ARTICLE pubs.acs.org/Biomac
Biosynthesis and Characterization of Poly(3-hydroxydodecanoate) by β-Oxidation Inhibited Mutant of Pseudomonas entomophila L48 Ah-Leum Chung,† Hong-Liang Jin,† Long-Jian Huang,† Hai-Mu Ye,‡ Jin-Chun Chen,† Qiong Wu,† and Guo-Qiang Chen*,† †
MOE Key Lab of Protein Sciences, Department of Biological Sciences and Biotechnology, School of Life Sciences and ‡Department of Chemical Engineering, Key Laboratory of Advanced Materials of Ministry of Education, Tsinghua University, Beijing 100084, China
bS Supporting Information ABSTRACT: A medium-chain-length (MCL) polyhydroxyalkanoates (PHAs) producer Pseudomonas entomophila L48 was investigated for microbial production of 3-hydroxydodecanote homopolymer. Pseudomonas entomophila L48 was found to produce MCL PHA consisting of 3-hydroxyhexanoate (3HHx), 3-hydroxyoctanoate (3HO), 3-hydroxydecanoate (3HD), and 3-hydroxydodecanoate (3HDD) from related carbon sources fatty acids. In this study, some of the genes encoding key enzymes in β-oxidation cycle of P. entomophila such as 3-hydroxyacyl-CoA dehydrogenase, 3-ketoacyl-CoA thiolase, and acetyl-CoA acetyltransferase were deleted to study the relationship between β-oxidation and PHA synthesis in P. entomophila. Among the mutants constructed, P. entomophila LAC26 accumulated over 90 wt % PHA consisting of 99 mol % 3HDD. A fed-batch fermentation process carried out in a 6 L automatic fermentor produced 7.3 g L1 PHA consisting of over 97 mol % 3HDD fraction. Properties of MCL PHA were significantly improved along with increasing 3HDD contents. P(2.1 mol % 3HD-co-97.9 mol % 3HDD) produced by P. entomophila LAC25 had the widest temperature range between Tg and Tm, which were 49.3 and 82.4 °C, respectively, in all MCL PHA reported so far. The new type of PHA also represented high crystallinity caused by side-chain crystallization compared with short side chain PHA. For the first time, P(3HDD) homopolymers were obtained.
’ INTRODUCTION Polyhydroxyalkanoates (PHAs) are biodegradable and biocompatible polyesters that can be synthesized by many bacteria as intracellular granules.15 Microbial PHAs have received considerable attention because of their material properties and related applications for packaging, biofuels, and biomedicine.2,68 They can be divided into three groups according to the side chain length, namely, short-chain-length PHA (SCL PHA) with monomers of C3C5, medium-chain-length PHA (MCL PHA) with C6C12, and long-chain-length PHA (LCL PHA) with monomers over C13.1,915 MCL PHA monomers mostly consist of 3HHx (3-hydroxyhexanoate), 3HO (3-hydroxyoctanoate), 3HD (3-hydroxydecanoate), and 3HHD (3-hydroxydodecanoate).9 MCL PHA tends to be sticky, elastic, and amorphous materials, whereas SCL PHAs behave as partially crystalline thermoplastic materials.2,20 Some strains of Pseudomonas spp., which is the most common MCL PHA-producing species, such as P. oleovorans, P. putida, and P. resinovorans, can accumulate PHA from fatty acids.9,16,17 When fatty acids were used as the sole carbon sources, the β-oxidation pathway plays an important role in providing intermediates for PHA synthesis.18,19 Namely, fatty acids as carbon sources enter β-oxidation cycle and lose two carbon atoms in each cycle,20,21 leading to shortened n-alkanoic acid monomers r 2011 American Chemical Society
in resultant PHA. 3-Ketoacyl-CoA thiolase (FadA) and 3-hydroxyacyl-CoA dehydrogenase (FadB) are two important enzymes catalyzing the last two steps in the β-oxidation pathway.18,2224 Ouyang et al.19 constructed a β-oxidation-impaired mutant of Pseudomonas putida KT2442 by deleting fadB and fadA genes to synthesize PHA with a high 3HDD fraction over 40 mol %. Recently, Ma et al.25 and Liu et al.26 reported production of homopolymer PHD and 3HDD monomers dominating PHA (of which 3HDD contents were 56.3 and 84.3 mol %, respectively) using β-oxidation inhibiting mutants of P. putida on relevant carbon sources. MCL PHA consisting of mainly 3HDD showed improved thermal and mechanical properties over the conventional MCL PHAs, which usually have low Tm (96% are found in synteny.28 P. entomophila genome harbors most of the central catabolic genes found in P. putida KT2440, indicating the possibility of MCL PHA production. Furthermore, P. entomophila was found containing genes encoding enzymes for the catabolism of long-chain carbohydrates.28 In this study, for the first time, P. entomophila was explored as a MCL PHA producer. The new MCL PHA producer was able to produce MCL PHA with a high 3HDD fraction of 99 mol % with deficient β-oxidation pathway. Furthermore, some interesting improvements on properties of MCL PHA were observed along with increasing 3HDD contents. One of our new types of PHA had the widest temperature range between Tg and Tm, which were 49.3 and 82.4 °C, respectively, among all MCL PHA reported so far. The enhanced thermal and mechanical properties indicated expanded application in further studies.
