Subscriber access provided by READING UNIV
Article
Biosynthesis of the Klebsiella oxytoca pathogenicity factor tilivallin: Heterologous expression, in vitro biosynthesis and inhibitor development Alexander von Tesmar, Michael Hoffmann, Antoine Abou Fayad, Stephan Hüttel, Viktoria Schmitt, Jennifer Herrmann, and Rolf Müller ACS Chem. Biol., Just Accepted Manuscript • DOI: 10.1021/acschembio.7b00990 • Publication Date (Web): 01 Feb 2018 Downloaded from http://pubs.acs.org on February 2, 2018
Just Accepted “Just Accepted” manuscripts have been peer-reviewed and accepted for publication. They are posted online prior to technical editing, formatting for publication and author proofing. The American Chemical Society provides “Just Accepted” as a free service to the research community to expedite the dissemination of scientific material as soon as possible after acceptance. “Just Accepted” manuscripts appear in full in PDF format accompanied by an HTML abstract. “Just Accepted” manuscripts have been fully peer reviewed, but should not be considered the official version of record. They are accessible to all readers and citable by the Digital Object Identifier (DOI®). “Just Accepted” is an optional service offered to authors. Therefore, the “Just Accepted” Web site may not include all articles that will be published in the journal. After a manuscript is technically edited and formatted, it will be removed from the “Just Accepted” Web site and published as an ASAP article. Note that technical editing may introduce minor changes to the manuscript text and/or graphics which could affect content, and all legal disclaimers and ethical guidelines that apply to the journal pertain. ACS cannot be held responsible for errors or consequences arising from the use of information contained in these “Just Accepted” manuscripts.
ACS Chemical Biology is published by the American Chemical Society. 1155 Sixteenth Street N.W., Washington, DC 20036 Published by American Chemical Society. Copyright © American Chemical Society. However, no copyright claim is made to original U.S. Government works, or works produced by employees of any Commonwealth realm Crown government in the course of their duties.
Page 1 of 29 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60
1
ACS Chemical Biology
Title
2
Biosynthesis of the Klebsiella oxytoca pathogenicity factor tilivallin:
3
Heterologous expression, in vitro biosynthesis and inhibitor development
4
5
Authors
6 7
Alexander von Tesmar1 , Michael Hoffmann1, Antoine Abou Fayad1, Stephan Hüttel2, Viktoria Schmitt1, Jennifer Herrmann1, Rolf Müller1
8
Contact Information
9
[email protected] 10
1
Department of Microbial Natural Products (MINS), Helmholtz Institute for Pharmaceutical Research Saarland (HIPS) - Helmholtz Centre for Infection Research (HZI) and Department of Pharmacy, Saarland University, 66123 Saarbrücken, Germany 2 Department of Microbial Drugs, Helmholtz Centre for Infection Research and German Centre for Infection Research (DZIF), partner site Hannover/Braunschweig, Inhoffenstrasse 7, 38124 Braunschweig, Germany
1 ACS Paragon Plus Environment
ACS Chemical Biology 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60
Page 2 of 29
11
Abstract
12
Tilvalline is a pyrrolo[4,2]benzodiazepine derivative produced by the pathobiont Klebsiella oxy-
13
toca and is the causative toxin in antibiotic associated hemorrhagic colitis (AAHC). Heterologous
14
expression of the tilivalline biosynthetic gene cluster along with in vitro reconstitution of the
15
respective NRPS (NpsA, ThdA, NpsB) was employed to reveal a non-enzymatic indole
16
incorporation via a spontaneous Friedel-Crafts-like alkylation reaction. Furthermore, the
17
heterologous system was used to generate novel tilivalline derivatives by supplementation of
18
respective anthranilate and indole precursors. Finally, it could be shown that salicylic and
19
acetylsalicylic acid inhibit the biosynthesis of tilivalline in K. oxytoca liquid culture, presumably
20
by blocking the peptidyl carrier protein ThdA, pointing towards a potential application in
21
combination therapy to prevent or alleviate symptoms of AAHC.
22 23 24 25 26
27
Keywords
28
Virulence factor, Antibiotic-associated colitis, TAR-assembly, heterologous expression,
29
precursor-directed mutasynthesis, in vitro reconstitution of NRPS, anti-virulence
30
2 ACS Paragon Plus Environment
Page 3 of 29 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60
ACS Chemical Biology
31
Introduction
32
Tilivalline, a pyrrolo[4,2]benzodiazepine (PBD) derivative, is produced by Klebsiella oxytoca1
33
and has been identified as the causative pathogenicity factor in antibiotic associated hemorrhagic
34
colitis (AAHC).2
35
PBDs are a common class of natural products produced by Streptomyces species and occur with
36
various substitution patterns. Compounds such as anthramycin, sibiromycin or tomaymycin can
37
bind covalently to the minor grove of double stranded DNA and hence, exhibit a potent
38
antineoplastic activity. In the past, a considerable effort to produce novel synthetic PBD
39
derivatives has been expended, resulting in PBD conjugates such as DSB-120 and SJG-136,
40
dimeric compounds with strong antitumor activity.3
41
Tilivalline likewise shows activity against mouse leukemia L1210 cells 4 and has been identified
42
to be causative agent for the cytotoxic effects of K. oxytoca extracts which have been initially
43
described in 1989.5,6 Recently, the presence of tilivalline has been reported to be fundamental
44
regarding the course of AAHC caused by K.oxytoca.2,7 AAHC is triggered by antibiotic treatment
45
due to overgrowth of inherently β-lactamase resistant K. oxytoca in the colon; such a dysbiotic
46
population causes bloody diarrhea and abdominal cramps 8–10
47
The biosynthetic gene cluster of tilivalline reported by Schneditz et al. contains a bi-modular non-
48
ribosomal peptide synthetase (NRPS) that is thought to synthesize the PBD core from an
49
anthranilate and a pyrrolo precursor. This assumption is based on the finding that the tilivalline
50
cluster has the same module organization as the sibiromycin and tomaymycin gene clusters.11,12
51
Furthermore, during the course of the preparation of this manuscript two papers appeared which
52
examined tilivalline biosynthesis by metabolite profiling, genetic deletion experiments and
53
complementation experiments in K. oxytoca as well as heterologous expression of the gene
54
cluster in E. coli, likewise presenting data supporting this hypothesis.13,14 Additionally, the 3 ACS Paragon Plus Environment
ACS Chemical Biology 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60
Page 4 of 29
55
tilivalline gene cluster was also identified in Xenorhabdus species, bacteria that undergo
56
symbiosis with nematodes.15 We have recently reported the in vitro total biosynthesis of
57
tomaymycin and characterized each biochemical step involved biochemically.16 NRPSs are
58
multimodular megasynthetases that produce a diverse group of natural products by catalyzing
59
peptide bonds between monomeric building blocks. Owing to the independence from the
60
ribosome, NRPS building blocks are not limited to the proteinogenic amino acids. Hence,
61
unusual blocks with diverse modifications are often incorporated. The minimal module for the
62
chain elongation process consists of three domains: The adenylation domain (A) activates the
63
substrate that subsequently is covalently tethered to the terminal thiol 4’phosphopanthein
64
prosthetic group (PPant) on the thiolation domain (T). The condensation domain (C) catalyzes the
65
peptide bond between two adjacent T domain tethered substrates. The last module usually
66
contains a thioesterase (TE) or reductase (R) domain that releases the substrate chain from the
67
enzyme.17–19 In addition, optional domains included in distinct modules can facilitate a variety of
68
modifications such as epimerization, hydroxylation or methylation and thus increase the diversity
69
of structural elements in natural products.20
70
Here we present experimental evidence of the tilivalline biosynthesis using heterologous
71
expression of the gene cluster in Escherichia coli and the in vitro reconstitution of the underlying
72
NRPS NpsA, ThdA, and NpsB. Our data show a non-enzymatic incorporation of the tilivalline
73
indole moiety by a Friedel-Crafts-like alkylation. Furthermore, the E. coli heterologous system
74
was used to generate novel tilivalline derivatives in a convenient 96-well plate assay. In addition,
75
we identified competitive inhibitors to block the tilivalline NRPS in the natural producer K.
