Bisubstrate Function of RNA Polymerases Triggered by Molecular

Subscriber access provided by Iowa State University | Library

Article

Bisubstrate function of RNA polymerases triggered by molecular crowding conditions Shuntaro Takahashi, Hiromichi Okura, and Naoki Sugimoto Biochemistry, Just Accepted Manuscript • DOI: 10.1021/acs.biochem.8b01204 • Publication Date (Web): 04 Feb 2019 Downloaded from http://pubs.acs.org on February 6, 2019

Just Accepted “Just Accepted” manuscripts have been peer-reviewed and accepted for publication. They are posted online prior to technical editing, formatting for publication and author proofing. The American Chemical Society provides “Just Accepted” as a service to the research community to expedite the dissemination of scientific material as soon as possible after acceptance. “Just Accepted” manuscripts appear in full in PDF format accompanied by an HTML abstract. “Just Accepted” manuscripts have been fully peer reviewed, but should not be considered the official version of record. They are citable by the Digital Object Identifier (DOI®). “Just Accepted” is an optional service offered to authors. Therefore, the “Just Accepted” Web site may not include all articles that will be published in the journal. After a manuscript is technically edited and formatted, it will be removed from the “Just Accepted” Web site and published as an ASAP article. Note that technical editing may introduce minor changes to the manuscript text and/or graphics which could affect content, and all legal disclaimers and ethical guidelines that apply to the journal pertain. ACS cannot be held responsible for errors or consequences arising from the use of information contained in these “Just Accepted” manuscripts.

is published by the American Chemical Society. 1155 Sixteenth Street N.W., Washington, DC 20036 Published by American Chemical Society. Copyright © American Chemical Society. However, no copyright claim is made to original U.S. Government works, or works produced by employees of any Commonwealth realm Crown government in the course of their duties.

Page 1 of 41 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

Bisubstrate function of RNA polymerases triggered by molecular crowding conditions Shuntaro Takahashi,1 Hiromichi Okura1 and Naoki Sugimoto1,2* 1

Frontier Institute for Biomolecular Engineering Research (FIBER), Konan University, 7-

1-20 Minatojima-Minamimachi, Kobe 650-0047, Japan.  2

Graduate School of Frontiers of Innovative Research in Science and Technology

(FIRST), Konan University, 7-1-20 Minatojima-Minamimachi, Kobe 650-0047, Japan. * To whom correspondence should be addressed. Tel: (+81)78-303-1457; Fax: (+81)78-3031495; Email: [email protected]

1

ACS Paragon Plus Environment

Biochemistry 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 2 of 41

ABSTRACT Since the origin of life on Earth, the role of carrying genetic information has been presumably transferred from RNA to DNA. At present, cellular environments are extremely dense, packed with co-solutes and macromolecules. Hence, the preference between RNA-dependent RNA and DNA polymerization may be affected by molecular crowding. In this study, we investigated both RNA-dependent RNA and DNA polymerizations by tC9Y polymerase ribozyme, T7 RNA polymerase (T7 RNAP), and Klenow fragment DNA polymerase (KF) in different molecular crowding conditions. Poly(ethylene glycol) (PEG) of various molecular weights was used as a crowding agent, and found to promote both RNA and DNA ribozyme-catalyzed polymerizations. In contrast, PEG with an average molecular weight of 200 (PEG200) reduced RNA polymerization by proteinaceous T7 RNAP, but simultaneously promoted DNA polymerization, without affecting the activity of KF. Thus, proteinaceous RNA polymerase might potentially display bisubstrate specificity, which is switchable in response to changes in dielectric constant and excluded volume in crowded environments. Our findings validate the bisubstrate activity of RNA polymerase from evolutionary aspects for the development of non-natural materials.

2


Page 3 of 41 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

INTRODUCTION The "RNA world" hypothesis suggests that genetic information in prebiotic life was stored in RNA.1 At some evolutionary stage, DNA is assumed to have become genetic material.2 One advantage of DNA over RNA for information storage is that the DNA backbone is less susceptible to hydrolysis than is the RNA backbone, because it lacks the reactive nucleophilic 2'-OH. Moreover, an analysis of non-enzymatic template-dependent polymerization of ribonucleotide analogs revealed that DNA replication is not as errorprone as RNA replication, likely because of the slower rate of the phosphodiester bond formation of DNA compared to RNA, which allows nucleotides to form optimal base pairs.3 The replication reaction may have been catalyzed by ribozymes or proteinaceous enzymes in the ribonucleoprotein (RNP) world that followed the RNA world. However, the process of emergence of the DNA world is controversial, and it is still unclear how the enzymatic DNA replication came to dominate that of the RNA one for storage of genetic information. The polymerizations of oligonucleotides are now catalyzed by proteinaceous polymerases: RNA polymerases (RNAPs), which recognize only ribonucleotides as substrates, and DNA polymerases (DNAPs), which are specific for deoxynucleotides. Both enzymes catalyze reactions of near-cognate substrates that share an overall topology of the active site.4 Thus, it has been suggested that RNAPs evolved into DNAPs,5 and therefore, RNAPs may have catalyzed DNA polymerization in the prebiotic world. If this hypothesis is true, RNAPs should display bisubstrate specificity, which could be differentially regulated to polymerize either RNA or DNA. Changes of substrate specificity could have been induced via structural changes of the enzyme because of mutation. On the other hand, enzymatic processes are also influenced by their molecular environments.6 For example, molecular crowding should impact reactions that occur in modern cells. The cellular environment includes cosolutes that lead to low water activity,

3


Biochemistry 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

a small dielectric constant, and a large excluded volume.7,

Page 4 of 41

8

These parameters have

effects on the folding and enzymatic activity of RNA, DNA, and proteins.9-14 During evolution, the concentration of cosolutes likely altered dramatically not only because of compartmentalization by the formation of vesicles and coacervates,15,

16

but also

because of changes in concentrations of organic compounds.17, 18 Phylogenetic studies suggest that the DNA replication system was established after compartmentalization of genetic materials in individual species.19,

20

A recent study suggested that crowded

environments could have facilitated non-enzymatic RNA and DNA replications.21 Thus, we have deduced that molecular crowding potentially impacted the bisubstrate specificity of RNAPs for the synthesis of both RNA and DNA. In this study, we investigated the effect of molecular crowding on RNA-dependent polymerization of ribonucleoside triphosphates (NTPs) and 2'-deoxyribonucleoside triphosphates (dNTPs). We compared the effects of molecular crowding of poly(ethylene glycol) (PEG) of different molecular weights on three polymerases: a ribozyme called tC9Y,22 which catalyzes RNA polymerization, a proteinaceous T7 RNA polymerase (T7 RNAP), which also catalyzes RNA polymerization, and a proteinaceous Klenow fragment DNA polymerase (KF), which catalyzes DNA polymerization. These three polymerases catalyze nucleotide polymerization through similar Mg2+-mediated mechanisms. In the first step of polymerization, each enzyme binds a nucleotide to an oligonucleotide primer that is paired with an RNA template.22-24 As a result, although the substrate specificity of reactions catalyzed by tC9Y and KF were not affected, in the reaction catalyzed by T7 RNAP, PEG with average molecular weight of 200 (PEG200) reduced the activity of RNA synthesis, and simultaneously enhanced the polymerization of dNTPs. Because evolutionarily older (precursor) enzymes have broad specificity, the transformability of bisubstrate specificity of T7 RNAP suggests a similarly transient evolutionary process with a role of RNAP in the transition from the RNP world to the DNA world. The

4


Page 5 of 41 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

bisubstrate specificity induced by molecular crowding enabled production of mixed oligonucleotides containing 2'-modified RNA residues. Our findings suggest a new concept of enzyme evolution and application using the bisubstrate specificity of the T7 RNAP enzyme in response to the changing crowding environments.

MATERIALS AND METHODS Materials NTP solutions were purchased from Thermo Scientific, dNTP solutions were purchased from Toyobo, and 2'-modified NTPs were purchased from Trilink. Ethylene glycol (EG), PEG200, and PEG8000 were purchased from Wako Pure Chemicals and used without further purification. T7 RNAP was purchased from Takara Bio. KF was purchased from New England BioLabs. Other reagents were purchased from Wako Pure Chemicals. Primer and template The FITC-labeled primer was purchased from Japan Bio Service. The sequence is shown in Table S1. Template RNA strands were prepared by in vitro transcription of template DNA strands amplified by PCR. All DNAs were HPLC-grade and were purchased

from

Eurofins

Genomics.