’ MATERIAL AND METHODS Bacterial Strains. E. coli JM109 (endA1, glnV44, thi-1, relA1, gyrA96, recA1, mcrB+, Δ(lac-proAB), e14- [F0 , traD36, proAB+, lacIq, lacZΔM15], hsdR17(rKmK+)) was used as the host for plasmid construction. Pseudomonas entomophila L48 was a member of Pseudomonas family that shares most of the fatty acid metabolic gene clusters with Pseudomonas putida.28 The bacteria were kindly provided by Professor Frederic Boccard (Centre de Genetique Moleculaire, Centre National de la Recherche Scientifique, France).29 The strain was also used as a DNA recipient via electroporation. The mutants from P. entomophila L48 are listed in Table 1. Plasmids Construction. pK18mobsacB31 was a suicide vector donated from Dr. Andreas Sch€afer of the University of Bielefeld (Bielefeld, Germany). The method to generate defined gene knockout mutant was mostly described by Sch€afer et al.31 and by our previous study.9,10 A fragment from P. entomophila L48 genome containing partial
length of upstream and downstream of targeted gene was amplified by PCR using the primers listed in Table 2. PCR products were digested by restriction endonucleases and were inserted into pK18mobsacB vector to construct a new knockout plasmid. (See Table 1.) Deletion of genes normally affects cell growth; antibiotic selection markers such as gentamycin resistance gene were inserted between two homologous fragments of some target genes to increase the success ratios of isolating defined deletion mutants.32 The four gene specific primers as illustrated in Table 2 were used to amplify two homologous fragments upstream and downstream of the specific target gene. Simultaneously, Gm-1 and Gm-2 primers (Table 2) were used to amplify the GmR cassette from pKD13-Gm template. The GmR fragment can be prepared in large amounts because it was used for all constructs. Followed by digestion with specific restriction endonucleases, these fragments were ligated to pK18mobsacB to form a suicide plasmid with gentamycin resistant. The plasmid was transformed into wild type or the mutants of P. entomophila by electroporation. Knockout Procedure. The method to generate a defined gene knockout mutant is described by Sch€afer et al.31 and by our previous study.9,19,23,25 Growth Medium and Shake-Flask Cultural Conditions. LB medium containing (g L1): yeast extract 5, tryptone 10, and NaCl 10 were used for seed culture preparation. One-step shake-flask cultivation was conducted in LB medium supplied with 12 g L1 dodecanoic acid as a related carbon source. The seed cultures were incubated at 30 °C in LB medium for 12 h at 200 rpm on a rotary shaker and then were inoculated into shake-flask cultivation medium by a volume of 5%. Shake-flask cultivation was carried out at 30 °C for 48 h at 200 rpm on a rotary shaker. Fermentor Cultural Conditions. A total of 300 mL of seed cultures in LB medium served as inoculants for fermentor scale production. We used a BF-115 6 L fermentor (New Brunswick Scientific, Edison, NJ, U.S.) with a working volume of 3 L. The culture condition was set at 30 °C and the pH was between 6.3 and 6.7. Dissolved 3560
dx.doi.org/10.1021/bm200770m |Biomacromolecules 2011, 12, 3559–3566
Biomacromolecules
ARTICLE
Table 2. Primers Used in This Study for Constructing Suicide Plasmidsa primers
sequences
restriction enzymes
C1ZC2-H1-1
ATAGGATCCAGCGTCGTAGATGAGTAACAAGAAC
BamHI
C1ZC2-H1-2
ATACATATGCTGGATAAGCTCCAGCACGTC
NdeI
C1ZC2-H2-1
TATCATATGGAAAGCACCCTGAGTGACGAC
NdeI
C1ZC2-H2-2
ATAGCTAGCGGCTCAGGTCGAAGATATAGAACTT
NheI
Gm-1
TTATCCCGGGTCAAACATGAGAATTA
SmaI
Gm-2
GGACCGATCGAATAGGAACTTCATTG
PvuI
fadB2xAx-1
GCCTCTAGACCGATATGCAAATCACT
XbaI
fadB2xAx-2 fadBA-H11
TACAAGCTTCACCTCAGTACAGGCACT ATAAAGCTTGAACGAAGCCTCCAAGCTG
HindIII HindIII
fadBA-H1-2
ATACCCGGGCAGTCGTTGACCAC
SmaI
fadBA-H2-1
ATACGATCGTCATGTCCGGCCAGCG
PvuI
fadBA-H2-2
ATAGCTAGCGTGCCGCCATTCTGCTT
NheI
0664-H1-1
ATAAAGCTTACGGATCAATTTGTTTCAGGAGG