76
oxytoca and thus prevented toxin production in liquid culture. This finding is especially
77
intriguing as tilivalline biosynthesis inhibition could serve as a valuable pathoblocker strategy in
78
colitis treatment. 4 ACS Paragon Plus Environment
Page 5 of 29 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60
ACS Chemical Biology
79 80
Results and Discussion
81
Clinical isolates of K. oxytoca produce tilivalline
82
K. oxytoca (ID 1976911) was isolated from skin smear from a patient suffering from
83
superinfection. The presence of the tilivalline biosynthetic gene cluster was confirmed by colony
84
PCR using primers for NpsA. An initial small-scale culture of the respective isolate in liquid
85
medium was extracted with ethyl acetate and fractionated into 96 well plates while a split flow
86
was used to acquire LC-MS data. Eventually, the fractions were screened towards cytotoxicity
87
against KB-3.1 human cervix carcinoma cells. The combined screening effort revealed one active
88
fraction containing primarily a compound with 334.1550 m/z. Comparison with an authentic
89
standard obtained by total synthesis revealed the detected compound as tilivalline, which was
90
finally confirmed by purification using preparative HPLC and subsequent NMR analysis (Figure
91
1).
92
To gain further insights into the genome of K. oxytoca (ID 1976911) the Illumina sequencing
93
technology was used for sequencing and the gene data were analyzed towards similarity to the
94
already reported tilivalline biosynthetic gene cluster. The tilivalline biosynthetic gene cluster was
95
identified using Antismash 2.021 displaying an identical locus organization as the one reported by
96
Schneditz et al. The DNA sequence identity of the two clusters spanning 16.264 bp is striking
97
99.4%. The lowest observed identity on protein level is 96.7% for UvrX (Table S1).
98
The three genes npsA, thdA and npsB encode a two-modular NRPS including a reductive release
99
domain. They share identical domain organization with the already described PBD producing
100
synthetase of tomaymycin from Streptomyces.11 Similar to the tomaymycin cluster, copies of
101
shikimate pathway genes and other housekeeping enzymes are present to provide the anthranilic
102
acid precursor for the biosynthesis of the core structure. The homologue of the 4-nitrophenol-25 ACS Paragon Plus Environment
ACS Chemical Biology 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60
Page 6 of 29
103
monoxygenase NphA1, HmoX, is putatively responsible for the hydroxylation at position 3 of the
104
anthranilic acid. Other NphA1 homologues can be found in the biosynthetic gene clusters of
105
tomaymycin or sibiromycin, which both harbor a hydroxylated anthranilic acid moiety.22 The
106
comparison with the tomaymycin biosynthesis further indicated a release of the formed dipeptide
107
as an aldehyde followed by an immediate circularization to an imine, which reacts spontaneously
108
to the respective carbinolamine by hydratation. The nature of the indole incorporation remained
109
elusive as no candidate genes for the indole incorporation could be identified in the tilivalline
110
biosynthetic gene cluster (Figure 1).
111 112 113
Heterologous expression of the tilivalline biosynthetic gene cluster reveals non-enzymatic indole incorporation
114
To generate a heterologous expression construct a transformation-associated recombination
115
(TAR) based assembly of PCR amplified DNA fragments was employed (see methods section for
116
details). The two operons containing the NRPS, the tailoring, and the precursor biosynthetic
117
genes were PCR amplified from the K. oxytoca (ID 1976911) genomic DNA. The promoter
118
cassette sequences for Ptet and PBAD as well as the vector backbone were PCR amplified while
119
suitable homologous regions at the 5’-end of the primers were introduced.23 The resulting five
120
fragments were assembled by TAR in Saccharomyces cerevisiae to the plasmid pCly-Til.
121
Plasmids exhibiting the correct restriction pattern were verified by employing Illumina
122
sequencing technology (Figure 2).
123
Upon induction of E. coli BL21 (DE3) pCLY-Til-24 in M9 minimal medium containing
124
tetracycline and L-arabinose, tilivalline was not detectable in the supernatant. However, trace
125
amounts of the carbinolamine derived from 3-hydroxy anthranilic acid and
126
identified by LC-MS. The heterologous system apparently lacked the required indole source
L-proline
were
6 ACS Paragon Plus Environment
Page 7 of 29 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60
ACS Chemical Biology
127
and/or enzyme for tilivalline production. Since no indole formation related genes are present in
128
the tilivalline gene cluster and the E. coli tryptophan degradation pathway is repressed in minimal
129
media,24 indole was supplemented to the medium at a final concentration of 5 mM. LC-MS
130
analysis of the corresponding cultures then indeed confirmed the presence of tilivalline indicating
131
a non-enzymatic mechanism for tilivalline formation from the imine. To facilitate indole
132
generation in vivo the gene of the wild type tryptophanase TnaA of K. oxytoca was cloned tag-
133
free into the pET28b expression vector. Upon induction of an E. coli transformant harboring both
134
constructs, pCLY-Til-24 and pET28b-tnaA, tilivalline production was observed without any
135
addition of indole (Figure 2).
136
To circumvent the poor growth and low yields in E. coli transformants harboring two plasmids
137
with a combined size of over 20 kb and two resistance markers, a second approach was
138
established. The operon containing the core NRPS NpsA, ThdA, and NpsB was cloned entirely
139
and tag-free into pET28b, which yielded a 10-fold increased tilivalline production in M9 minimal
140
media supplemented with 3-hydroxy anthranilic acid, indole, and L-proline. To prove the non-
141
enzymatic nature of the indole incorporation, all enzymes in the supernatant of an E. coli
142
pET28b-Til-NRPS transformant grown without supplementation of indole were inactivated by
143
three different methods. The supernatant containing the carbinolamine was either heat inactivated
144
at 100°C for 5 minutes or supplemented with SDS or methanol to final concentrations of 1% and
145
20%, respectively. Subsequently performed incubation with indole confirmed the tilivalline
146
formation in all three scenarios and thus manifested the probability of a spontaneous reaction of
147
the NRPS produced carbinolamine with free indole (Figure 3).