The

sense

DNA

strand

(5'-

GATCGATCTCGCCCGCGAAATTAATACGACTCACTATAGTCAATGACACGCTTC-3') and

each

antisense

DNA

(5'-

TTTTTTTTTTCTGCCAACCGTGCGAAGCGTGTCATTGACTATAG-3',

5'-

TTTTTTTTTTCTGCCAACCGGGCGAAGCGTGTCATTGACTATAG-3',

5'-

TTTTTTTTTTCTGCCAACCGCGCGAAGCGTGTCATTGACTATAG-3',

or

5'-

TTTTTTTTTTCTGCCAACCGAGCGAAGCGTGTCATTGACTATAG-3') was annealed and amplified by PCR. The obtained DNA was transcribed using the CUGA7 in vitro

5


Biochemistry 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 6 of 41

transcription kit from Nippon Gene. Transcripts were separated by denaturing polyacrylamide gel electrophoresis (PAGE) (8% acrylamide, 8 M urea in Tris-borateEDTA buffer) at 70 °C. The transcripts were recovered from the gel by incubation in a solution containing EDTA for 30 min, then in the EDTA solution for 1.5 h (both at 37 °C), and then in ultrapure water overnight at 30 °C. The extracted transcripts were precipitated twice from ethanol and resuspended in ultrapure water. The RNA solutions were stored at -80 °C. Preparation of polymerases tC9Y was prepared by in vitro transcription from DNA amplified by PCR. tC9Y strand 1 (5'CCTCAGAGCTTGAGAACATCTTCGGATGCAGAGGAGGCAGCCTTCGGTGGCGCG AGAGCG-3')

and

tC9Y

strand

2

(5'-

CGTCAGGTGTTATCCCCACCCGCGAAGCGGGAGTATTGTGCGTCTGTTGAGAAC GTTGGC-3') were mixed and amplified by PCR. After the purification of the amplified fragment, a second PCR was performed with the fragment, tC9Y strand 3 (5'CTAATACGACTCACTATAGTCATTGAAAAAAAAAAAAAGACAAATCTGCCCTCAGA GCTT-3'),

and

tC9Y

strand

4

(5'-

GGAGCCGAAGCTCCGGGGATTATGACCTTGGCGTGTCTAACATCGCCTTTTCGTC AGGTG-3'). For tC9Y reactions, tC9Y was heated at 80 °C for 2 min and cooled to 17 °C for 10 min immediately before the polymerase activity assay. The RNA extension activity of tC9Y was confirmed by incubation with 0.5 μM RNA primer and 0.5 μM RNA template in 50 mM Tris-HCl (pH 8.0), 100 μM NTPs, 0-250 mM MgCl2, and 0 or 20 wt% PEG200 at 25 °C for 12 h or 48 h (in 2.5 μL total volume). After incubation, 5 μL of the loading solution, consisting of 3x loading dye (1.8% Ficoll PM70, 3.9 mM EDTA, and 0.015% bromophenol blue), 125 mM EDTA, 4.8 M urea, and 2.6 ng/μL competing template, was added and heated at 94 °C for 5 min. The products were separated by denaturing PAGE

6


Page 7 of 41 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

(20% acrylamide, 8 M urea in Tris-borate-EDTA buffer) at 70 °C. The gel images were captured using a Fujifilm FLA-5100 fluorescent imager. The coding sequence of T7 RNAP was mutated using the QuikChange Site-Directed Mutagenesis Kit (Agilent) to prepare a plasmid for the expression of T7 RNAP Y639F. The mutant was expressed in E. coli and purified as described.25 To prepare KF E710A, the coding sequence of KF was amplified from E. coli JM 109 by PCR and cloned into a pMAL-c5x vector (New England BioLabs). Mutation was performed using the QuikChange Site-Directed Mutagenesis Kit. E. coli ER2523 was transformed with the constructed vector. The cells were cultured in LB medium to an A600 of approximately 0.5, followed by the addition of isopropyl β-D-1-thiogalactopyranoside and further culture. Cultured cells were harvested and lysed. The soluble fraction was loaded on the column packed with amylose resin (New England BioLabs). After treatment with the Factor Xa protease, the reactant was purified over a Hitrap Heparin column (GE Healthcare). To confirm the influence of PEG on the structure of T7 RNAP, CD spectra were measured on a J-820 CD spectrometer (JASCO) in 0.5 μM T7 RNAP, 50 mM Tris-HCl (pH 8.0), and 10 mM MgCl2, without PEG or with 20 wt% PEG200 after incubation for 30 min at 25 °C. Polymerase activity assay The polymerases (0.5 μM) were incubated with 0.5 μM FITC-labeled RNA primer and 0.5 μM RNA template in 50 mM Tris-HCl (pH 8.0), 10 mM MgCl2, the indicated NTPs or dNTPs, and the indicated crowding agent at 25 °C for 12 h or 48 h (in 2.5 μL total volume). In the case of T7 RNAP, 5 mM DTT was added. After the incubation, 5 μL of the loading solution, consisting of 3x loading dye, 125 mM EDTA, 4.8 M urea, and 2.6 ng/μL competing template, was added and heated at 80 °C for 5 min. The products were separated by denaturing PAGE (20% acrylamide, 8 M urea in Tris-borate-EDTA buffer)

7


Biochemistry 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 8 of 41

at 70 °C, and bands quantified. The percentage of primers extended was calculated as the fluorescence intensity (LAU/mm2) of the bands of the extended primers divided by the summed fluorescence intensities (LAU/mm2) of all detectable bands. Data for T7 RNAP in the presence of PEG200 are averages of six samples. All the other data are averages of three samples. Errors are standard deviations. To determine the influence of PEGs on the activity of T7 RNAP, T7 RNAP (0.8 μM) was incubated with 0.8 μM FITClabeled RNA primer and 0.8 μM RNA template in 83 mM Tris-HCl (pH 8.0) or in 83 mM Tris-HCl (pH 8.0) with 33 wt% PEG200 at 25 °C for 0 h or 6 h, followed by reactions initiated by the addition of 100 μM UTP. After UTP addition, the reactions included 0.5 μM T7 RNAP, 0.5 μM RNA primer, and 0.5 μM RNA template in 50 mM Tris-HCl (pH 8.0), 10 mM MgCl2, 100 μM NTPs, and 0 or 20 wt% PEG200. Solutions were incubated at 25 °C for 12 h. The extended primers were evaluated by denaturing PAGE. Primer extension activity along the DNA template was completed in the same buffer and substrate conditions, except for using the DNA template instead of the RNA template. Analysis of polymerization of the first nucleotide T7 RNAP (0.5 μM) was incubated with 0.5 μM FITC-labeled RNA primer G, 0.5 μM RNA template A, and different concentrations (1, 10, 100, and 1000 μM) of UTP, dTTP, or dUTP in 0 or 20 wt% PEG200, 50 mM Tris-HCl (pH 8.0), and 10 mM MgCl2 at 25 °C for 0 min, 10 min, 20 min, 60 min, and 12 h. The reactants were analyzed on PAGE, and extended primers were quantified as described above. Analysis of the diffusion rate of the T7 RNAP complex The FITC-labeled primers (0.5 nM) were incubated with 0.5 μM T7 RNAP or 0.5 μM T7 RNAP Y639F, 0.5 μM RNA template, 100 μM each of NTP or dNTP, in 50 mM Tris-HCl (pH 8.0), and 10 mM MgCl2 with 20 wt% PEG200 at 25 °C for 30 min. As controls, the FITC-labeled primers were incubated in the absence of each component. FCS

8


Page 9 of 41 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

(fluorescence correlation spectroscopy) measurements were performed with FCS compact BL (Hamamatsu Photonics). For fluorescence excitation of the FITC-labeled primer, a 7-μW laser at 473 nm was used. Calculation of the diffusion rate of the measured correlation functions was performed using the equipped software (Hamamatsu Photonics). Analysis of the fidelity of DNA polymerization under molecular crowding conditions The polymerases (0.5 μM) were incubated with 0.5 μM RNA primer G and 0.5 μM RNA template A in 50 mM Tris-HCl (pH 8.0), 10 mM MgCl2, with matched (UTP or dTTP) or mismatched NTP or dNTP, and 0 or 20 wt% PEG200 at 25 °C for 12 h. The reactants were analyzed on PAGE, and the extended primers were quantified as described above. Incorporation of 2'-modified nucleotides by T7 RNAP. T7 RNAP (0.5 µM) was incubated with 0.5 µM RNA primer G and 0.5 µM RNA template A in 50 mM Tris-HCl (pH 8.0), 10 mM MgCl2, 100 µM modified nucleotide (2'-F UTP, 2'F TTP, or 2'-OMe UTP) or unmodified nucleotide (UTP, dUTP, or dTTP), and 0 or 20 wt% PEG200 at 25 °C for 12 h. The final concentration of nucleotides was 25 µM. The reactions using RNA templates U, G, and C were also investigated using each matched modified or unmodified nucleotide. In reactions using RNA template A, the samples were diluted 5-fold with solution containing 125 µM NTPs in 50 mM Tris-HCl (pH 8.0), 10 mM MgCl2 without PEG200. The solutions were then further incubated for 12 h. All the products were separated by denaturing PAGE, and bands quantified as described above.