HindIII
0664-H1-2
ATACCCGGGCCTGCAGCAGGATCTGG
SmaI
0664-H21
ATACGATCGCAGTGGCCTGGGC
PvuI
0664-H22 463536-H1-1
ATAGCTAGCTTGGCCATGCTGGCCAG ATAAAGCTTAGTTGCCCCTCGCCA
NheI HindIII
463536-H1-2
ATACCCGGGCATCACATAGGGCGCC
SmaI
463536-H2-1
ATACGATCGGTATTCAGGTAGCCGAGGTTC
PvuI
463536-H2-2
ATAGCTAGCGGTGGCCGACGGC
NheI
2543-H1-1
ATAAAGCTTCAAGGACAGAAGAAAATCACC
HindIII
2543-H1-2
ATACCCGGGTGACCTCGACC
SmaI
2543-H2-1
ATACGATCGCCGAACTGCTGATCTACG
PvuI
2543-H2-2
ATAGCTAGCCTGGTAATCGGCCACCT
NheI
a
H1: homologous fraction upstream of the target gene; H2: homologous fraction downstream of the target gene. Restriction sites were underlined in the DNA sequences.
oxygen (DO) was provided by injecting filtered air at a flow rate of 0.5 L per liter of culture broth per minute and was maintained at 30% of air saturation by automatically adjusting the agitation rate from 200 to 800 rpm. The pH was controlled automatically by the addition of an aqueous solution of 5 M NaOH and 3 M H2SO4. The initial culture medium in fermentor vessel contained (g L1): yeast extract 5, tryptone 10, NaCl 10, and glucose 25. A total of 15 g of dodecanoic acid was added at 12 h, and 15 g of dodecanoic acid, 3 g of yeast extract, and 6 g of tryptone were added to the fermentor when dodecanoic acid was exhausted. PHA Analysis, Extraction, and Purification. Both lyophilized cells and the extracted PHA were analyzed by gas chromatography (GC) the same as previously described.9 GC analysis was performed using a Hewlett-Packard 6890 equipped with a 30 m HP-5 capillary column. Bacteria were harvested by centrifugation at 8000g for 15 min, washed with ethanol and distilled water, and then lyophilized. A total of 100 mL of chloroform was added to 10 g of dry cells and then treated at 100 °C for 4 h. Subsequently, supernatant was obtained by centrifugation at 8000g for 10 min; then, PHA was precipitated with 10-fold volume quantity of ethanol. The precipitated PHA was washed by ethanol, followed by vacuum drying. The PHA was dissolved with chloroform for film casting, and all solvents were evaporated for at least 2 days.10,19,33
PHA Characterization using Nuclear Magnetic Resonance (NMR). 1H NMR spectra were measured by a JEOL JNM-ECA 300 NMR spectrometer with chloroform-d as solvent. Tetramethylsilane was used as the internal standard. The 13C NMR spectra were performed with a JEOL JNM-ECA 600 NMR spectrometer. Characterization of Physical Properties of PHA. Molecular weights were measured by using gel permeation chromatography (GPC) equipped with a refractive index (RI) detector (Wyatt Optilab
rEX). The measurements were carried out at 35 °C using a PLgel 5 μm mixed-D column, which was calibrated with polystyrene standards. THF was used as the eluent, and the flow rate was 1.0 mL min1. The glasstransition temperature (Tg) was detected by a Shimadzu DSC-60 differential scanning calorimeter (DSC) under a nitrogen atmosphere. Each sample weighting 2 to 3 mg was encapsulated in an aluminum pan and was heated from 30 to 120 °C as the first scan. After being maintained at 120 °C for 1 min, the molten sample was quenched to 100 °C. Subsequently, the sample was again heated from 100 to +120 °C as the second scan. A heating rate of 10 °C min1 was used throughout the process. Melting temperature (Tm) and apparent heat of fusion (ΔHm) were determined from the DSC endothermal peak value and areas of the first and the second scans. The midpoint of transition temperature range was determined as the glass-transition temperature (Tg). Tensile mechanical analysis was conducted on the PHA solvent casting films. The films were cut into dumb-bell-shaped specimens with a width of 4 mm and a thickness of ∼100 μm. The stressstrain measurements of films were carried out using a CMT-4000 universal testing machine (Shenzhen SANS, Shenzhen, China) at room temperature. The speed of the cross-head was 5 mm min1.