148 149
In vitro reconstitution of the tilivalline NRPS 7 ACS Paragon Plus Environment
ACS Chemical Biology 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60
Page 8 of 29
150
To further elucidate the biosynthetic pathway of tilivalline, in vitro reconstitution of the
151
underlying proteins was pursued. Thus, the three genes constituting the tilivalline NRPS, npsA,
152
thdA, and npsB and the K. oxytoca tryptophanase tnaA were heterologously expressed in E. coli
153
BL21 (DE3). For the NRPS enzymes an N-terminal, HRV3C cleavable 6xHis-MBP tag was used
154
as it showed to enhance protein yields and solubility. The obtained NRPS proteins were purified
155
to homogeneity by a three-step protocol using nickel-affinity chromatography, a reverse nickel-
156
affinity chromatography step upon HRV-3C digestion to remove the tags, and a gel filtration step
157
(Figure S3). TnaA was enriched by affinity chromatography using an N-terminal 6xHis-tag and
158
purified to homogeneity by a final gel filtration step without removing the tag (Figure S4).
159
The purified proteins NpsA, ThdA, and NpsB were used to reconstitute the biosynthesis of
160
tilivalline in vitro. Upon incubation of the NRPS proteins with the substrates 3-hydroxy
161
anthranilic acid, L-proline, and indole together with the cofactors ATP and NADPH, tilivalline
162
formation could be observed by LC-MS. The addition of TnaA, tryptophan and the cofactor PLP
163
instead of indole also restored production. The activity of TnaA was previously reconstituted in
164
vitro25 (Figure S4). Trace amounts of the carbinolamine could be detected in all assays but it was
165
further accumulated once the indole source was omitted. To prove the non-enzymatic nature of
166
the indole incorporation, the carbinolamine was purified from the in vitro reconstitution assay on
167
analytical scale. In vitro reaction with indole yielded tilivalline and a second, isobaric compound
168
with a slightly different retention time (Figure 3). This additional signal is most likely owing to
169
the formation epi-tilivalline, the diastereomer of tilivalline, during indole addition, since no
170
enzyme controls the stereochemistry. In contrast to tilivalline, the signal of epi-tilivalline
171
decreased in aqueous solution over time, while the peak area of tilivalline remained unchanged.
172
This indicates degradation rather than transformation into the stable epimer.. Instability of
173
epi-tilivalline also explains its absence in K. oxytoca extracts and in the heterologous system. 8 ACS Paragon Plus Environment
Page 9 of 29 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60
ACS Chemical Biology
174
Furthermore, these results hint towards a non-reversible indole addition, since otherwise
175
tilivalline would over time be transformed into its diastereomer and subsequently be degraded.
176
Summarized, the structural backbone of tilivalline is produced by a two-modular NRPS like the
177
ones found in PBD producing actinomycetes. Interestingly, the indole moiety of tilivalline is
178
incorporated by a non-enzymatic process spontaneously in aqueous solution. It can be assumed
179
that the positive resonance effect of the ortho-hydroxyl group increases the basicity of the imine.
180
The formation of an energetically favored five-membered ring including the phenolic hydrogen
181
and the imine nitrogen presumably further promotes the polarization. The resulting mesomeric
182
carbeniumion undergoes a Friedel-Crafts like alkylation with the electron-rich indole carbon
183
(Figure 3). Since K. oxytoca is indole-positive the required free indole is provided by degrading
184
tryptophan.26 The recently published results confirm the herein presented biosynthetic
185
pathway.13,14 Furthermore, the high reactivity of the imine carbon is also observed for other
186
PBDs, for example in the DNA-alkylation reaction of tomaymycin. Here, the missing activation
187
by a ortho-hydroxyl group might allow the purification of the imine form, in contrast to
188
tilivalline.
189 190
Biological activity of Tilivalline
191
Other PBDs like tomaymycin, sibiromycin, and anthramycin show promising cytotoxic activities
192
and thus, have been further developed towards antitumor agents.
193
action is the covalent bond formation between the imine carbon of the PBD with an amino group
194
of a guanidine in the minor groove of the DNA.29 Apparently, an analogous mode-of-action for
195
tilivalline is not possible since the imine-carbon of the PBD is already occupied by the indole.
196
The observed cytotoxicity of synthesized tilivalline with an IC50 of 1.6 µM against KB-3.1 human
197
cervix carcinoma cells raises the question what alternative mode-of-action is present.
27,28
The underlying mode-of-
9 ACS Paragon Plus Environment
ACS Chemical Biology 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60
Page 10 of 29
198
Interestingly and in contrast to previously published data, we found that the carbinolamine (also
199
termed kleboxymycin or tilimycin in other studies)13,14 is by one order of magnitude less toxic on
200
KB-3.1 cells (IC50 23.6 µM). However, different cell lines have been used in the cited studies,
201
making comparability of the data difficult. In our assay the DNA minor groove binder
202
tomaymycin displayed pronounced cytotoxic activity with an IC50 value of 0.06 µM. Since both,
203
tilivalline and its carbinolamine precursor, induce cell death at low to mid µM concentrations it is
204
likely that high local concentrations in the infected host cause the observed epithelial damage in
205
AAHC. Although the molecular details of tilivalline induced apoptosis remain elusive, the
206
respective NRPS constitutes a promising target for anti-virulence strategies.
207 208
Tilivalline NRPS as heterologous platform for the generation of tilivalline derivatives
209
To explore the ability of the NRPS system to accept a broad spectrum of substrates, as it is
210
known for the tomaymycin NRPS,16 the heterologous expression system was utilized to set up a
211
96-well plate based assay for a precursor directed mutasynthesis approach (
212
Table 1). Twelve different halogenated, hydroxylated, or nitrated indole derivatives were
213
supplemented with 3-hydroxy anthranilic acid and L-proline and supernatants were subsequently
214
analyzed by LC-MS (Figure S1). Fluoro- and hydroxyl substituted indoles were incorporated
215
with comparable efficiencies to the native, unsubstituted indole. Although nitro- and bromo
216
derivatives were also accepted, the signal intensities were one order of magnitude lower. The
217
incorporation of 5-iodo indole was inefficient and only trace amounts of the respective tilivalline
218
derivative could be detected. Furthermore, the tilivalline NRPS accepts twelve different
219
anthranilic acid derivatives including halogen-, hydroxy-, methoxy-, and trifluoromethyl
220
substituted ones (Figure S2). The halogenated as well as the hydroxylated and methoxylated
221
anthranilic acid derivatives were readily accepted with product signal intensities comparable to 10 ACS Paragon Plus Environment
Page 11 of 29 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60
ACS Chemical Biology
222
the native tilivalline. The substitution of the 3-hydroxy group with the sterically demanding
223
trifluoromethyl led to a nearly complete abolishment of production and only trace amounts of the
224
respective derivative could be detected. All anthranilic acid derivatives were supplemented
225
together with indole and L-proline. For all tilivalline derivatives, the emergence of a second
226
signal with an approximately 100-fold lower intensity compared to the main product signal was
227
observed. This indicates the formation of both epimers during indole addition and the subsequent
228
degradation of the epi-tilivalline derivative, as already observed for tilivalline.