RESULTS

9


Biochemistry 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 10 of 41

Model polymerases for the study of the effect of crowding conditions on nucleic acid polymerization We used three types of polymerases as models of molecules that could have emerged at different evolutionary stages. In the RNA world, it has been suggested that all enzymatic reactions were catalyzed by ribozymes. tC9Y is one of the popular RNA polymerase ribozymes, and therefore a reasonable model of an RNA polymerase in the RNA world.22 As for proteinaceous RNA polymerases, there are single-subunit and multisubunit types. RNAPs in both extant eukaryotes and prokaryotes are mainly composed of multiple subunits. Although the catalytic mechanism of transcription is universal for all RNAPs,26 the structural homology between multi-subunit RNAPs and single-subunit RNAPs is not high. On the other hand, DNAPs have high structural homology with singlesubunit RNAPs, such as T7 RNAP.27 Thus, DNAPs are evolutionarily related not to multisubunit RNAPs, but rather to the single-subunit RNAPs. T7 RNAP is a model single subunit RNAP, because the ancestral RNAP was likely a single subunit28; however, T7 RNAP was not the same as the ancestral RNAP. Based on the hypothesis that the transfer of genetic materials from RNA to DNA happened during the ribonucleoprotein (RNP) world, it is possible that the role of RNAP in this era would have been assumed by DNAP. Although bacteriophages could have emerged after the emergence of LUCA, we considered T7 RNAP to be one of the best models for the investigation of the effect of molecular crowding on RNAP, since the single-subunit RNAP shares catalytic and structural homology. Regarding DNA polymerase, we used KF, an already wellestablished DNAP model that also has high structural homology with T7 RNAP,27 and therefore represents a suitable model to investigate the evolution from the ancestral RNAP.

10


Page 11 of 41 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

Effects of molecular crowding on nucleotide polymerization by ribozymes To analyze reactivity, a primer extension assay was performed using 39-mer RNA strands as templates and fluorescein isothiocyanate (FITC)-labeled 10-mer RNAs as primers (Figure 1 and Table S1).22 To unify the reaction conditions for each enzymatic reaction, all reactions were carried out as follows: Polymerase (0.5 μM) was incubated with 0.5 μM FITC-labeled RNA primer G (complementary to the template), 0.5 μM RNA template A, and 100 μM NTPs or dNTPs in 50 mM Tris-HCl (pH 8.0) and 10 mM MgCl2 at 25 °C for 12 h. Reactions were performed in 0-20 wt% ethylene glycol (EG), poly(ethylene glycol) 200 (PEG200; average molecular weight 200), or poly(ethylene glycol) 8000 (PEG8000; average molecular weight 8000). Reactants and products were separated by means of denaturing PAGE, and bands corresponding to extended primers and unreacted primers were quantified by measuring fluorescence intensity. Polymerization (5’ → 3’ direction)

RNA Prime G RNA template X

5’-FITC-CUGCCAACCG 3’-(A10)GACGGUUGGCXCGCUUCGCACAGUAACUG-5’

Figure 1. Sequences of the template and primer RNAs used in the assay. In the template, X was either A, C, G, or U. Templates were named based on the identity of X (Table S1). Figure 1. Sequences of the template and primer RNAs used in the assay. In the

template, X was either A, C, G, or U. Templates were named based on the identity of X (Table S1). RNA-dependent RNA synthesis by tC9Y was performed in the absence of the crowding reagents in the buffer conditions described and only 3.3% of the primers were extended (Figures 2a and b). On the other hand, in the presence of PEG200, the reaction was clearly facilitated, and the fraction of extended primers increased with increasing PEG200 concentration (Figures 2a and b). At 20 wt% PEG200, 87% of the primers were

11


Biochemistry 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 12 of 41

Figure 2. RNA and DNA polymerization in 0-20 wt% PEG200. (a) Analysis of primer extension by tC9Y by denaturing PAGE. (b) Percentage of primers extended by tC9Y. (c) Analysis of primer extension by T7 RNAP by denaturing PAGE. (d) Percentage of primers extended by T7 RNAP. (e) Analysis of primer extension by KF by denaturing PAGE (f) Percentage of primers extended by KF. For PAGE analyses, the conditions were: Lane 1, unreacted primer; Lane 2, 0 wt% PEG200 with NTPs; Lane 3, 5 wt% PEG200 with NTPs; Lane 4, 10 wt% PEG200 with NTPs; Lane 5, 15 wt% PEG200 with

12


Page 13 of 41 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

NTPs; Lane 6, 20 wt% PEG200 with NTP; Lane 7, 0 wt% PEG200 with dNTPs; Lane 8, 5 wt% PEG200 with dNTPs; Lane 9, 10 wt% PEG200 with dNTPs; Lane 10, 15 wt% PEG200 with dNTPs; Lane 11, 20 wt% PEG200 with dNTP; Lane 12, unreacted primer. Positions of products (n+1, 2, 3, 4, 5, or 6, where n is the primer length) are indicated. In graphs, percentage of primers extended in reactions with NTPs is indicated in green, and percent extension in reactions with dNTPs is indicated in blue. Conditions were: 0.5 μM T7RNAP, 0.5 μM RNA primer G, 0.5 μM RNA template A with 100 μM NTPs in 0-20 wt% PEG200, 50 mM Tris-HCl (pH 8.0), and 10 mM MgCl2 at 25 °C for 12 h. Percentage of primers extended was determined by dividing the fluorescence intensity (LAU/mm2) of the bands of extension products by the summed fluorescence intensities (LAU/mm2) of all detectable bands. Data points are averages of three samples. Errors shown are the standard deviations.

extended, and up to six NTPs were polymerized. Although tC9Y activity requires greater than 200 mM Mg2+ concentrations for efficient activity,2 we found that the processivity of tC9Y in the presence of 250 mM MgCl2 was rather lower than that in the presence of both 10 mM MgCl2 and 20 wt% PEG200 (Figure S1). Thus, 10 mM MgCl2 was a sufficient Mg2+ concentration in the crowding condition and appropriate for the study of the effect of molecular crowding on activity. With dNTPs as substrates, little extension was observed in the absence of PEG200, which is in agreement with a low level of dNTP polymerization by a deep precursor of tC9Y being only a ligase, as reported previously 29.

Extension of dNTPs was enhanced in 20 wt% PEG200, with 82% of primers extended.

At most, two nucleotides were added to the primer under these conditions after 12 h, and also after 48 h (Figure S2). Thus, the processivity of tC9Y when using dNTPs as substrates was lower compared to that of using NTPs as substrates. The percentage of primers extended using either NTPs or dNTPs as substrates increased with the

13


Biochemistry 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 14 of 41

concentration of EG (Figure S3a), but a lower fraction of primers were extended in EG than in the presence of PEG200. The larger cosolutes more effectively increased the excluded volume effect, which stabilizes compactly folded conformations, such as that of the active form of tC9Y.30 Furthermore, decreases in the dielectric constant induced by larger cosolutes likely enhanced the attractive electrostatic interactions between tC9Y and nucleotides. PEG8000 also activated primer extension with both NTPs and dNTPs to degrees comparable to those in the presence of similar concentrations of PEG200 (Figure S3b). In addition to its effects on the enzyme, PEGs decrease the stability of RNA helices, which could decrease the efficiency of primer extension.30 Thus, the tC9Y ribozyme displays bisubstrate specificity in the polymerization of RNA and DNA with different efficiencies, depending on the molecular environment. This in turn implies that ribozyme RNA polymerase could not have acted as a DNA polymerase to distinguish NTPs in the course of evolution.

Effects of molecular crowding on nucleotide polymerization by proteinaceous polymerase Next, we investigated the effects of cosolutes on RNA-dependent primer extension catalyzed by a proteinaceous polymerase of T7 RNAP in the buffer containing 50 mM Tris-HCl (pH 8.0) and 10 mM MgCl2. In the absence of cosolutes, 45% of primers were extended with NTPs as substrates, and more than nine NTPs were polymerized (Figures 2c and d). The smeared bands may indicate fully extended products with variation in the length and the sequence of the 3′ end, because T7 RNAP can stop polymerization aberrantly at the end of the template and cause longer products than expected under normal conditions.31 In 10 wt% PEG200, the percentage of primers extended was similar to that in the reaction without PEG200. In the presence of 20 wt% PEG200, however,

14


Page 15 of 41 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

only 23% of primers were extended. In contrast, with dNTP substrates, the fraction of primers extended increased with increasing concentration of PEG200. In the absence of PEG200, 13% of primers were extended, whereas in 20 wt% PEG200, 69% of primers were extended, although the maximum processivity in 20 wt% PEG200 using dNTPs as substrates was 3 nucleotides even after a 48 h reaction time (Figure S2). The small reduction of RNA synthesis activity and the promotion of DNA synthesis by PEG200 may result from the effects of the cosolute on the conformation of T7 RNAP, from the dissociation of the complex containing T7 RNAP, primer, template, and nucleotides, and/or from changes in substrate selectivity. PEG200 does not denature T7 RNAP, as shown by circular dichroism analysis (Figure S4). Furthermore, pre-incubation of T7 RNAP with PEG200 prior to the initiation of the reaction did not alter product amounts (Figure S5). We also confirmed that there was no contamination of other enzymes in the solution of T7 RNAP by the reaction in the presence of an excess amount of DNA duplexes containing the T7 promoter sequence (Figure S6). These results suggest that a cosolute has an important effect on the substrate selectivity of the enzyme. To evaluate the effects of the crowding reagent on substrate specificity of T7 RNAP, we performed RNA and DNA syntheses using the T7 RNAP mutant Y639F, in which Tyr 639 of T7 RNAP is mutated to Phe. Replacement of Tyr 639 with phenylalanine abolishes the ability of the enzyme to discriminate between NTPs and dNTPs, because of the loss of the interaction between Tyr 639 and the 2′-OH of NTPs, mediated either through H2O or Mg2+ ions.32 T7 RNAP Y639F polymerized NTPs and dNTPs equally well in diluted solutions but the nucleoside monophosphate (NMP) incorporation was affected by PEG200 just as was the wild-type polymerase (Figure S7). This suggests that changes in discrimination enabled by Tyr 639 did not cause the activity changes observed in the presence of PEG200. Additionally, the substrate specificities using a DNA template or DNA primer (both had identical sequences as the RNA template and RNA primer) were