’ RESULTS AND DISCUSSIONS Production of PHA in P. entomophila L48. As most of the central metabolic pathways found in other Pseudomonas are encoded in P. entomophila genome, the strain should be able to use fatty acids for accumulating MCL PHA, which was confirmed using LB-fatty acid medium (Table 3). PHA synthase encoding genes of P. entomophila L48 were located in the phaC1-phaZ-phaC2 operon.9,34 3561
dx.doi.org/10.1021/bm200770m |Biomacromolecules 2011, 12, 3559–3566
Biomacromolecules
ARTICLE
Table 3. PHA Production by P. entomophila L48, LAC01, LAC03, LAC20, LAC23, LAC25, and LAC26 Using 12 g L1 Dodecanoic Acid As Related Carbon Sourcesa PHA monomer compositions (mol %) strains
1
CDW (g L )
PHA contents (wt %)
3HHx
3HO
3HD
3HDD
50.43 ( 2.4
6.4 ( 0.5
44.5 ( 0.5
38.6 ( 0.7
10.6 ( 0.3
4.3 ( 0.1
40.0 ( 1.0 1.6 ( 0.1
41.4 ( 0.7 41.6 ( 0.6
14.3 ( 0.5 56.8 ( 0.6
L48
7.8 ( 0.1
LAC01
3.0 ( 0.2
LAC03 LAC20
9.9 ( 0.03 2.2 ( 0.1
0 51.89 ( 4.6 70.21 ( 5.0
LAC23
2.6 ( 0.2
93.77 ( 2.5
1.5 ( 0.1
98.5 ( 0.1
LAC25
2.8 ( 0.1
85.13 ( 6.8
1.8 ( 0.5
98.3 ( 0.5
LAC26
2.7 ( 0.0
90.93 ( 1.9
1.2 ( 0.6
98.8 ( 0.6
Bacteria were cultured in one-step LB medium supplemented with 12 g L1 dodecanoic acid as described in the Material and Methods section at 30 °C for 48 h. All data were expressed as average value ( SD and represented the average value of three parallel experiments. CDW: cell dry weight; 3HHx: 3-hydroxyhexanoate; 3HO: 3-hydroxyoctanoate; 3HD: 3-hydroxydecanoate; 3HDD: 3-hydroxydodecanoate.
a
Figure 1. β-Oxidation cycle provides precursors toward PHA synthesis. S-3-Hydroxyacyl-CoA dehydrogenase: encoded by two genes, fadB and fadB2x; 3-ketothiolase: encoded by fadA; acetyl-CoA acetyltransferase: encoded by six genes in P. entomophila, including fadAx, PSEEN 0664, PSEEN 2543, PSEEN 2795, PSEEN 3197, PSEEN 4635, only four of them were focused in our study; Enoyl-CoA hydratase: PhaJ; PHA synthase: PhaC. Gray bar indicates the deletion of genes on this pathway.
To disable activity of PHA synthase, we constructed a pha-operon knockout mutant as described in the Materials and Methods and named it P. entomophila LAC01. No PHA production was detected by P. entomophila LAC01 with dodecanoic acid as a related carbon source, whereas the wild type accumulated >50 wt % PHA (Table 3). The resulting MCL PHA was a mixture of 3HHx, 3HO, 3HD, and 3HDD, consistent with our assumption. Construction of β-Oxidation Inhibited Mutants of P. entomophila L48 and Their PHA Production. During each β-oxidation cycle, the fatty acid was shortened by a two-carbon
atom fragment removed as acetyl-CoA (Figure 1).20 The weakened β-oxidation pathway should lead to an increased composition of longer chain length monomer in the resulted MCL PHA. Importantly, because carbon flux can be directed more into PHA synthesis, more accumulation of MCL PHA should be expected. Previous studies demonstrated increased 3HDD monomer fraction in PHA synthesized by P. putida grown on relevant carbon source after deleting fadB fadA and fadB2x fadAx genes encoding 3-ketoacyl-CoA thiolase and 3-hydroxyacyl-CoA dehydrogenase.19,25,26 Putative key proteins that have crucial 3562
dx.doi.org/10.1021/bm200770m |Biomacromolecules 2011, 12, 3559–3566
Biomacromolecules
ARTICLE
Figure 2. NMR spectra of homopolymer poly(3-hydroxydodecanoate) (P(3HDD)). (A) 1H NMR and (B) 13C NMR. The monomer peak assignment on NMR was made by the chemical shift based on previous work.35
functions in the β-oxidation pathway of P. entomophila are 3-hydroxyacyl-CoA dehydrogenase and 3-ketoacyl-CoA thiolase, which are encoded by fadB fadB2x and fadA, respectively, similar to those found in P. putida, whereas gene fadAx was found to encode acetyl-CoA acetyltransferase according to the data available from NCBI. In this study, we mainly focused on genes encoding acetyl-CoA acetyltransferase as the target for investigating the relationship between β-oxidation and PHA synthesis in P. entomophila. The locus tags of these genes are recorded as PSEEN 0664, PSEEN 2543, and PSEEN 4635 in the NCBI database (Figure 1).