229
In conclusion, all tested substrates were accepted by the NRPS system with varying overall
230
efficiency. We were able to produce a variety of derivatives of this bioactive compound class,
231
which opens the possibility to search for inhibitors of toxin biosynthesis in K. oxytoca liquid
232
culture using competitive substrates for the A-domain NpsA.
233 234
Salicylic acid based compounds inhibit tilivalline production in K. oxytoca
235
Antibiotic resistant pathogens are an increasing threat to public health. Consequently, the
236
development of alternative antibacterial strategies has become vital. The virulence of pathogens
237
often depends on distinct natural products that act as toxins or siderophores.30–33 Hence, the
238
underlying biosynthetic machinery has emerged as a promising antibacterial target.34,35
239
Substances that are capable to block secondary metabolite pathways have less impact on the
240
overall fitness of the pathogen compared to antibiotics, which usually target vital cell functions.
241
Combination therapy with an anti-virulence agent and an antibacterial drug is thought to reduce
242
the probability of resistance development and the problematic side effects associated with an
243
antibiotic regime.36 NRPS assembly lines use adenylation domains to activate the amino acid
244
substrates as acyl-AMP that remains tightly bound to the active site for downstream processing.
245
Therefore, non-hydrolyzable acyl-AMP mimics such asthe acyl-sulfamoyl-adenosine (acyl-AMS) 11 ACS Paragon Plus Environment
ACS Chemical Biology 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60
Page 12 of 29
246
scaffold have been commonly used for selective inhibition of adenylating enzymes.37 Despite the
247
established application in in vitro experiments, the application in liquid culture is hampered due
248
to poor cell-permeability.38 Nevertheless, inhibition of the biosynthesis of salicyl-capped non-
249
ribosomal-peptide-polyketide siderophores in M. tuberculosis and Y. pestis using salicyl-AMS
250
has been reported where successful inhibition impaired bacterial growth under iron-limiting
251
conditions.39
252
Along those lines we pursued an alternative inhibition approach for the NRPS produced toxin
253
tilivalline, exploring salicylic acid derivatives as potential inhibitors. Activation and transfer of
254
salicylic acid, that lacks the amino group compared to the native substrate 3-hydroxy anthranilic
255
acid, can block the PCP-domain to be no longer available for tilivalline biosynthesis.
256
Additionally, adenylation and loading onto the PCP-domain exhibit a low substrate specificity, as
257
it is known from the in vitro derivatization screening and extensive studies on the related
258
tomaymycin NRPS,16 further favoring our approach.
259
Initially, tilivalline production in K. oxytoca (ID 1976911) was evaluated for different
260
fermentation conditions, whereby incubation for 16 h at 37 °C turned out to be most reliable.
261
Tilivalline production in the presence of different potential inhibitors was subsequently quantified
262
relative to each other by LC-MS. As could be predicted rationally from the biosynthetic route,
263
salicylic acid derivatives lacking the amino group might be loaded to the NRPS and act as
264
inhibitors of the overall reaction. Indeed, salicylic acid inhibited production completely in two
265
steps with IC50 values of 0.3 µM and 43 µM. Acetylsalicylic acid showed an IC50 value of 10 µM
266
for the reduction of tilivalline production to a final level of 15% (Figure 4). Both inhibitors did
267
not affect bacterial growth, as controlled by measuring optical density. Acetylsalicylic acid has
268
been shown to hydrolyze to salicylic acid in aqueous solution and thus probably acts as a
269
prodrug.40 Furthermore, salicylic acid is known to impair bacterial cell viability at high 12 ACS Paragon Plus Environment
Page 13 of 29 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60
ACS Chemical Biology
270
concentrations, including altering gene expression and disturbing motility.41 Therefore the second
271
step of the observed two-step dose model for salicylic acid is likely not result of a selective
272
inhibition of tilivalline biosynthesis, but rather the consequence of overall diminished cell
273
fitness.
274
This result provides first evidence that salicylic and acetylsalicylic acid inhibits tilivalline
275
biosynthesis in K. oxytoca liquid cultures. The low cytotoxicity values of tilivalline and the high
276
production titer in liquid culture indicate a high occurrence of the toxin in the colon as well.
277
Consequently, reduction of this pathogenicity factor is a promising approach to cure or at least
278
reduce severity of AAHC.
279 280 281 282
13 ACS Paragon Plus Environment
ACS Chemical Biology 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60
Page 14 of 29
283 284
Figure 1: A Biosynthetic gene cluster of tilivalline from K. oxytoca (ID 1976911) spans 17 kb. It
285
contains ten open reading frames constituting a two modular NRPS (black), the putative 3-
286
hydroxylase (dark grey), genes for providing anthranilic acid (white) and regulators (light grey).
287
B UV (200-600 nm) trace of the ethyl acetate extract of an K. oxytoca (ID 1976911)
288
fermentation. The asterisk indicates the cytotoxic fraction harboring tilivalline. C Proposed
289
biosynthesis of tilivalline: The NRPS (NpsA,ThdA,NpsB) generates the tilivalline backbone from
290
3-hydroxy anthranilic acid and proline. The biochemistry of the subsequent indole incorporation
291
was elusive.
292
14 ACS Paragon Plus Environment
Page 15 of 29 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60
ACS Chemical Biology
293 294
Figure 2: A Schematic display of the TAR assembly of the five PCR generated DNA fragments
295
to yield the heterologous expression construct pCLY-Til. B Two different heterologous
296
expression systems for tilivalline in E. coli BL21 (DE3) have been generated. Simultaneous
297
expression of pCLY-Til and pET28b-tnaA or indole supplementation led to successful restoration
298
of tilivalline production. Expression of the construct pET28b-NRPS while supplementation of all 15 ACS Paragon Plus Environment
ACS Chemical Biology 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60
Page 16 of 29
299
three precursors indole, 3-hydroxy anthranilic acid, and L-proline restored tilivalline production
300
as well. C LC-MS analysis of the different heterologous systems shows the successful production
301
of tilivalline in M9 minimal media. E. coli BL21 (DE3) pCly-Til-24 produces tilivalline when
302
indole is either produced in the cell by the tryptophanase construct pET28b-tnaA (I) or
303
supplemented in the culture media (II). E. coli BL21 (DE3) pET28b-NRPS produces tilivalline
304
when the substrates are supplemented (III). Synthesized (V) and purified tilivalline from K.