15


Biochemistry 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 16 of 41

tested (Figure S8). Although a DNA template is a common substrate for T7 RNAP, neither the reduction of the RNA polymerization (93% of primers in the absence of PEG200 and 96% of primers in the presence of 20 wt% PEG200 were extended) nor the stimulation of DNA polymerization (57% of primers in the absence of PEG200 and 61% of primers in the presence of 20 wt% PEG200 were extended) were observed with the addition of PEG200 (Figure S8a). In the case of the reaction started from DNA primer G directed by RNA template A, the RNA polymerization occurred with or without PEG200 (94% of primers in the absence of PEG200 and 97% of primers in the presence of 20 wt% PEG200 were extended). On the other hand, the stimulation of DNA polymerization by PEG200 (8.3% of primers in the absence of PEG200 and 72% of primers in the presence of 20 wt% PEG200 were extended) was observed, as well as in the case using the RNA primer and the RNA template (Figure S8b). These results suggest that the changes in the substrate specificity of T7 RNAP by PEG200 occur in the reaction directed by an RNA template and require an RNA primer particularly for the effect on the reduction of RNA polymerization. Interestingly, cosolute size more strongly influenced the extension by T7 RNAP than the extension by tC9Y (Figures S3c and d). Increasing the concentration of EG increased the fraction of primers extended with both NTPs and dNTPs by T7 RNAP, whereas increasing the concentration of PEG8000 decreased product formation with both substrates. Because both crowders decreased the dielectric constant, the different directions of these trends possibly occurred because of the difference in the strength of the excluded volume effect, which might influence the dynamics of the active site. We assume that PEG200 has a sufficient molecular size to repress RNA polymerization but not to repress DNA polymerization. The difference in the balance of the acceleration and repression effect for RNA or DNA polymerization by molecular crowding is at the point where EG and PEG8000 did not show a specificity change of T7 RNAP. From these

16


Page 17 of 41 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

results, we found that T7 RNAP possesses bisubstrate specificity in RNA and DNA polymerizations, whose preference is adjustable in a certain crowding condition. Therefore, RNAPs such as T7 RNAP are able to recognize dNTPs to polymerize in this crowding condition and act as a DNA polymerase, which might have occurred in the evolutionary process during the transfer of genetic materials from RNA to DNA. RNA-dependent DNA extension from an RNA primer by proteinaceous polymerase KF was enhanced by PEG200 in the buffer containing 50 mM Tris-HCl (pH 8.0) and 10 mM MgCl2 (Figures 2e and f). In the absence of PEG200, 67% of primers were extended with dNTPs as substrates. In 20 wt% PEG200, 93% were extended. In contrast, extension was not observed with NTPs as substrates under any conditions. To investigate the mechanism of PEG200-mediated enhancement, we analyzed KF E710A, in which the Glu 710 side chain of KF, which acts as a steric gate to prevent the entry of NTPs into the substrate binding pocket,33 is mutated to Ala. PEG200 enhanced NTP polymerization by the mutant KF (Figure S9). Cosolutes EG and PEG8000 had little effect on the activity of KF (Figures S2e and f). These results suggest that the enhanced catalytic activity of KF observed in PEG200 is likely caused by the stabilization of the tertiary structure of KF and the electrostatic interactions necessary for substrate recognition. As the substrate specificity of KF was strictly opposed to changes in the crowding conditions, DNAPs, such as KF, could have become established DNA polymerases following their evolution from a proteinaceous RNAP induced by a crowding condition.

T7 RNAP forms an inactive complex during RNA elongation in the presence of the cosolute To understand the unique effect of crowding on the activities of T7 RNAP, we analyzed the polymerization of the first nucleotide at different concentrations of the initial

17


Biochemistry 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 18 of 41

nucleotide (1, 10, 100, and 1000 μM). T7 RNAP (0.5 μM) was incubated with 0.5 μM FITC-labeled RNA primer G, 0.5 μM RNA template A, and UTP, dTTP, or dUTP in 0 or 20 wt% PEG200, 50 mM Tris-HCl (pH 8.0), and 10 mM MgCl2 at 25 °C for 12 h. The dependencies of primer extension on substrate concentration were similar in the absence and presence of PEG200 (Figure S10). In the absence of PEG200, increased dTTP and dUTP concentrations increased the amount of the extended primer (3.9, 12, 29, and 61% for dTTP, and 4.6, 7.5, 22, and 45% for dUTP at the concentration of nucleotide of 1, 10, 100, and 1000 μM, respectively), whereas the amount of the extended primer decreased with increased UTP concentration (75, 53, and 27% at the concentration of UTP of 10, 100, and 1000 μM, respectively, except between 1 and 10 μM UTP). These results suggest that the 2′-OH of UTP was the cause of substrate-mediated inhibition at increased concentrations. As for the absolute amount of primers extended, the addition of 20 wt% PEG200 slightly increased the amount of the extended primer with dTTP or dUTP (15, 36, 77, and 80% for dTTP, and 6.9, 17, 51, and 60% for dUTP at nucleotide concentrations of 1, 10, 100, and 1000 μM, respectively), although the amount of the extended primer decreased with increased UTP concentration. These trends were similar to effects on DNA synthesis by tC9Y and were likely caused by the decrease in dielectric constant in the presence of PEG200. In contrast, PEG200 decreased primer extension in the presence of UTP compared to the amount of primer extended in the absence of PEG200. Therefore, PEG200 enhanced DNA synthesis but did not promote RNA synthesis because of substrate-mediated inhibition by UTP at the site of UMP incorporation. For efficient polymerization, the polymerase should quickly bind to and dissociate from the primer-template duplex. Thus, the substrate inhibition of T7 RNAP by UTP might lead to the formation of an inactive complex that is likely stable. We used fluorescence correlation spectroscopy (FCS) to monitor the diffusion time of the FITC-labeled primer

18


Page 19 of 41 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

under various reaction conditions to detect complex formation. The complex with UTP should include the template and Mg2+. In the absence of PEG, the diffusion time of this complex was 0.22 ms (Figure 3a and Table S2), almost the same as the diffusion time in the presence of each of the other NTPs or dNTPs, as well as that of other control experiments without the template, MgCl2, or nucleotides (Figures S11a and b, and Table S2). On the other hand, in the presence of 20 wt% PEG200, the complex had a diffusion time of 11 ms, whereas in the presence of each of the other NTPs or dNTPs and appropriate complementary templates, the diffusion time was roughly 0.5 ms (Fig. 3b, Table S2, and Figures S11c and d). These results suggest that the lifetime of the complex is shortened when NTPs or dNTPs are actively being polymerized. Therefore, the long diffusion time in the presence of both UTP and PEG200 indicates that an unusual and stable complex was formed, which inactivated the polymerization of T7 RNAP. The diffusion time of T7 RNAP Y639F in the presence of UTP and PEG200 (14 ms) was also suggestive of the formation of an unusual complex (Table S2, and Figures S11e and f). The unusual complex of T7 RNAP Y639F in the presence of PEG200 is likely stabilized by interaction of the 2′-OH of UTP in the substrate binding pocket. Unlike T7 RNAP, tC9Y has no binding sites for the Mg2+ ion, other than that for the catalytic Mg2+ ion,34 and KF has no room for the insertion of additional nucleotides after one nucleotide is inserted into the substrate binding pocket.33 Consequently, tC9Y and KF did not form inactive complexes, resulting in a lack of substrate inhibition by UTP.

19


Biochemistry 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 20 of 41

Figure 3. Normalized correlation functions. Correlation functions were determined from fluorescence correlation spectroscopy (FCS) experiments with 5 nM FITC-labeled primer, 0.5 μM T7 RNAP, 0.5 μM RNA template A without any substrate (red), with 100 μM UTP (green), or with 100 μM dTTP (blue) in 50 mM Tris-HCl (pH 8.0), and 10 mM MgCl2 at 25 °C for 30 min (a) without PEG200 and (b) with 20 wt% PEG200. The data (doted plots) were analyzed by autocorrelation function as shown by the fitting curves.