Deletion of genes involved in the P. entomophila β-oxidation pathway was carried out using a similar method we previously established for P. putida KT2442.9 The knockout of fadB2x and fadAx in P. entomophila L48 using suicide plasmid pALS03 led to the mutant termed P. entomophila LAC03. Over 40 and 70% sequences of fadB2x and fadA were deleted, respectively, in the LAC03 mutant. However, successful ratios of deleting essential genes for cell growth were much lower, resulting in tedious process of isolating essential genes deleted mutants. Inserting antibiotic selection markers between two homologous fragments of target gene could help shorten the screening process significantly.32 3563
dx.doi.org/10.1021/bm200770m |Biomacromolecules 2011, 12, 3559–3566
Biomacromolecules The knockout mutants of fadB and fadA with about 45 and 65% sequence deleted were constructed as described in the Materials and Methods, forming P. entomophila LAC20. Deletion of >20% of PSEEN 0664 in P. entomophila LAC20 resulted in P. entomophila LAC23. Similarly, 70 and 20% sequences of PSEEN 4635 and PSEEN 4636 were deleted based on LAC23 in mutant LAC25. P. entomophila LAC26 was a mutant in which PSEEN 2543 lost its function via deleting approximately half of the sequence in LAC23. P. entomophila L48, LAC03 and β-oxidation inhibited mutants were cultured in LB media using 12 g L1 dodecanoic acid as a related carbon source. The yield of PHA in P. entomophila LAC03 was almost the same as that of the wild type (Table 3), indicating that fadB2x and fadAx did not play a predominant part in the β-oxidation pathway.19 P. entomophila LAC20 is a fadB fadA genes knockout mutant of P. entomophila L48. It was clearly observed that the mutant was able to synthesize more longer-chain-length monomers in PHA compared with wild-type P. entomophila L48. Strain LAC20 produced >70 wt % PHA composed of 3HO, 3HD, and 3HDD monomers when dodecanoic acid was provided. Interestingly, no 3HHx fraction was detected (Table 3). The results demonstrated that fadB and fadA genes played an important role in the β-oxidation pathway of P. entomophila L48. It could be concluded that β-oxidation was significantly weakened by deleting theses genes. In comparison, PHA produced by KTOY06, a fadB fadA knockout mutant of P. putida KT2442, was reported as copolymers consisted of C6 to C12 monomers.19 P. entomophila LAC23 is a mutant of P. entomophila LAC20 with gene PSEEN 0664 deleted. The strain showed better growth on dodecanoic acid of which CDW was 2.6 g L1. Surprisingly, we observed that the PHA yield increased to 93.8 wt % from 70 wt % by strain LAC20. Furthermore, the PHA synthesized by strain LAC23 contained only two monomers, of which 3HDD content was 98.5 mol %, much higher compared with only 56.8 mol % in PHA produced by LAC20 (Table 2). These results suggested that the role of genes encoding acetylCoA acetyltransferase becomes more important when fadB fadA, one of the two sets of genes19 involved in β-oxidation, was deleted. Deletion of acetyletranferase encoding genes could result in an increasing amount of acetyl-CoA, leading to weakened β-oxidation,26 resulting in more carbon flux being directed into PHA synthesis, as reported by Ren et al.15 Therefore, production of PHA consisting of higher 3HDD composition was increased. Two more mutants, LAC25 and LAC26, were constructed based on strain P. entomophila LAC23. PSEEN 4635 PSEEN 4636 and PSEEN 2543 were deleted, respectively. Similar to strain LAC23, LAC25 and LAC26 were found to produce polymers absolutely dominated by 3HDD. LAC25 showed better growth compared with LAC23 and LAC26, although monomer composition of the PHA accumulated showed no significant change. Strain LAC26 produced a near homopolymer of P(1.2 mol % 3HD-co-98.8 mol % 3HDD) on dodecanoic acid provided as a related carbon source (Table 3). The NMR analysis of the polymer exhibited peaks for 3HDD in the polymer (Figure 2). For the very first time, a novel type of MCL PHA with 99 mol % 3HDD content was obtained. Production of MCL PHA in a 6 L Fermentor. Production of MCL PHA by P. entomophila LAC25 was conducted in a 6 L fermentor containing 3 L of medium. Dynamic cell growth and PHA accumulation during the cultivation process were investigated. In the first 12 h, yeast extract, tryptone, and glucose served
ARTICLE
Figure 3. Cell growth and PHA production by Pseudomonas entomophila LAC25 grown in a 6 L fermentor. LB medium supplemented with glucose was used for the first stage of cell growth; then, dodecanoic acid, yeast, and tryptone were added for the second-stage culture, as indicated by the arrow.