305
oxytoca (ID 1976911) (IV) were used as standard.
306 307
16 ACS Paragon Plus Environment
Page 17 of 29 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60
ACS Chemical Biology
308 309
Figure 3: A Formation of tilivalline and epi-tilivalline can be detected upon incubation of indole
310
with the purified PBD precursor in the carbinolamine form (I). PBD-precursor was purified from
311
the in vitro reconstitution of NpsA, ThdA and NpsB without indole supplementation (II).
312
Synthesized tilivalline was used as a standard (III). EIC traces for tilivalline (black, 334.1500 ±
313
0.002 m/z) and carbinolamine (grey, 235.10772 ± 0.002 m/z) are shown. B LC-MS derived EICs
314
prove formation of tilivalline in the supernatant of induced E. coli BL21 (DE3) pET28b-NRPS
315
cultures in M9 minimal media (IV) upon addition of indole (I). Inactivation of enzymes by heat
316
(HI) (II) or methanol (III) did not impair product formation. Synthesized tilivalline was used as
317
standard (V) C Theoretical reaction mechanism for indole incorporation include the iminium
318
transition state stabilized by the acidic phenolic hydrogen in ortho-position. Tilivalline is formed
319
after Friedel-Crafts-like alkylation of nucleophilic indole at the carbeniumion takes place. Non-
320
enzymatic incorporation leads to loss of stereochemical control and both epimers, tilivalline and
321
epi-tilivalline are formed, while the latter proved instable and degrades over time. 17 ACS Paragon Plus Environment
ACS Chemical Biology 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60
Page 18 of 29
322
Table 1: Mutasynthesis of tilivalline derivatives by supplementing E. coli BL21 (DE3) pET28b-
323
NRPS fermentations with anthranilic acid or indole derivatives. Incorporation efficiency was
324
estimated by comparing LC-MS derived EIC signal intensities compared to tilivalline production:
325
similar production (+++), one magnitude less (++), little (+) and trace amount (tr).
326
18 ACS Paragon Plus Environment
Page 19 of 29 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60
ACS Chemical Biology
327 328
Figure 4: Salicylic acid and acetylsalicylic acid inhibit tilivalline biosynthesis in K. oxytoca (ID
329
1976911) liquid culture. Experiments were carried out in triplicates. Mean values and standard
330
deviations are given. A two-step and one-step dose-response model was used to fit salicylic acid
331
and acetylsalicylic acid data, respectively.
332
19 ACS Paragon Plus Environment
ACS Chemical Biology 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60
333
Methods
334
Sequencing of strain K. oxytoca (ID 1976911)
335
The strain K. oxytoca (ID 1976911) was obtained from Dr. Alexander Halfmann, Saarland
336
University Medical Center, Homburg, Germany. Prior sequencing, presence of the tilivalline
337
gene cluster was confirmed by successfully amplifying npsA using the primer pair NpsA-
338
FP/NpsA-RP designed for protein purification. Draft genome sequence of Klebsiella oxytoca (ID
339
1976911) was obtained using Illumina sequencing technology in cooperation with the Genome
340
Analytics group at the Helmholtz Centre for Infection Research (Braunschweig, Germany). Raw
341
sequencing data obtained from the MiSeq platform comprised 2,849,072 paired-end reads with
342
the length of 250 bp each. This raw data was assembled into contigs with Abyss-pe assembler
343
software42, version 1.9.0. The resulting 192 contiguous sequences (contigs) were mapped to the
344
reference sequence of a close relative genome of Klebsiella oxytoca MGH 28 (GenBank
345
accession code: KI535631) in Geneious software43, verision 9.0.5. The resulting draft genome
346
circular scaffold of 5,720,468 bp was used for the downstream analysis. The cluster sequence will
347
be made available at GenBank upon acceptance of the manuscript.
348
Isolation of tilivalline
349
Preparative HPLC was performed with a Waters Autopurifier System (APS) equipped with a
350
Waters XBridge C18 150 x 4.6 mm, 5 µm dp analytical column for method development at 1.0
351
mL/min flow rate. Preparative separations were performed with a XBridge C18 150 x 19 mm, 5
352
µm dp column at 25 mL/min flow rate. Both used (A) water + 0.1 % FA and (B) acetonitrile +
353
0.1 % FA as solvent system. Elution of an 800 µL sample injection started with a 3 min isocratic
354
step at 5 % B, a linear increase to 40 % B within 25 min, a steep increase to 95 % B in 2 min,
355
followed by a 3 min plateau at 95 % prior to reequilibration to initial conditions. The overall run
356
time was 34 min while 40 fractions were collected in a period from 19 to 22 min. Fractions were 20 ACS Paragon Plus Environment
Page 20 of 29
Page 21 of 29 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60
ACS Chemical Biology
357
combined based on MS data and yielded tilivalline in high purity without any further purification
358
efforts.
359
TAR assembly of the tilivalline biosynthetic gene cluster
360
PCR fragments of the vector backbone, promoter cassettes, tilivalline NRPS and tailoring operon
361
were amplified using primers with suitable 40bp 5’overhangs (Table S2). TAR assembly in S.
362
cerevisiae was conducted as described previously.23 Colony PCR targeting fragment borders was
363
used to preselect yeast colonies (Table S2). Positive clones were grown in selective leucine
364
deficient media overnight and subsequently the plasmid DNA was isolated. Plasmid isolation by
365
alkaline lysis from E. coli Gbred transformants and subsequent restriction digest was used to
366
identify correct constructs. Isolation attempts with E. coli Dh10b or HS916 cells yielded low
367
DNA concentration. Plasmids were subsequently verified by Illumina sequencing.
368
Heterologous expression of the tilivalline biosynthetic gene cluster
369
E. coli BL21 (DE3) pCly-Til-24 (or 28) cells were grown overnight in LB media at 30°C.
370
Expression in 10 mL M9 minimal media with 2% glycerol as sole carbon source at 30°C for 16 h
371
was induced by addition of 2% (w/v) arabinose and 5 ng/mL tetracycline after cell density
372
reached OD600=0.6. Subsequently the filtrated supernatant was forwarded to LCMS analysis.
373
TnaA was coexpressed in pET28b using the same protocol but with additional induction with 0.1
374
mM IPTG. Supplementation with indole was carried out simultaneously with induction with a
375
final concentration of 1mM.