Molecular crowding enhances fidelity of DNA polymerization by T7 RNAP During the polymerization of RNA and DNA, error frequencies are as important as the elongation efficiency. To assess them, we evaluated the effect of molecular crowding on the polymerization of matched and mismatched nucleotides in the first position of the product with the RNA template A in the buffer containing 50 mM Tris-HCl (pH 8.0) and 10 mM MgCl2. In the presence of 20 wt% PEG200, tC9Y was more efficient in adding both matched and mismatched NTPs, and certain dNTPs to the RNA primer G, than in its absence (Figure 4a). Enhanced electrostatic interactions between the 2′-OH and the substrate binding site in the presence of 20 wt% PEG200 resulted in the polymerization of mismatched NTPs. The polymerization of dGTP likely occurred because of the

20


Page 21 of 41 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

thermodynamic stability of the G·A mismatch.35 For T7 RNAP, the polymerization of template-complementary UTP was observed at higher levels in the absence of 20 wt% PEG200 than in its presence, and mismatched NTPs were also polymerized at higher levels in 20 wt% PEG200 (Figure 4b). The polymerization of the template-complementary dTTP was facilitated at 20 wt% PEG200, whereas the polymerization of mismatched dNTPs was not significant. Therefore, molecular crowding enhanced the accuracy of the DNA polymerization of T7 RNAP. In the case of KF, the presence of 20 wt% PEG200 increased the percentage of primers extended, and no mismatched nucleotides were polymerized (Figure 4c). These results indicate that KF robustly polymerizes dNTPs in different molecular environments, and that tC9Y flexibly accepts both matched and nonmatched dNTPs. Therefore, only the specificity of T7 RNAP can be altered by changing molecular environments, which should prevent RNA replication and DNA replication processes from occurring simultaneously.

21


Biochemistry 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 22 of 41

Figure 4. Efficiency of polymerization of one nucleotide. Percentage of primers extended by (a) tC9Y, (b) T7 RNAP, and (c) KF are plotted. The polymerases (0.5 μM) were incubated with 0.5 μM RNA primer G, 0.5 μM RNA template A, and each substrate in 50 mM Tris-HCl (pH 8.0) and 10 mM MgCl2 at 25 °C without PEG (white) or with 20 wt% PEG200 (black) for 12 h.

Enzymatic synthesis of RNA oligonucleotides containing 2′-modified substrates by T7 RNAP In the course of transition of molecular environment, the substrate specificity should gradually transform between RNA-preferred and DNA-preferred activity, which results in production of chimeric oligonucleotides containing RNA and DNA. To demonstrate the

22


Page 23 of 41 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

synthesis of chimeric oligonucleotides, we first investigated attachment of dTTP to an RNA primer in 20 wt% PEG200 and 10 mM MgCl2. We then added NTPs and evaluated formation of the product containing dTMP (Figure 5a). Because 20 wt% PEG200 reduced the activity of UTP polymerization caused by the formation of the inactive substrateenzyme-complex, we diluted the reaction mixture to decrease the concentration of primer (0.1 µM) and template (0.1 µM) and used an NTP concentration of 25 µM. This procedure should disrupt the inactive complex and prevent generation of further inactive complexes during RNA elongation. As a result, dTMP was incorporated as a first nucleotide and PEG200 promoted the formation of longer products (Figures 5b, 5c and S12). Although we cannot exclude that the unreacted primers at the first step were also elongated more than 1 nt, the intensity of the band corresponding to a single nucleotide polymerization clearly decreased after the second step compared to that of the first step with both dTTPs as substrates. This result indicated that the changes in molecular crowding reversibly regulate the substrate specificity of T7 RNAP during the polymerization of oligonucleotides, which could happen in the process of evolution. This environmental dependency suggested that T7 RNAP might synthesize RNA oligonucleotides containing 2′-modified substrates under certain conditions. From the viewpoint of biotechnological application, chimeric RNAs containing residues modified at the 2′-modified position are used as research tools and as therapeutic agents because of high affinity for complementary target sequences and stability against endogenous nucleases in cells.36 In particular, 2′-fluoro (2′-F) residues significantly improve affinity and stability and have been used in ribozymes, aptamers, and oligonucleotides for RNA interference.36-40 Then, we next attempted to incorporate the non-natural 2-modified RNA. Whether 2′-F UTP or 2′-F TTP were used at the first step, PEG200 promoted the formation of longer products (Figures 5b, 5c and S13). The efficiency of 2′-F UTP polymerization at the first

23


Biochemistry

(a)

(b)

T7 RNAP Primer G Template A 1st step

G CAC

dTTP

2’-F UTP

2’-F TTP

1 2 3 4

1 2 3 4

1 2 3 4

dTTP, 2’-F UTP or 2’-F TTP GdT CAC

2nd step

ATP, CTP, GTP, and GTP GdTG CAC

(c)

(d)

Reduced amount of 1 nt extended primer (%)

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 24 of 41

100 80 60 40 20 0

dTTP

2'-fluoro UTP 2'-fluoro TTP

(e)

Figure 5. Generation of chimeric RNA containing 2′-F NTPs by T7 RNAP. (a) Schematic illustration of protocol. (b) Denaturing PAGE analysis of products extended in the presence of dTTP (left), 2′-F UTP (middle), and 2′-F TTP (right): Lane 1, unreacted primer G and reference oligonucleotide; Lane 2, products after step 1 in 0 wt% PEG200; Lane 3, products after step 1

24


Page 25 of 41 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

in 20 wt% PEG200; Lane 4, products after step 2. (c) Percent of primers extended in the first step. In these graphs, percent of primers extended in 0 wt% PEG200 with 2′-modified nucleotide is indicated in light blue, percent of primers extended in 20 wt% PEG200 with 2′-modified nucleotide is indicated in blue, and percent extension of RNA extended product after the elongation in 20 wt% PEG200 with 2′-modified nucleotide is indicated in green. (d) Percent of further extension at the second step from the product of 1 nt primers extended in the presence of 20 wt% PEG200. (e) Percent of primers extended in the first step using various combinations of templates and substrates. In these graphs, percent of primers extended in 0 wt% PEG200 with 2′-modified nucleotide is indicated in light blue, and percent of primers extended in 20 wt% PEG200 with 2′-modified nucleotide is indicated in blue.step was lower than the efficiency of

polymerization of dTTP or 2′-F TTP. As observed in Figure S8, uridine is not a canonical base of DNA. Thus, 2′-F UTP did not act as a good substrate. At the second step, longer products were detected (Figure 5d). This indicated that under molecular crowding conditions, T7 RNAP can synthesize chimeric RNA containing 2′-F NTPs, which are not normally substrates of T7 RNAP, and RNA elongation occurred from the termini of 2'modified nucleotides at the second step. Further, we investigated other combinations of templates and substrates, including well-known 2′-OMe modified nucleotides (Figures 5e and S13). As observed in the FCS results, the polymerization of unmodified NTPs, except for UTP, showed a little enhancement by the addition of 20 wt% PEG200. In the case of polymerization of 2′-modified nucleotides (dNTPs, 2′-F NTPs, and 2′-OMe NTPs), all the cases reflected enhancement of polymerization in the presence of 20 wt% PEG200. In particular, 2′-F CTP, 2′O-Me CTP, dGTP, 2′-F GTP, 2′-OMe GTP, dUTP, 2′OMe UTP, dTTP, and 2′-F TTP showed almost or more than two-fold efficiency of polymerization compared to those in the absence of PEG200.

As maximum three dNMPs were consecutively incorporated by T7 RNAP (Figure 2c), it

25


Biochemistry 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 26 of 41

is possible that a few 2′-OH modified nucleotides were extended in the first step. Under the conditions used with template A, primers with dT, dTdG, and dTdGdC at the 3′ termini could be extended with NTPs (Figure S14). Therefore, the method developed here enables synthesis of chimeric oligonucleotides having a few consecutive 2′-OH modified nucleotides.

DISCUSSION Molecular crowding has a significant effect on the properties of biomolecules because of changes in conditions such as the water activity, dielectric constant, and excluded volume. In this study, we found that T7 RNAP does not prefer to incorporate UMP in the presence of a high concentration of PEG200, whereas the polymerization of dNTP did occur, and moreover, was accelerated with increasing PEG200. We surmise that both the effects of PEG200 on RNA and DNA polymerizations of T7 RNAP could be reasonably explained by the biophysical effects of molecular crowding. For example, a decrease in the dielectric constant of the solution perturbs the RNA-RNA interaction between mRNA and tRNA and decreases the fidelity of translation as well as RNAdependent RNA polymerization.41 Because the decrease in dielectric constant influences the electrostatic interactions between substrates and the active site of T7 RNAP, the fidelity could be affected by PEG200. In addition, it has been reported that the dynamics of the tertiary structure of RNA in the presence of PEG200 was different from that in the absence of PEG200 because of the direct interaction of PEG200 and effect of the excluded volume.42 Although CD results showed that the obvious structural changes were not identified, the local dynamics of the structure of the active center could be affected, which might result in the transformation of T7 RNAP to the DNA polymerase. Molecular crowding can regulate enzymatic reactions, but the effect of molecular