as nutrition to support cell growth. PHA was produced after dodecanoic acid was added at 12 h. The mutant entered the logarithmic phase after 4 h, reaching 12 g L1 CDW at 32 h (Figure 3). MCL PHA accumulation increased steadily from 0.4 g L1 at 16 h to 7.3 g L1 at 36 h, which was nearly three times that in shake flask culture at 48 h; the 3HDD fraction in PHA was >97 mol % (Figure 3). At the end of the culture at 36 h, 10.5 g L1 CDW containing 70 wt % PHA was obtained. The composition of PHA accumulated was very similar to the results from shake-flask culture (Table 3). Physical Properties of MCL PHA with Different Monomer Compositions. MCL PHAs with different 3HDD fractions were prepared using P. entomophila LAC25 or LAC26 as the producer. Number-average molecular weights (Mn) and polydispersity (Mw/Mn) of PHA accumulated in P. entomophila L48 mutants were smaller than those accumulated by P. putida KT244219 (Table 4). Thermal properties of PHA with different 3HDD were determined (Table 4). Increasing the long-chain monomer fraction favored side-chain crystallization, which leads to improved MCL PHA properties.19,25,26 That is, MCL PHA with high contents of long-chain monomer should be very different from typical MCL PHA. Apparent heat of fusion was significantly higher than any other MCL PHAs produced by wild type and mutants of P. putida,19,25,26 reaching 48.3 J g1 when 3HDD fraction was nearly 98 mol %. In addition, melting temperatures increased with increasing longer-chain-length monomer components, indicating that Tm and crystallinity were changed depending on monomer composition. Tm of P(2.1 mol % 3HD-co-97.9 mol % 3HDD) was 82.4 °C compared with 53 °C of P(85 mol % 3HDco-15 mol % 3HDD) produced by P. putida KT2442.19 What’s more, there were two Tm in the high content 3HDD MCL PHA (Supporting Information, Figure S2), indicating the existence of side-chain crystallization of 3HDD. This was very different from typical MCL PHAs, which are mostly amorphous without crystallization. Glass-transition temperatures were not affected significantly with increasing 3HDD monomer content; they were between 44 °C and 49 °C. When the 3HDD fraction reached 97.9 mol %, MCL PHA had the lowest Tg of 49.3 °C. Tm, ΔHm, 3564
dx.doi.org/10.1021/bm200770m |Biomacromolecules 2011, 12, 3559–3566
Biomacromolecules
ARTICLE
Table 4. Physical Properties of MCL PHA Consisting of Various 3HDD Fractions molecular weightsb
thermal propertiesc
mechanical propertiesd
3HDD fraction strain (carbon source)
Mn, 104Da
Tm, °C ΔHm, J g1 Tg, °C
Mw/Mn
E, MPa
σy,
σmt,
MPa
MPa
εb, %
KT2442 (C12)
15
8.0
1.3
53
18
44
3.6
189
KTOY06 (C12)e
28
9.5
1.4
58
22
45
6.0
180
KTOY06 (C12)e
39
10.8
1.5
65
28
43
11.5
KT2047A(C12)f
56.3
12.5
1.5
74.9
40.4
43.0 2.0
188
KTQQ20 (C12)g
84.3
11.9
1.3
77.6
40.9
32.5 103.1
88
41.9
43.0 39.9 ( 8.7 41 ( 0.5 6.9 ( 0.3 136 ( 22
45.7
42.0 53.7 ( 12.9 5.3 ( 0.2 8.2 ( 1.3 82 ( 7
48.3
49.3 61.1 ( 6.4 5.5 ( 0.8 5.5 ( 0.9 60 ( 34
e
a
(mol %)a
LAC26 (C12)h
93.5
3.9
2.1
LAC26 (C12)h
95.8
4.4
1.8
LAC25 (C12)h
97.9
5.2
2.0
49.2 79.6 50.7 79.9 53.6 82.4
125
b
Monomer composition was determined based on GC analysis. Mn, number-average molecular weight; Mw/Mn, polydispersity. c Tm, melting temperature; ΔHm, apparent heat of fusion; Tg, glass-transition temperature. d E, Young’s modulus; σy, yield strength; σmt, maximum tension strength; εb, elongation at break. e Data cited from Ouyang et al. f Data cited from Ma et al. g Data cited from Liu et al. h Grown on LB containing dodecanoic acid for 40 h at 30 °C.