376
Heterologous expression of the tilivalline NRPS
377
The operon harboring the tilivalline NRPS was cloned into pET28b using suitable primers
378
allowing for tag-free expression. E. coli BL21 (DE3) pET28b-NRPS cells were grown overnight
379
in LB media at 30°C. Expression in M9 minimal media with 2% glucose as sole carbon source at 21 ACS Paragon Plus Environment
ACS Chemical Biology 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60
Page 22 of 29
380
30°C was induced by addition of 0.1 mM IPTG, 1mM indole, 1mM 3-hydroxy anthranilic acid
381
and 1mM L-proline after cell density reached OD600=0.6. After incubation for 16h the filtrated
382
supernatant was forwarded to LCMS analysis. Synthetic biology studies were carried out by
383
substituting indole or 3-hydroxy anthranilic acid with the respective derivative. Initial
384
fermentation was carried out in 10 mL volume. Feeding studies were carried out in 150 µL
385
volume using a 96-well flat bottom plate.
386
Protein Purification of NpsA, ThdA, and NpsB
387
The respective gene was inserted into a petM44 expression vector with an N-terminal 6xHis-
388
MBP tag using according primers (restriction site in bold):
389
NpsA-FP
AAAAACCATGGCAACGCATTCAGCATA
390
NpsA -RP
AAAAAAAGCTTTTACACCTGCTCCAGTAAAGAATTT
391
ThdA-FP
AAAAACCATGGCAGACAACGTTGAGCAA
392
ThdA -RP
AAAAAAAAGCTTTTAGAGCTTTTGCCGTTGCC
393
NpsB-FP
AAAAACCATGGCACCATCATTCAATAGCG
394
NpsB-RP
AAAAAGGATCCCTAGACAATTTCTTTCTGCCGCT
395
The respective construct was expressed in E. coli BL21 (DE3) cells (500 mL LB, 0.1 mM IPTG,
396
16°C, 16h). The cell pellet was resuspended in lysis buffer (150 mM NaCl, 25 mM Tris, 40 mM
397
Imidazole, 1 mM TCEP, pH 7.5), sonicated and centrifuged. The supernatant was loaded onto a
398
gravity flow column containing Ni-NTA loaded sepharose, washed with lysis buffer, and
399
subsequently eluted in one step (250 mM Imidazole). The tag was cleaved using HRV3C
400
protease during overnight dialysis against SEC buffer (150 NaCl, 25 Tris, pH 7.5) at 4 °C, and
401
removed by a second Ni-NTA chromatography step. After passing through a Superdex 200 16/60
402
pg column (GE Healthcare Life Sciences) the protein was concentrated using a 30 kDa (NpsA 22 ACS Paragon Plus Environment
Page 23 of 29 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60
ACS Chemical Biology
403
and NpsB) or 10 kDa (ThdA) cutoff filter and stored at -80 °C in 10% glycerol. Protein purity
404
was determined by SDS-PAGE. Protein concentration was determined spectrophotometrically
405
upon determining the respective extinction coefficient from the amino acid sequence using the
406
PROTPARAM webserver (http://web.expasy.org/protparam/).44
407 408
In Vitro Reconstitution of tilivalline NRPS
409
NpsA, ThdA and NpsB (0.4 µM each) were incubated with the respective cofactors (1 mM ATP,
410
0.5 mM NADPH) and substrates (0.5 mM Proline, 3-OH-anthranilic acid, indole) in reaction
411
buffer (150 mM NaCl, 10 mM MgCl2, 50 mM Tris-HCl, pH 7.5) in a total volume of 20 µL at
412
room temperature for 4h. The mixture was dried in a vacuum condenser and subsequently
413
resuspended in 20 µL water:acetonitrile (1:1), centrifuged and submitted to LC-MS analysis.
414
In Vitro Reconstitution of tilivalline NRPS and TnaA
415
2 µM TnaA and 0.4 µM each of NpsA, ThdA and NpsB were incubated with the respective
416
cofactors (0.1 mM PLP, 1 mM ATP, 0.5 mM NADPH) and substrates (0.5 mM Prolin, 3-OH-
417
anthranilic acid and tryptophan) in reaction buffer (150 mM NaCl, 10 mM MgCl2, 50 mM Tris-
418
HCl, pH 7.5) in a total volume of 20 µL at 37°C for 2.5h. The mixture was dried in a vacuum
419
condenser and subsequently resuspended in 20 µL water:acetonitrile (1:1), centrifuged and
420
submitted to LC-HRMS analysis.
421
Determination of Cytotoxicity
422
KB-3.1 human cervix carcinoma cells were obtained from the German Collection of
423
Microorganisms and Cell Cultures (Deutsche Sammlung für Mikroorganismen und Zellkulturen,
424
DSMZ) and were cultured under conditions recommended by the depositor. Cells were seeded at
425
6 x 103 cells per well of 96-well plates in 180 µL complete medium and treated with compounds 23 ACS Paragon Plus Environment
ACS Chemical Biology 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60
Page 24 of 29
426
in duplicate in serial dilution after 2 h of equilibration. After 5 d incubation, 20 µL of 5 mg mL-1
427
MTT (thiazolyl blue tetrazolium bromide) in PBS was added per well and it was further
428
incubated for 2 h at 37°C. The medium was then discarded and cells were washed with 100 µL
429
PBS before adding 100 µL 2-propanol/10 N HCl (250:1) in order to dissolve formazan granules.
430
The absorbance at 570 nm was measured using a microplate reader (Tecan Infinite M200Pro),
431
and cell viability was expressed as percentage relative to the respective solvent control. IC50
432
values were determined by sigmoidal curve fitting.
433
Inhibition of tilivalline production in K. oxytoca (ID 1976911)
434
Cryo-cultures of K. oxytoca (ID 1976911) were streaked out on TSA-S plates and incubated at
435
37 °C overnight and subsequently stored at 4°C until use. Inhibition of tilivalline production was
436
screened in 8 mL TSB media inoculated from single colonies in flasks without baffles. The
437
inhibitor was added to its final concentration using DMSO stock solutions. Cultures were
438
incubated for 16 h at 37 °C and 100 rpm. 10 mL ethyl acetate was added and shaking was
439
continued for additional 30 minutes. 1 mL of the organic phase was dried and resuspended in
440
40 µL acetonitrile:water (1:1), centrifuged and submitted to LCMS analysis. Experiments were
441
carried out in triplicates.
442 443
Supporting Information
444
Sequence homologies, TAR primer sequences, tilivalline NMR data, tilivalline derivatives MS
445
data, NpsA, NpsB and ThdA SDS-PAGE, TnaA in vitro reconstitution, supplemental methods
446
(purification and in vitro reconstitution of TnaA, analytical methods), synthetic procedures. This
447
material is available free of charge via the Internet at http://pubs.acs.org.
448
References 24 ACS Paragon Plus Environment
Page 25 of 29 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60
ACS Chemical Biology
449 450
(1) Mohr, N., and Budzikiewicz, H. (1982) Tilivalline, a new pyrrolo[2, 1-c][1,4] benzodiazepine metabolite from klebsiella. Tetrahedron 38, 147–152.