26


Page 27 of 41 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

crowding on the fidelity of enzymatic reactions has not been reported to date. Therefore, our finding can bring a new dimension to the field of molecular crowding. The possible mechanism of the transformation of the activity of T7 RNAP from an RNA polymerizing enzyme to a DNA polymerizing enzyme can be inferred from the analysis of its tertiary structure, determined by X-ray crystallography as follows.26 In a diluted solution, T7 RNAP initially captures NTPs via ionic interactions with basic amino acids Arg627 and Lys631, which are located near the active site in the substrate-binding pocket (Figure 6a). The substrate-polymerase complex is then stabilized by a base-pairing interaction with the template in the “initial binding position.” A conformational change coordinates the Mg2+ ion with Asp537 and Asp812 to bind NTPs in the “Mg2+ binding position” (Figure 6a). The reaction with dNTPs as substrates is not preferred because of the lack of interaction between the substrate 2′-OH of and the hydroxyl group of Tyr639 (Figures 6a and b). It is thought that PEG200 facilitates the formation of the inactive complex of T7 RNAP by UTP and the incorporation of dNMPs because of the decrease in the dielectric constant caused by the addition of this polymer. Because UTP caused substrate-induced inhibition, it is possible that the lower dielectric constant in the presence of PEG200 stabilized the electrostatic interaction between T7 RNAP and UTP, which resulted in the binding of UTP to both the initial binding position and the Mg2+ binding position (Figure 6c). Moreover, the excluded volume effect might perturb the structural dynamics of the active site, which allows the simultaneous binding of UTP to both binding positions. The stabilization of the electrostatic interaction between T7 RNAP and dNTPs might enable T7 RNAP to recognize dNTPs without an interaction with the 2′-OH (Figure 6d). According to established evolutionary hypotheses, the precursors of an enzyme could have been less specific than current enzymes, which evolved to possess higher specificities.43 Based on this hypothesis, it is reasonable that tC9Y and T7 RNAP, which

27


Biochemistry 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 28 of 41

Figure 6. Effects of crowding conditions and nucleotide substrates on T7 RNAP. (a) In a diluted solution, the phosphate of UTP initially binds basic amino acids (Arg627 and Lys631) and 2'- OH contacts Tyr639. Simultaneously, a base pair forms with the template, followed by a conformational change that results in interactions with Mg2+ ion. (b) In a diluted solution, dTTP does not bind to T7 RNAP with sufficient stability for the conformational change to occur. (c) In solution with PEG200, UTP acts as the substrate inhibitor; PEG200 stabilizes an inactive conformation in the binding site. (d) In solution with PEG200, dTTP binds to T7 RNAP with sufficient stability to allow polymerization to occur because of enhancement of electric static interactions. T7 RNAP, template, primer, Mg2+, UTP, and dTTP are shown in light blue, magenta, red, orange, green, and blue, respectively. Vicinities of expected electrostatic interactions are shown in red in figures on top, which were drawn using CUEMOL software. T7 RNAP structure before the conformational change was taken from PDB ID 1S0V. Orientation of Mg2+ in the putative inactive complex before the conformational change was determined from PDB ID 1S76. NTPs and dNTPs were substituted for NTP in PDB data files. The additional inserted substrate was placed in a sterically feasible orientation.

28


Page 29 of 41 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

were models of a precursor polymerase, displayed bisubstrate specificity in RNA and DNA polymerizations. Some proteins are indeed known to be characterized by bisubstrate specificity.44, Mycobacterium

45

PriA, an isomerase for histidine/tryptophan biosynthesis in

tuberculosis,

displays

bisubstrate

specificity

by

active

site

metamorphosis, in which the arrangement of the active site is dynamic, but the key residues in the active site are shared.44 Specificity can be interconverted by directed evolution to create mutated enzymes.46 Interestingly, the specificity of PriA from Mycobacterium tuberculosis could be induced by the addition of small molecules as specific inhibitors in the active site.44 These characteristics resemble the bisubstrate specificity of T7 RNAP induced by PEG200. As PEG200 causes structural perturbation of the biomolecular structure,42 molecular crowding can induce active site metamorphosis. Currently, there have been no other reports of conversion of enzymatic bisubstrate specificity by crowding agents. However, the results in this study imply that crowding environments could promote active site metamorphosis of precursor enzymes and specialization to express either substrate specificity. Our findings suggest that during the evolution of enzymes from precursors with broad specificity, there might have been intermediate precursors exhibiting a switchable bifunctional activity that was regulated by chemical perturbation such as crowding environments. It has been suggested that molecular crowding has greatly impacted the evolution of biological systems.10-14, 16-18 During the process of evolution leading to the emergence of cells, phase separation in an aqueous solution has been considered as not only a means of compartmentalization in prebiotic cells but also as a means for the encapsulation of prebiotic enzymes. For example, ribozyme-catalyzed reactions have been shown to occur within encapsulated, eutectic ice phases,47, 48 membrane-bound lipid vesicles,15, 4951

and membrane-free compartments based on polyethelene glycol (PEG)/dextran

aqueous two-phase systems (ATPS).16 RNA catalysis within these compartments

29


Biochemistry 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 30 of 41

exhibits an increased rate of reaction as a result of an increased concentration due to the volume exclusion effect. This effect is beneficial for the concentration of prebiotic enzymes, which exist in a very small amount in a prebiotic aqueous solution. Another benefit of this phase separation is that the partition coefficient of different aqueous phases triggers the separation of DNA and RNA molecules based on molecular weight, which promotes the catalysis of the reaction.50, 52 Interestingly, this compartmentation accelerated the Darwinian evolution of ribozymes.47, 53 In cases where the protein itself acts as a medium for phase separation, it has been demonstrated that compartmentation enhances gene expression54 and facilitates the evolution of DNA polymerase for improved structural stability.55 Since the effect of volume exclusion by phase separation generally improves the kinetics of enzymatic reactions to facilitate the binding of enzymes to their substrates, the results in this study that show an acceleration of all the enzymatic reactions by PEGs with higher molecular weights make sense. The properties of the solution with cosolutes such as osmolytes and crowders also drastically alter the structures of the enzymes and, thereby, their functions. These compounds affect RNA and protein structures due to physical properties such as the effects of water exclusion from the target, direct interaction with the target, and volume exclusion from the target. The effect of osmolytes and crowders on the efficiency of structural folding of RNAs and proteins differs, because the folding processes of RNAs and proteins require the exclusion of water to allow them to adopt the most stable folded structural cores.56 In the case of RNAs, the formation of secondary and tertiary structures is facilitated by osmolytes.10,

13

For example, the E.coli 23S ribosomal RNA (rRNA)

contains many chemical modifications on its RNA bases and these are required for the efficient folding of the ribosome; these chemical modifications were likely a result of evolution. The folding of rRNA without these modifications does not occur efficiently; however, trimethylamine-oxide (TMAO) recovers the folding efficiency, implying the

30


Page 31 of 41 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

importance of this osmolyte in the process of the molecular evolution in the RNA world. In another example, urea, which is a general denaturant of RNAs and proteins, facilitates the folding of the Tetrahymena group I ribozyme by minimizing the effects of stable folding intermediates.57 Proteins are often stabilized by polyols such as glycerol, sorbitol, and mannitol.58,

59

Crowders stimulate the formation of compact and folded RNA and

protein structures, by particularly affecting the conformation of enzymes.11 Thus, crowders could have led to the generation of higher activity enzymes in protocells. Indeed, although crowders such as high molecular weight PEGs destabilize the secondary structure of ribozymes by decreasing water activity, the enzyme activities are facilitated through the stabilization of the tertiary structures of enzymes by decreasing dielectric constants and the effect of excluded volume.30 The structural stability of protein enzymes is often enhanced by such crowders due to the excluded volume effect.11, 60 The activities of protein enzymes are also affected by crowders.61, 62 For example, a phosphoglycerate kinase needs a large movement of the cleft motif for enzymatic reaction, which is enhanced by crowders.62 Furthermore, it has been reported that the catalytic rate constant of the trypsin-catalyzed hydrolysis of a non-natural substrate ester decreases depending on the decrease in dielectric constants by crowders.63 Therefore, osmolytes and crowders influence the stability and dynamics of the enzyme structure and the chemistry of the catalytic center of the enzyme, which could be beneficial for the evolution of various macromolecules. Based on these contexts, our findings on the effect of molecular crowding on the polymerase reactions studied are in line with previous results and imply the evolutional origin of these polymerases. Osmolytes and crowders can change multiple physical factors in solution as shown above. Thus, the effects of osmolytes and crowders on biomolecules are not uniform. Importantly, the substrate specificity of T7 RNAP was switchable in response to changes in the dielectric constant and excluded volume effect in the solution containing PEG200. This study is the first to suggest an impact of multiple and simultaneous physical effects on biomolecules in the

31


Biochemistry 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 32 of 41

historical context of molecular evolution. Although it has not yet been established that PEG-like molecules existed in the prebiotic world, our findings on the effect of molecular crowding on biomolecules are in line with previous reports. Our results may generate novel insights into molecules that may regulate substrate specificity of a single-subunit RNAP and thereby contribute to evolutionary transition from an RNP world to a DNA world. Genes encoding singlesubunit RNAPs, such as T7 RNAP, are found in some phages (phage-encoded), in mitochondrial DNAs (nucleus-encoded), and in plasmids carried by some plants (plasmid-encoded).64 A phylogenetic study revealed that these T7-like RNAPs share a common ancestor, and that DNA polymerases and reverse transcriptases evolved from this polymerase.20,

65

A DNA replication system was likely established after the

compartmentalization of genetic materials.19,

20

During evolution, the concentration of

cosolutes increased dramatically because of this compartmentalization

15

and the

accompanying increases in concentrations of organic compounds.17, 18 Recent studies suggest that the crowding environment compartmented by coacervates might have been the locus of protocells51,

