dry-cleaning operations along the Lake Huron shoreline (Figure 1, Supporting Information). The plume shows evidence of naturally occurring reductive dechlorination as indicated by the appearance of reductive dechlorination products (TCE, cis-DCE, and VC). The subsurface lithology is composed of primarily fine to medium grained sand of low organic content (0.4 wt %). A clay layer of low conductivity and high PCEsorptive capacity underlies this sand. The total thickness of the sand deposits is approximately 7.3 m. The depth to groundwater at the site ranges from approximately 2.3 to 2.6 m below surface (mbs). Hydraulic conductivity measurements vary from 396 to 914 cm/day with the prevailing regional groundwater velocity estimated at 256 cm/day. 2.2. Inoculum Description and Preparation. Activity measurements in microcosm studies with materials collected from different locations and depths inside the plume demonstrated a heterogeneous distribution of the dechlorinating populations in the Bachman aquifer (5, 13). A sediment-free, nonmethanogenic, PCE-to-ethene-dechlorinating consortium was obtained which, through repeated transfers and dilution-to-extinction in medium with acetate as the only available electron donor and PCE as the electron acceptor, yielded a pure culture of an acetate-oxidizing PCEto-cis-DCE-dechlorinating Desulfuromonas species, designated Desulfuromonas michiganensis strain BRS1 (7). Enrichment with lactate as the electron donor and cis-DCE as the electron acceptor yielded a highly enriched mixed culture that rapidly produced ethene with minimal VC accumulation. 16S rRNA gene-based analysis revealed the presence of at least one Dehalococcoides population in this enrichment (14). The presence of culturable populations capable of complete dechlorination of PCE to ethene from the site provided impetus for a controlled comparison of side-by-side biostimulation and bioaugmentation strategies for plume control. Desulfuromonas michiganensis strain BRS1 and the cis-DCE-to-ethene dechlorinating enrichment culture were combined to achieve a robust PCE-to-ethene dechlorinating culture to seed the reactor. The culture was scaled up by growth in reduced minimal medium in glass vessels mixed via recirculation of the liquid phase using peristaltic pumps. The pH was maintained between 6.6 and 7.0 via addition of sodium bicarbonate and controlled using an in-line pH monitor. The culture was then fed sodium lactate as a source of reducing equivalents and PCE as electron acceptor. Lactate and PCE were added together via manual injection of concentrated stock solutions, and the system was monitored for disappearance of PCE as well as sequential production and disappearance of dechlorination daughter products. Additional substrates were added when all chloroethenes were depleted. The amount of lactate and PCE added depended on the rate of formation and disappearance of reduced daughter products.
The bioaugmentation plot was inoculated according to the following inoculation strategy. First, 75 L of groundwater was extracted from the control plot, fed into the inoculation tank, and reduced with 5 mg/L of sulfide (as S). The inoculum (200 L) was shipped to the site in anaerobic air-sealed vessels and was mixed with the reduced groundwater in the inoculation tank. This mixture was sampled for cell density and microbial community analyses, and approximately 220 L of the microbial suspension was injected across the entire saturated thickness via both injection wells. An additional 110 L of site groundwater was mixed with the remaining cell suspension, and 128 L of this diluted mixture was injected to promote distribution of the inoculum into the treatment zone. Following the inoculation, addition of 0.1 mM lactate and nutrients (phosphate and nitrate) was initiated. No electron donor, nutrients, or microorganisms were added to the control plot. 2.3. Plot Construction and Operation. (i) Installation. Two plots (4.6 m × 5.5 m) were constructed perpendicular to groundwater flow and separated by a plot of the same size (Figure 1, left). The Southern plot was used to explore bioaugmentation, and the Northern plot was initially used as a control plot and later amended with lactate to evaluate the potential for biostimulation. Each plot was bounded by dual level piezometers (identified as ML-810 through ML817) at each corner, with 61 cm screens centered at 3.7 mbs and 5.5 mbs. Two 10 cm diameter injection wells, screened at 3.0-6.1 mbs, were located as shown in Figure 1 on the west side of the plots, and a single extraction well (also screened at 3.0-6.1 mbs) was located toward the Eastern side of the plots. Finally, four separate multilevel arrays (identified as ML-818 through ML-825) were positioned in a diamond configuration with 10 cm screens at 3.7, 4.3, 