and Tg of P(3HD) were 72.2 °C, 11 J g1, and 37.2 °C, respectively, as reported by Liu et al.;26 all of these thermal properties were significantly enhanced in the P(3HDD). These results agreed with what was reported by Noda et al.,12 Gross et al.,36 and Preusting et al.,37 which stated that higher endotherm suggests a higher degree of sample crystallinity.38 The novel MCL PHA, P(2.1 mol % 3HD-co-97.9 mol % 3HDD), accumulated by β-oxidation-inhibited mutant of P. entomophila represented the widest range between Tm and Tg among the MCL PHAs reported so far, revealing a new phenomenon in PHA research. Young’s modulus (E), yield strength (σy), maximum tension strength (σmt), and elongation at break (εb) were compared (Table 4). The Young’s modulus (E) of the samples increased significantly from 39.9 to 61.1 MPa along with increasing contents of 3HDD. Meanwhile, increases in yield strength (σy) were observed with increasing 3HDD. Elongation at break (εb) decreased from 136 to 60% when 3HDD fraction increased. Maximum tension strength (σmt) reached a high value of 8.2 MPa for 95.8 mol % 3HDD containing MCL PHA.
’ CONCLUSIONS This study proposed a new MCL PHA producer Pseudomonas entomophila, by which production of PHA with dominant fraction of 3HDD was achieved. Knockout of putative β-oxidation related genes in P. entomophila L48 resulted in the formation of novel near homopolymer P(3HDD). When dodecanoic acid was used as a related carbon source, the 3HDD fraction in PHA produced by P. entomophila LAC26 was 99 mol %. Higher CDW and PHA contents of the mutants compared with those of similar mutants of P. putida19,25,26 showed the possibility of P. entomophila to be used as a producer of long chain monomer containing MCL PHA. This was the first report on a near homopolymer P(3HDD) produced. The melting temperature of poly(2.1 mol % 3HD-co-97.9 mol % 3HDD) was 82.4 °C, which was the highest Tm, and with glasstransition temperature of 49.3 °C, the new type of PHA behaved within the widest temperature range between Tm and Tg in all MCL PHA reported so far. Moreover, the P(3HDD) was
found with high crystallization degree and yield strength, indicating many potential applications.
’ ASSOCIATED CONTENT
bS Supporting Information. Transmission electron microscopy of the P. entomophila mutant and DSC thermogram of P(2.1 mol % 3HD-co-97.9 mol % 3HDD) copolymer. This material is available free of charge via the Internet at http://pubs.acs.org. ’ AUTHOR INFORMATION Corresponding Author
*Tel: +86-10-62783844. Fax: +86-10-62794217. E-mail: chengq@ mail.tsinghua.edu.cn.
’ ACKNOWLEDGMENT We are very grateful for the kind donation of plasmid pK18mobsacB from Dr. Andreas Sch€afer of the University of Bielefeld (Bielefeld, Germany). Pseudomonas entomophila L48 was a gift from Professor Frederic Boccard (Centre de Genetique Moleculaire, Centre National de la Recherche Scientifique, France). This research was financially supported by National High Tech 863 Grants (Project No. 2010AA101607) and 973 Basic Research Fund (grant no. 2007CB707807), as well as the Tsinghua University Initiative Scientific Research Program 2009THZ01005. ’ REFERENCES (1) Anderson, A. J.; Dawes, E. A. Micobiol. Rev 1990, 54, 450–472. (2) Solaiman, D. K.; Ashby, R. D.; Foglia, T. A. Curr. Microbiol. 2002, 44, 189–195. (3) Hazer, B.; Steinb€uchel, A. Appl. Microbiol. Biotechnol. 2007, 74, 1–12. (4) Chen, G. Q.; Wu, Q. Biomaterials 2005, 26, 6565–6578. (5) Park, S. J.; Choi, J. I.; Lee, S. Y. J. Microbiol. Biotechnol. 2005, 15, 206–215. (6) Keshavarz, T.; Roy, I. Curr. Opinion Microbiol 2010, 13, 321–326. (7) Chen, G. Q. Chem. Soc. Rev. 2009, 38, 2434–2446. 3565