451 452 453 454
(2) Schneditz, G., Rentner, J., Roier, S., Pletz, J., Herzog, K. A. T., Bucker, R., Troeger, H., Schild, S., Weber, H., Breinbauer, R., Gorkiewicz, G., Hogenauer, C., and Zechner, E. L. (2014) Enterotoxicity of a nonribosomal peptide causes antibiotic-associated colitis. Proc. Natl. Acad. Sci. 111, 13181–13186.
455 456
(3) Gerratana, B. (2012) Biosynthesis, synthesis, and biological activities of pyrrolobenzodiazepines. Med. Res. Rev. 32, 254–293.
457 458
(4) Shioiri, T., Aoyama, T., Yamagami, N., Shimizu, N., Mori, N., and Kohda, K. (1995) Structure-cytotoxicity relationship of tilivalline derivatives. Anticancer. Drug Des. 10, 167–176.
459 460
(5) Minami, J., Okabe, A., Shiode, J., and Hayashi, H. (1989) Production of a unique cytotoxin by Klebsiella oxytoca. Microb. Pathog. 7, 203–211.
461 462
(6) Higaki, M., Chida, T., Takano, H., and Nakaya, R. (1990) Cytotoxic component(s) of Klebsiella oxytoca on HEp-2 cells. Microbiol. Immunol. 34, 147–151.
463 464 465 466
(7) Darby, A., Lertpiriyapong, K., Sarkar, U., Seneviratne, U., Park, D. S., Gamazon, E. R., Batchelder, C., Cheung, C., Buckley, E. M., Taylor, N. S., Shen, Z., Tannenbaum, S. R., Wishnok, J. S., and Fox, J. G. (2014) Cytotoxic and pathogenic properties of Klebsiella oxytoca isolated from laboratory animals. PLoS One 9.
467 468 469 470
(8) Beaugerie, L., Metz, M., Barbut, F., Bellaiche, G., Bouhnik, Y., Raskine, L., Nicolas, J.-C., Chatelet, F.-P., Lehn, N., Petit, J.-C., and Infectious Colitis Study Group. (2003) Klebsiella oxytoca as an agent of antibiotic-associated hemorrhagic colitis. Clin. Gastroenterol. Hepatol. 1, 370–376.
471 472 473
(9) Högenauer, C., Langner, C., Beubler, E., Lippe, I. T., Schicho, R., Gorkiewicz, G., Krause, R., Gerstgrasser, N., Krejs, G. J., and Hinterleitner, T. a. (2006) Klebsiella oxytoca as a causative organism of antibiotic-associated hemorrhagic colitis. N. Engl. J. Med. 355, 2418–2426.
474 475
(10) Chow, J., Tang, H., and Mazmanian, S. K. (2011) Pathobionts of the gastrointestinal microbiota and inflammatory disease. Curr. Opin. Immunol. 23, 473–480.
476 477 478
(11) Li, W., Chou, S., Khullar, A., and Gerratana, B. (2009) Cloning and characterization of the biosynthetic gene cluster for tomaymycin, an sjg-136 monomeric analog. Appl. Environ. Microbiol. 75, 2958–2963.
479 480
(12) Li, W., Khullar, A., Chou, S., Sacramo, A., and Gerratana, B. (2009) Biosynthesis of sibiromycin, a potent antitumor antibiotic. Appl. Environ. Microbiol. 75, 2869–2878.
481 482 483 484
(13) Tse, H., Yang, D., Sze, K.-H., Chu, I. K., Kao, R. Y. T., Lee, K.-C., Lam, C.-W., Gu, Q., Tai, S. S.-C., Ke, Y., Chan, E., Chan, W.-M., Dai, J., Leung, S.-P., Leung, S.-Y., and Yuen, K.Y. (2017) A tricyclic pyrrolobenzodiazepine produced by Klebsiella oxytoca is associated with cytotoxicity in antibiotic-associated hemorrhagic colitis. J. Biol. Chem. jbc.M117.791558.
485 486
(14) Dornisch, E., Pletz, J., Glabonjat, R. A., Martin, F., Lembacher-Fadum, C., Neger, M., Hoegenauer, C., Francesconi, K., Kroutil, W., Zangger, K., Breinbauer, R., Zechner, E. L., and 25 ACS Paragon Plus Environment
ACS Chemical Biology 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60
Page 26 of 29
487 488 489
Högenauer, C. (2017) Angewandte International Edition Title: Biosynthesis of the enterotoxic pyrrolobenzodiazepine natural product tilivalline Biosynthesis of the enterotoxic pyrrolobenzodiazepine natural product tilivalline. Angew. Chem. Int. Ed. Angew. Chem 10.
490 491 492 493
(15) Tobias, N. J., Wolff, H., Djahanschiri, B., Grundmann, F., Kronenwerth, M., Shi, Y. M., Simonyi, S., Grün, P., Shapiro-Ilan, D., Pidot, S. J., Stinear, T. P., Ebersberger, I., and Bode, H. B. (2017) Natural product diversity associated with the nematode symbionts Photorhabdus and Xenorhabdus. Nat. Microbiol. 2, 1676–1685.
494 495 496 497
(16) von Tesmar, A., Hoffmann, M., Pippel, J., Fayad, A. A., Dausend-Werner, S., Bauer, A., Blankenfeldt, W., and Müller, R. (2017) Total Biosynthesis of the Pyrrolo[4,2]benzodiazepine Scaffold Tomaymycin on an In Vitro Reconstituted NRPS System. Cell Chem. Biol. 24, 1216– 1227.e8.
498 499
(17) Finking, R., and Marahiel, M. A. (2004) Biosynthesis of Nonribosomal Peptides. Annu. Rev. Microbiol. 58, 453–488.
500 501 502
(18) Fischbach, M. A., and Walsh, C. T. (2006) Assembly-line enzymology for polyketide and nonribosomal peptide antibiotics: Logic machinery, and mechanisms. Chem. Rev. 106, 3468– 3496.
503 504
(19) Süssmuth, R. D., and Mainz, A. (2017) Nonribosomal Peptide Synthesis—Principles and Prospects. Angew. Chemie - Int. Ed.
505 506
(20) Hur, G. H., Vickery, C. R., and Burkart, M. D. (2012) Explorations of catalytic domains in non-ribosomal peptide synthetase enzymology. Nat. Prod. Rep. 29, 1074.
507 508 509 510
(21) Weber, T., Blin, K., Duddela, S., Krug, D., Kim, H. U., Bruccoleri, R., Lee, S. Y., Fischbach, M. A., Müller, R., Wohlleben, W., Breitling, R., Takano, E., and Medema, M. H. (2015) antiSMASH 3.0-a comprehensive resource for the genome mining of biosynthetic gene clusters. Nucleic Acids Res. 43, W237--43.