4.9, and 5.5 mbs, to provide discrete monitoring points with depth over the center of each plot. During the pilot study, groundwater was recirculated from the extraction well into the two injection wells. Each of the injection wells was equipped with a flow meter and associated flow control valve to equalize groundwater flow into each well. Modeled flow lines for a 15 L/min pumping regime show that for an ideal pumping situation, the two plots are spaced to prevent crossflow (Figure 1, right). A bromide tracer test confirmed that the two plots were hydraulically separated at this flow rate. This test also provided a Darcy velocity estimation of 12 cm/day within the flow field. The pilot study was conducted in three phases: (i) preoperational site characterization and aquifer reduction; (ii) bioaugmentation and control test; and (iii) biostimulation test. For clarity, time zero for the bioaugmentation test was set to the time of inoculation (Figure 2). Similarly, time zero for the biostimulation test was set to the time of initial lactate injection in the Northern plot, which occurred 101 days after the bioaugmentation study was initiated. (ii) Geochemical Monitoring. Piezometers and multilevel arrays were sampled using peristaltic pumps. After purging the sample tubing, the pump effluent was attached to a QED flow cell (Ann Arbor, MI) to measure temperature, pH, ORP, specific conductivity, and DO. All probes were calibrated daily prior to each sampling event. Flow cell readings were recorded after 20-30 min when stable baselines were observed. After the flow cell readings, DO and aqueous ferrous iron concentrations were determined colorimetrically using Chemetrics (Calverton, VA) field sampling kits. Duplicate laboratory samples to analyze for chlorinated ethenes and methane were collected in 40-mL borosilicate vials, preserved by the addition of a few drops of concentrated sodium bisulfite to lower the pH below 2, and capped with Teflon-lined rubber septa. Collected samples were immediately stored at 4 °C until analysis according to U.S. EPA methods 8120A and VOL. 37, NO. 7, 2003 / ENVIRONMENTAL SCIENCE & TECHNOLOGY
9
1423
FIGURE 1. Plan drawing of the wells and sampling points for plots at the Bachman Road Residential Wells Site (left). The control and biostimulation plots are physically the same. Flowlines for a 15 L/min pumping regime are also shown (right - not to scale). The groundwater flow model indicates that there is no cross-flow between plots at this flow rate. 8260B. Dissolved hydrogen concentrations as indicator of the predominant terminal electron accepting processes (TEAPs) active in situ were determined using Microseeps (Pittsburgh, PA) field sampling protocols (5, 15). In addition to sampling at discrete points, samples for analysis were taken from the extraction wells in both plots in weekly intervals. These samples were obtained through in-line sampling ports on the discharge from the extraction wells. Samples for PCE and dechlorination products were collected in duplicate 40-mL borosilicate vials, preserved, and capped as described above. Ethene was measured in the aqueous effluent samples of each plot, but not in samples from the piezometers. Gas chromatography analyses were conducted to determine concentrations of chlorinated ethenes, ethene, and methane (16). Organic acids were measured using high performance liquid chromatography (HPLC) as described (17). Aquifer cores were collected using Geoprobe equipment (Salina, KS) near the extraction wells prior to the field tests (day -26) and 3 months after bioaugmentation. In addition, 1424
9
ENVIRONMENTAL SCIENCE & TECHNOLOGY / VOL. 37, NO. 7, 2003
a final set of cores was taken from the center of each plot at the conclusion of the study (day 212). Sampling and handling of materials were performed as described by Fennell et al. (18). Aquifer cores were sampled for contaminant concentrations using EPA method 8120 and used for the extraction of community DNA as described (5). (iii) Microbial Monitoring. Groundwater samples were collected approximately monthly from multilevel arrays ML818 and ML-820 in the control plot and ML-822 and ML-824 in the bioaugmentation and ML-818 and ML-820 for the biostimulation plots at 3.7 and 5.5 mbs for each array and immediately stored at 4 °C. The samples (50-100 mL) were filtered through 0.2 µm membrane filters to collect microbial biomass. The filters were placed in 2 mL plastic tubes with 1 mL of TE buffer (10 mM TRIS, 1 mM EDTA, pH 8.0). Rigorous shaking for 5 min yielded a cell suspension suitable for DNA extraction using the UltraClean Soil DNA Kit from Mo Bio Laboratories, Inc. (Solana Beach, CA). Alternatively, cell suspensions were diluted appropriately, and whole cells were used as a template in the Polymerase Chain Reaction (PCR).