52, 66

where enzymatic reaction including RNA catalysis and

transcription were facilitated.16, 51, 67, 68 Thus, the molecular-crowding-induced transfer of genetic information storage from RNA to DNA might have happened in the prebiotic world by means of single-subunit RNAP. In the present study, the model of RNA and DNA polymerizations was based on the primer extension model along with the template oligonucleotide. Because the normal transcription of T7 RNAP begins with the recognition of a promoter sequence, the primer extension model is completely different from the current reaction mechanism of T7 RNAP. We hypothesized that the ancestral RNAP likely had DNA polymerization activity that could be “awakened” in T7 RNAP under conditions mimicking the ancestral environments using PEGs. Interestingly, the singlesubunit RNAP from mitochondria, such as T7 RNAP, also carries out transcription that

32


Page 33 of 41 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

does not depend on a promoter.69 Therefore, the ancestral single-subunit RNAP may have made oligonucleotides for various purposes, and potentially catalyzed the DNA polymerization under various molecular environments before DNA polymerases existed. To engineer enzymes with non-natural properties, strategies based on Darwinian evolution are often employed; essentially proteins with desired properties are selected from a pool or randomly mutated enzymes.70 For example, T7 RNAP Y639F catalyzes transcription with non-canonical dNTP substrates, although it does not accept 2′-F modified NTPs very well.71 On the other hand, the present study identifies the ability of the T7 RNAP wild type to polymerize DNA and modified RNA. If our hypothesis about transformation of the substrate specificity is true, our approach demonstrated the reverse evolution of T7 RNAP by mimicking the prebiotic condition and activated the “hidden” activity of T7 RNAP that was used in the prebiotic era. We assume that the reason why the wild-type T7 RNAP could synthesize oligonucleotides having 2′-F and 2′-OMe modified NTP in the crowding condition is because of a different reaction mechanism from normal transcription, which might have been used in the reaction in the prebiotic era. Our approach is based on primer extension mechanism. Although the precise mechanism of primer extension is not available, the unique structure of the active site for primer extension mechanism may be more influenced by the cosolute than that in normal transcription, which permitted non-mutated T7 RNAP to synthesize non-natural nucleotides. Because we did not mutate any residues of T7 RNAP, this approach can be a novel technique to alter the enzymatic activities. The novel approach developed in this study is applicable to the synthesis of modification-rich oligonucleotide libraries that are valuable for the development of novel nucleic acid-based drugs. Bioinformatics is a powerful tool to guide incorporation of amino acid changes that alter the functions of enzymes. The effects of molecular conditions on biomolecules can also be analyzed by simulation techniques. Thus, the combination of bioinformatics and our approach may

33


Biochemistry 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 34 of 41

provide a useful methodology rationally altering the functions of enzymes.

Conclusion We investigated the activities of the RNA-dependent RNA and DNA polymerizations by tC9Y, T7 RNAP, and KF in the presence of crowding agents. In the crowding conditions, T7 RNAP displayed bisubstrate specificity similar to evolutionarily older (precursor) enzymes. In particular, PEG200 promoted RNA polymerization by tC9Y, and DNA polymerization by tC9Y, T7 RNAP, and KF. In contrast, PEG200 reduced the activity of RNA polymerization by T7 RNAP. T7 RNAP displayed bisubstrate specificity similar to evolutionarily older (precursor) enzymes by promoting substrate inhibition by UTP. Additionally, PEG200 increased the fidelity of DNA polymerization relative to RNA polymerization. Thus, PEG200 transformed an RNAP into a DNAP, suggesting that the specific crowding environment is a regulator of substrate specificity of RNAP. This study is an experimental demonstration of an evolutionary link between polymerase activities and crowding conditions. Finally, it is tempting to speculate that, since the bisubstrate specificity of the enzyme can be controlled by chemical perturbation, molecular crowding could be a more general trigger that might have affected the evolutionary processes of a range of various reactions catalyzed by biomolecules.

Supporting Information The Supporting Information is available free of charge on the ACS Publications website; this includes PAGE data of control experiments, CD spectra, FCS results of control experiments, and sequences used in this study (Figures S1–S14 and Tables S1–S2).

34


Page 35 of 41 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

The authors declare no competing financial interest.

ACKNOWLEDGEMENT We thank Ms. M. Izumi and Ms. J. Inoue for their assistances in performing the experiments. This work was supported by Grants-in-Aid for Scientific Research from the Ministry of Education, Culture, Sports, Science and Technology (MEXT) and the Japan Society for the Promotion of Science (JSPS), especially a Grant- in-Aid for Scientific Research on Innovative Areas “Chemistry for Multimolecular Crowding Biosystems” (JSPS KAKENHI Grant No. JP17H06351), by the MEXT-Supported Program for the Strategic Research Foundation at Private Universities (2014-2019), Japan, by The Hirao Taro Foundation of Konan Gakuen for Academic Research, by The Okazaki Kazuo Foundation of Konan Gakuen for Advanced Scientific Research, and by the Chubei Itoh Foundation.

REFERENCES [1] Higgs, P. G., and Lehman, N. (2015) The RNA World: molecular cooperation at the origins of life, Nat. Rev. Genet. 16, 7-17. [2] Poole, A. M., and Logan, D. T. (2005) Modern mRNA proofreading and repair: clues that the last universal common ancestor possessed an RNA genome?, Mol. Biol. Evol. 22, 1444-1455. [3] Leu, K., Obermayer, B., Rajamani, S., Gerland, U., and Chen, I. A. (2011) The prebiotic evolutionary advantage of transferring genetic information from RNA to DNA, Nucleic Acids Res. 39, 8135-8147. [4] Bonner, G., Patra, D., Lafer, E. M., and Sousa, R. (1992) Mutations in T7 RNA polymerase that support the proposal for a common polymerase active site structure, EMBO J. 11, 3767-3775. [5] Ahlquist, P. (2002) RNA-dependent RNA polymerases, viruses, and RNA

35


Biochemistry 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

silencing, Science 296, 1270-1273. [6] Vashishtha, A. K., Wang, J., and Konigsberg, W. H. (2016) Different Divalent Cations Alter the Kinetics and Fidelity of DNA Polymerases, J. Biol. Chem. 291, 20869-20875. [7] Nakano, S., Miyoshi, D., and Sugimoto, N. (2014) Effects of molecular crowding on the structures, interactions, and functions of nucleic acids, Chem. Rev. 114, 2733-2758. [8] Minton, A. P. (2006) How can biochemical reactions within cells differ from those in test tubes?, J. Cell Sci. 119, 2863-2869. [9] Kuznetsova, I. M., Turoverov, K. K., and Uversky, V. N. (2014) What macromolecular crowding can do to a protein, Int. J Mol. Sci. 15, 2309023140. [10] Lambert, D., and Draper, D. E. (2007) Effects of osmolytes on RNA secondary and tertiary structure stabilities and RNA-Mg2+ interactions, J. Mol. Biol. 370, 993-1005. [11] Zhou, H. X., Rivas, G., and Minton, A. P. (2008) Macromolecular crowding and confinement: biochemical, biophysical, and potential physiological consequences, Ann. Rev. Biophys. 37, 375. [12] Desai, R., Kilburn, D., Lee, H. T., and Woodson, S. A. (2014) Increased ribozyme activity in crowded solutions, J. Biol. Chem. 289, 2972-2977. [13] Lambert, D., Leipply, D., and Draper, D. E. (2010) The osmolyte TMAO stabilizes native RNA tertiary structures in the absence of Mg2+: evidence for a large barrier to folding from phosphate dehydration, J. Mol. Biol. 404, 138157. [14] Semrad, K., and Green, R. (2002) Osmolytes stimulate the reconstitution of functional 50S ribosomes from in vitro transcripts of Escherichia coli 23S rRNA, RNA 8, 401-411. [15] Chen, I. A., Salehi-Ashtiani, K., and Szostak, J. W. (2005) RNA catalysis in model protocell vesicles, J. Am. Chem. Soc. 127, 13213-13219. [16] Strulson, C. A., Molden, R. C., Keating, C. D., and Bevilacqua, P. C. (2012) RNA catalysis through compartmentalization, Nat. Chem. 4, 941-946. [17] Spitzer, J., and Poolman, B. (2009) The role of biomacromolecular crowding, ionic strength, and physicochemical gradients in the complexities of life's emergence, Microbiol. Mol. Biol. Rev. 73, 371-388. [18] Budin, I., and Szostak, J. W. (2010) Expanding roles for diverse physical phenomena during the origin of life, Ann. Rev. Biophys. 39, 245-263. [19] Leipe, D. D., Aravind, L., and Koonin, E. V. (1999) Did DNA replication evolve twice independently?, Nucleic Acids Res. 27, 3389-3401. [20] Glansdorff, N., Xu, Y., and Labedan, B. (2008) The last universal common ancestor: emergence, constitution and genetic legacy of an elusive forerunner, Biol. Direct 3, 29. [21] He, C., Gallego, I., Laughlin, B., Grover, M. A., and Hud, N. V. (2017) A viscous solvent enables information transfer from gene-length nucleic acids in a model prebiotic replication cycle, Nat. Chem. 9, 318-324.