511 512 513 514
(22) Takeo, M., Murakami, M., Niihara, S., Yamamoto, K., Nishimura, M., Kato, D. I., and Negoro, S. (2008) Mechanism of 4-nitrophenol oxidation in Rhodococcus sp. strain PN1: Characterization of the two-component 4-nitrophenol hydroxylase and regulation of its expression. J. Bacteriol. 190, 7367–7374.
515 516 517
(23) Bilyk, O., Sekurova, O. N., Zotchev, S. B., and Luzhetskyy, A. (2016) Cloning and Heterologous Expression of the Grecocycline Biosynthetic Gene Cluster. PLoS One 11, e0158682.
518 519
(24) Han, T. H., Lee, J.-H., Cho, M. H., Wood, T. K., and Lee, J. (2011) Environmental factors affecting indole production in Escherichia coli. Res. Microbiol. 162, 108–116.
520 521
(25) Ku, S. Y., Yip, P., and Howell, P. L. (2006) Structure of Escherichia coli tryptophanase. Acta Crystallogr. Sect. D Biol. Crystallogr. 62, 814–823.
522 523 524
(26) Podschun, R., and Ullmann, U. (1998) Klebsiella spp. as nosocomial pathogens: Epidemiology, taxonomy, typing methods, and pathogenicity factors. Clin. Microbiol. Rev. 11, 589–603. 26 ACS Paragon Plus Environment
Page 27 of 29 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60
ACS Chemical Biology
525 526 527
(27) Kumar, R., and Lown, J. W. (2003) Recent developments in novel pyrrolo[2,1c][1,4]benzodiazepine conjugates: synthesis and biological evaluation. Mini Rev. Med. Chem. 3, 323–339.
528 529 530
(28) Mantaj, J., Jackson, P. J. M., Rahman, K. M., and Thurston, D. E. (2017) From Anthramycin to Pyrrolobenzodiazepine (PBD)-Containing Antibody-Drug Conjugates (ADCs). Angew. Chem. Int. Ed. Engl. 56, 462–488.
531 532 533
(29) Puvvada, M. S., Forrow, S. A., Hartley, J. A., Stephenson, P., Gibson, I., Jenkins, T. C., and Thurston, D. E. (1997) Inhibition of bacteriophage T7 RNA polymerase in vitro transcription by DNA-binding pyrrolo[2,1-c][1,4]benzodiazepines. Biochemistry 36, 2478–2484.
534 535 536
(30) Liu, G. Y., Essex, A., Buchanan, J. T., Datta, V., Hoffman, H. M., Bastian, J. F., Fierer, J., and Nizet, V. (2005) Staphylococcus aureus golden pigment impairs neutrophil killing and promotes virulence through its antioxidant activity. J. Exp. Med. 202, 209–215.
537 538 539
(31) Chang, C.-I., Chelliah, Y., Borek, D., Mengin-Lecreulx, D., and Deisenhofer, J. (2006) Structure of tracheal cytotoxin in complex with a heterodimeric pattern-recognition receptor. Science 311, 1761–1764.
540 541
(32) Holden, V. I., and Bachman, M. A. (2015) Diverging roles of bacterial siderophores during infection. Metallomics 7, 986–995.
542 543 544
(33) Neumann, W., Gulati, A., and Nolan, E. M. (2017) Metal homeostasis in infectious disease: recent advances in bacterial metallophores and the human metal-withholding response. Curr. Opin. Chem. Biol. 37, 10–18.
545 546 547 548
(34) Song, Y., Liu, C. I., Lin, F. Y., Joo, H. N., Hensler, M., Liu, Y. L., Jeng, W. Y., Low, J., Liu, G. Y., Nizet, V., Wang, A. H. J., and Oldfield, E. (2009) Inhibition of staphyloxanthin virulence factor biosynthesis in Staphylococcus aureus: In vitro, in vivo, and crystallographic results. J. Med. Chem. 52, 3869–3880.
549 550
(35) Lamb, A. L. (2015) Breaking a pathogen’s iron will: Inhibiting siderophore production as an antimicrobial strategy. Biochim. Biophys. Acta 1854, 1054–1070.
551 552
(36) Maura, D., Ballok, A. E., and Rahme, L. G. (2016) Considerations and caveats in antivirulence drug development. Curr. Opin. Microbiol. 33, 41–46.
553 554 555 556
(37) Finking, R., Neumüller, A., Solsbacher, J., Konz, D., Kretzschmar, G., Schweitzer, M., Krumm, T., and Marahiel, M. A. (2003) Aminoacyl adenylate substrate analogues for the inhibition of adenylation domains of nonribosomal peptide synthetases. ChemBioChem 4, 903– 906.
557 558 559
(38) Davis, T. D., Mohandas, P., Chiriac, M. I., Bythrow, G. V, Quadri, L. E. N., and Tan, D. S. (2016) Design, synthesis, and biological evaluation of $α$-hydroxyacyl-AMS inhibitors of amino acid adenylation enzymes. Bioorg. Med. Chem. Lett. 26, 5340–5345.
560 561 562
(39) Ferreras, J. A., Ryu, J.-S., Di Lello, F., Tan, D. S., and Quadri, L. E. N. (2005) Smallmolecule inhibition of siderophore biosynthesis in Mycobacterium tuberculosis and Yersinia pestis. Nat. Chem. Biol. 1, 29–32. 27 ACS Paragon Plus Environment
ACS Chemical Biology 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60
Page 28 of 29
563 564 565
(40) Edwards, L. J. (1950) The hydrolysis of aspirin. A determination of the thermodynamic dissociation constant and a study of the reaction kinetics by ultra-violet spectrophotometry. Trans. Faraday Soc. 46, 723.
566 567
(41) Price, C. T. D., Lee, I. R., and Gustafson, J. E. (2000) The effects of salicylate on bacteria. Int. J. Biochem. Cell Biol.
568 569
(42) Simpson, J. T., Wong, K., Jackman, S. D., Schein, J. E., Jones, S. J. M., and Birol, I. (2009) ABySS: A parallel assembler for short read sequence data. Genome Res. 19, 1117–1123.
570 571 572 573
(43) Kearse, M., Moir, R., Wilson, A., Stones-Havas, S., Cheung, M., Sturrock, S., Buxton, S., Cooper, A., Markowitz, S., Duran, C., Thierer, T., Ashton, B., Meintjes, P., and Drummond, A. (2012) Geneious Basic: An integrated and extendable desktop software platform for the organization and analysis of sequence data. Bioinformatics 28, 1647–1649.
574 575 576
(44) Gasteiger, E., Hoogland, C., Gattiker, A., Duvaud, S., Wilkins, M. R., Appel, R. D., and Bairoch, A. (2005) Protein Identification and Analysis Tools on the ExPASy Server, in The Proteomics Protocols Handbook, pp 571–607.
577
28 ACS Paragon Plus Environment
Page 29 of 29 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60
ACS Chemical Biology
TOC 78x37mm (300 x 300 DPI)
ACS Paragon Plus Environment