FIGURE 2. Diagram of the two time scales used in this study. The bioaugmentation and control time scales are set to zero on the date of inoculation. The biostimulation time scale is set to zero on the date that continuous lactate feed commenced in the biostimulation plot. Day 101 of the bioaugmentation time scale relates to day 0 of the biostimulation time scale. The presence of Dehalococcoides species and PCE-dechlorinating Desulfuromonas populations was evaluated using dechlorinator 16S rRNA gene-targeted primer pairs in a nested PCR approach as described previously (5). In addition to previously published primers, the primer pair 5′-GCG GTT TTC TAG GTT GTC-3′ (Dhc 730 F) and 5′-CAC CTT GCT GAT ATG CGG-3′ (Dhc 1350 R) was used to target Dehalococcoides species (14). Community DNA was also PCR-amplified to perform Terminal Restriction Fragment Length Polymorphism (T-RFLP) analysis as previously described (19). In addition, aquifer cores were collected at three times and used for the extraction of community DNA as described (5). Real-Time (RTm) PCR (TaqMan-PCR) was used to quantify Dehalococcoides and Desulfuromonas populations. This method has been shown to provide precise and accurate quantitation of microbial populations and genes in soils and sediments (20-23). The 16S rRNA gene forward and reverse primers and probes were, respectively, for Desulfuromonas 5′ GACATCCCGATCGCACCTTA 3′, 5′ CCATGCAGCACCTGTCACC 3′, 5′FAM-AACATAGGGGTCAGTTCGGCTGGITTAMRA 3′; and for Dehalococcoides 5′ CTGGAGCTAATCCCCAAAGCT 3′; 5′ CAACTTCATGCAGGCGGG 3′; 5′ FAMTCCTCAGTTCGGATTGCAGGCTGAA-TAMRA 3′ (14). The r2 values for the standard curves for both populations were >0.99 in both pure cultures and in sediment samples. Detection limits of 102 and 103 16S rRNA gene copies per g of aquifer material were determined for Dehalococcoides spp. and Desulfuromonas spp., respectively.
3. Results Preoperational Pilot Site Characterization. A transect normal to groundwater flow was sampled at 3.05, 4.57, and 6.10 mbs (exemplified for selected parameters in Figure 2, Supporting Information) using the multilevel piezometers (ML-810 through ML-817) bracketing the pilot study area (see Table 1, Supporting Information) as well as using six aquifer core samples collected near the extraction well of the pilot plots. The transect data indicate substantial heterogeneity in groundwater aquifer characteristics at the site. Along the North-South (N/S) axis, respiratory endpoints (oxygen and iron) indicated that the bioaugmentation plot contained >6 mg/L of oxygen in shallow depths. Moreover, while the concentrations of PCE increased in the N/Sdirection, those of cis-DCE decreased, supporting prior evidence of partial reductive dechlorination by indigenous populations. Based on these data, the plot impacted primarily
by PCE (the southern plot) was chosen for the bioaugmentation control strategy to capture the complete dechlorination potential exhibited by the dechlorinating inoculum. Groundwater analysis from the piezometers (Table 1, Supporting Information) indicated that PCE concentrations were higher in shallow sample points and cis-DCE dominated in deeper sample points. Moreover, dissolved oxygen (DO), dissolved iron, methane, and oxidation-reduction potential (ORP) data suggested that shallow portions of the bioaugmentation plot were aerobic (> 6 mg/L of oxygen), while shallow parts of the control plot were anoxic to reduced (i.e., iron-reducing or methanogenic). The deep portions of both plots exhibited dissolved oxygen concentrations below 1 mg/ L, soluble iron concentrations ranging from