dx.doi.org/10.1021/bm200770m |Biomacromolecules 2011, 12, 3559–3566
Biomacromolecules
ARTICLE
(8) Koller, M.; Bona, R.; Chiellini, E.; Fernandes, E. G.; Horvat, P.; Kutschera, C.; Hesse, P.; Braunegg, G. Bioresour. Technol. 2008, 99, 4854–4863. (9) Ouyang, S. P.; Liu, Q.; Fang, L.; Chen, G. Q. Macromol. Biosci. 2007, 7, 227–233. (10) Wang, H. H.; Li, X. T.; Chen, G. Q. Process Biochem. 2009, 44, 106–111. (11) Chen, G. Q.; Zhang, G.; Park, S. J.; Lee, S. Y. Appl. Microbiol. Biotechnol. 2001, 57, 50–55. (12) Noda, I.; Green, P. R.; Satkowski, M. M.; Schechtman, L. A. Biomacromolecules 2005, 6, 580–586. (13) Park, S. J.; Lee, S. Y. Appl. Biochem. Biotechnol. 2004, 113, 335–346. (14) Steinb€uchel, A.; Valentin, H. E. FEMS Microbiol. Lett. 1995, 128, 219–228. (15) Ren, Q.; de Roo, G.; Ruth, K.; Witholt, B.; Zinn, M.; Th€ony-Meyer, L. Biomacromolecules 2009, 10, 916–922. (16) Kroumova, A. B.; Wagner, G. J.; Davies, H. M. Arch. Biochem. Biophys. 2002, 405, 95–103. (17) Sanchez, R. J.; Schripsema, J.; da Silva, L. F.; Taciro, M. K.; Pradella, J. G. C.; Gomez, J. G. C. Eur. Polym. J. 2003, 39, 1385–1394. (18) Fiedler, S.; Steinb€uchel, A.; Rehm, B. Arch. Microbiol. 2002, 178, 149–160. (19) Ouyang, S. P.; Luo, R. C.; Chen, S. S.; Liu, Q.; Chung, A.; Wu, Q.; Chen, G. Q. Biomacromolecules 2007, 8, 2504–2511. (20) Sudesh, K.; Abe, H.; Doi, Y. Prog. Polym. Sci. 2000, 25, 1503–1555. (21) Sun, Z.; Ramsay, J. A.; Guay, M.; Ramsay, B. A. Appl. Microbiol. Biotechnol. 2007, 74, 69–77. (22) Olivera, E. R.; Carnicero, D.; Jodra, R.; Minambres, B.; Garcia, B.; Abraham, G. A.; Gallardo, A.; San Roman, J.; Garcia, J. L.; Naharro, G.; Luengo, J. M. Environ. Microbiol. 2001, 3, 612–618. (23) Snell, K. D.; Feng, F.; Zhong, L. H.; Martin, D.; Madison, L. L. J. Bacteriol. 2002, 184, 5696–5705. (24) Park, S. J.; Lee, S. Y. Biotechnol. Bioeng. 2004, 86, 681–686. (25) Ma, L.; Zhang, H. F.; Liu, Q.; Chen, J.; Zhang, J; Chen, G. Q. Bioresour. Technol. 2009, 100, 4891–4894. (26) Liu, Q.; Luo, G.; Zhou, X. R.; Chen, G. Q. Metab. Eng. 2011, 13, 11–17. (27) Kessler, B.; Witholt, B. Macromol. Symp. 1998, 130, 245–260. (28) Vodovar, N.; Vallenet, D.; Cruveiller, S.; Rouy, Z.; Barbe, V.; Acosta, C.; Cattolico, L.; Jubin, C.; Lajus, A.; Segurens, B.; Vacherie, B.; Wincker, P.; Weissenbach, J.; Lemaitre, B.; Medigue, C.; Boccard, F. Nat. Biotechnol. 2006, 24, 673–679. (29) Sun, Z. Y.; Ramsay, J. A.; Guay, M.; Ramsay, B. A. Appl. Microbiol. Biotechnol. 2006, 71, 423–431. (30) Velazquez, F.; Pfluger, K.; Cases, I.; De Eugenio, L. I.; De Lorenze, V. J. Bacteriol. 2007, 189, 4529–4533. (31) Sch€afer, A.; Tauch, A.; J€ager, W.; Kalinowski, J.; Thierbach, G.; P€uhler, A. Gene 1994, 145, 69–73. (32) Choi, K. H.; Schweizer, H. P. BMC Microbiol. 2005, 5, 30. (33) Liu, W. K.; Chen, G. Q. Appl. Microbiol. Biotechnol. 2007, 76, 1153–1159. (34) Chung, A. L.; Liu, Q.; Ouyang, S. P.; Wu, Q.; Chen, G. Q. Appl. Microbiol. Biotechnol. 2009, 83, 513–519. (35) Matsusaki, H.; Abe, H; Doi, Y. Biomacromolecules 2000, 1, 17–22. (36) Gross, R. A.; DeMello, C.; Lenz, R. W.; Brandl, H.; Fuller, R. C. Macromolecules 1989, 22, 1106–1115. (37) Preusting, H.; Nijenhuis, A.; Witholt, B. Macromolecules 1990, 23, 4220–4224. (38) Witholt, B.; Kessler, B. Curr. Opin. Biotechnol. 1999, 10, 279–285.
3566
dx.doi.org/10.1021/bm200770m |Biomacromolecules 2011, 12, 3559–3566