36


Page 36 of 41

Page 37 of 41 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

[22] Attwater, J., Wochner, A., and Holliger, P. (2013) In-ice evolution of RNA polymerase ribozyme activity, Nat. Chem. 5, 1011-1018. [23] Ricchetti, M., and Buc, H. (1993) E. coli DNA polymerase I as a reverse transcriptase, EMBO J. 12, 387-396. [24] Cazenave, C., and Uhlenbeck, O. C. (1994) RNA template-directed RNA synthesis by T7 RNA polymerase, Proc. Natl. Acad. Sci. U. S. A. 91, 69726976. [25] Takahashi, S., Hisanaga, K., Yoshida, A., and Okahata, Y. (2012) Real-time monitoring of a stepwise transcription reaction on a quartz-crystal microbalance, Anal. Biochem. 421, 732-741. [26] Temiakov, D., Patlan, V., Anikin, M., McAllister, W. T., Yokoyama, S., and Vassylyev, D. G. (2004) Structural basis for substrate selection by T7 RNA polymerase, Cell 116, 381-391. [27] Kochetkov, S. N., Rusakova, E. E., and Tunitskaya, V. L. (1998) Recent studies of T7 RNA polymerase mechanism, FEBS Lett. 440, 264-267. [28] Forrest, D., James, K., Yuzenkova, Y., and Zenkin, N. (2017) Single-peptide DNA-dependent RNA polymerase homologous to multi-subunit RNA polymerase, Nat. Commun. 8, 15774. [29] Glasner, M. E., Yen, C. C., Ekland, E. H., and Bartel, D. P. (2000) Recognition of nucleoside triphosphates during RNA-catalyzed primer extension, Biochemistry 39, 15556-15562. [30] Nakano, S., Karimata, H. T., Kitagawa, Y., and Sugimoto, N. (2009) Facilitation of RNA enzyme activity in the molecular crowding media of cosolutes, J. Am. Chem. Soc. 131, 16881-16888. [31] Triana-Alonso, F. J., Dabrowski, M., Wadzack, J., and Nierhaus, K. H. (1995) Self-coded 3'-extension of run-off transcripts produces aberrant products during in vitro transcription with T7 RNA polymerase, J. Biol. Chem. 270, 6298-6307. [32] Sousa, R., and Padilla, R. (1995) A mutant T7 RNA polymerase as a DNA polymerase, EMBO J. 14, 4609-4621. [33] Bermek, O., Grindley, N. D., and Joyce, C. M. (2013) Prechemistry nucleotide selection checkpoints in the reaction pathway of DNA polymerase I and roles of glu710 and tyr766, Biochemistry 52, 6258-6274. [34] Shechner, D. M., and Bartel, D. P. (2011) The structural basis of RNA-catalyzed RNA polymerization, Nat. Struct. Mol. Biol. 18, 1036-1042. [35] Leontis, N. B., Stombaugh, J., and Westhof, E. (2002) The non-Watson-Crick base pairs and their associated isostericity matrices, Nucleic Acids Res. 30, 3497-3531. [36] Wilson, C., and Keefe, A. D. (2006) Building oligonucleotide therapeutics using non-natural chemistries, Curr. Opin. Chem. Biol. 10, 607-614. [37] Sabahi, A., Guidry, J., Inamati, G. B., Manoharan, M., and Wittung-Stafshede, P. (2001) Hybridization of 2'-ribose modified mixed-sequence oligonucleotides: thermodynamic and kinetic studies, Nucleic Acids Res. 29, 2163-2170.

37


Biochemistry 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

[38] Morrissey, D. V., Lockridge, J. A., Shaw, L., Blanchard, K., Jensen, K., Breen, W., Hartsough, K., Machemer, L., Radka, S., Jadhav, V., Vaish, N., Zinnen, S., Vargeese, C., Bowman, K., Shaffer, C. S., Jeffs, L. B., Judge, A., MacLachlan, I., and Polisky, B. (2005) Potent and persistent in vivo anti-HBV activity of chemically modified siRNAs, Nat. Biotechnol. 23, 1002-1007. [39] Khati, M., Schuman, M., Ibrahim, J., Sattentau, Q., Gordon, S., and James, W. (2003) Neutralization of infectivity of diverse R5 clinical isolates of human immunodeficiency virus type 1 by gp120-binding 2'F-RNA aptamers, J. Virol. 77, 12692-12698. [40] Pieken, W. A., Olsen, D. B., Benseler, F., Aurup, H., and Eckstein, F. (1991) Kinetic characterization of ribonuclease-resistant 2'-modified hammerhead ribozymes, Science 253, 314-317. [41] Laughrea, M., Latulippe, J., and Filion, A. M. (1984) Effect of ethanol, phenol, formamide, dimethyl sulfoxide, paromomycin, and deuterium oxide on the fidelity of translation in a brain cell-free system, Biochemistry 23, 753-758. [42] Tyrrell, J., Weeks, K. M., and Pielak, G. J. (2015) Challenge of mimicking the influences of the cellular environment on RNA structure by PEG-induced macromolecular crowding, Biochemistry 54, 6447-6453. [43] Jensen, R. A. (1976) Enzyme recruitment in evolution of new function, Annu. Rev. Microbiol. 30, 409-425. [44] Due, A. V., Kuper, J., Geerlof, A., von Kries, J. P., and Wilmanns, M. (2011) Bisubstrate specificity in histidine/tryptophan biosynthesis isomerase from Mycobacterium tuberculosis by active site metamorphosis, Proc. Natl. Acad. Sci. U. S. A. 108, 3554-3559. [45] Fushinobu, S., Nishimasu, H., Hattori, D., Song, H. J., and Wakagi, T. (2011) Structural basis for the bifunctionality of fructose-1,6-bisphosphate aldolase/phosphatase, Nature 478, 538-541. [46] Newton, M. S., Guo, X., Soderholm, A., Nasvall, J., Lundstrom, P., Andersson, D. I., Selmer, M., and Patrick, W. M. (2017) Structural and functional innovations in the real-time evolution of new (betaalpha)8 barrel enzymes, Proc. Natl. Acad. Sci. U. S. A. 114, 4727-4732. [47] Attwater, J., Wochner, A., and Holliger, P. (2013) In-ice evolution of RNA polymerase ribozyme activity, Nat. Chem. 5, 1011-1018. [48] Mutschler, H., and Holliger, P. (2014) Non-canonical 3'-5' extension of RNA with prebiotically plausible ribonucleoside 2',3'-cyclic phosphates, J. Am. Chem. Soc. 136, 5193-5196. [49] Adamala, K. P., Engelhart, A. E., and Szostak, J. W. (2016) Collaboration between primitive cell membranes and soluble catalysts, Nat. Commun. 7, 11041. [50] Engelhart, A. E., Adamala, K. P., and Szostak, J. W. (2016) A simple physical mechanism enables homeostasis in primitive cells, Nat. Chem. 8, 448-453. [51] Jia, T. Z., Hentrich, C., and Szostak, J. W. (2014) Rapid RNA exchange in aqueous two-phase system and coacervate droplets, Orig. Life Evol. Biosph. 44, 1-12.

38


Page 38 of 41

Page 39 of 41 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

[52] Deng, N. N., and Huck, W. T. S. (2017) Microfluidic Formation of Monodisperse Coacervate Organelles in Liposomes, Angew. Chem. Int. Ed. 56, 9736-9740. [53] Agresti, J. J., Kelly, B. T., Jaschke, A., and Griffiths, A. D. (2005) Selection of ribozymes that catalyse multiple-turnover Diels-Alder cycloadditions by using in vitro compartmentalization, Proc. Natl. Acad. Sci. U. S. A. 102, 1617016175. [54] Dora Tang, T. Y., van Swaay, D., deMello, A., Ross Anderson, J. L., and Mann, S. (2015) In vitro gene expression within membrane-free coacervate protocells, Chem. Commun. 51, 11429-11432. [55] Ghadessy, F. J., Ong, J. L., and Holliger, P. (2001) Directed evolution of polymerase function by compartmentalized self-replication, Proc. Natl. Acad. Sci. U. S. A. 98, 4552-4557. [56] Yancey, P. H., Clark, M. E., Hand, S. C., Bowlus, R. D., and Somero, G. N. (1982) Living with water stress: evolution of osmolyte systems, Science 217, 1214-1222. [57] Rook, M. S., Treiber, D. K., and Williamson, J. R. (1998) Fast folding mutants of the Tetrahymena group I ribozyme reveal a rugged folding energy landscape, J. Mol. Biol. 281, 609-620. [58] Shelanski, M. L., Gaskin, F., and Cantor, C. R. (1973) Microtubule assembly in the absence of added nucleotides, Proc. Natl. Acad. Sci. U. S. A. 70, 765768. [59] Gekko, K., and Timasheff, S. N. (1981) Mechanism of protein stabilization by glycerol: preferential hydration in glycerol-water mixtures, Biochemistry 20, 4667-4676. [60] Christiansen, A., Wang, Q., Cheung, M. S., and Wittung-Stafshede, P. (2013) Effects of macromolecular crowding agents on protein folding in vitro and in silico, Biophys. Rev. 5, 137-145. [61] Jiang, M., and Guo, Z. (2007) Effects of macromolecular crowding on the intrinsic catalytic efficiency and structure of enterobactin-specific isochorismate synthase, J. Am. Chem. Soc. 129, 730-731. [62] Dhar, A., Samiotakis, A., Ebbinghaus, S., Nienhaus, L., Homouz, D., Gruebele, M., and Cheung, M. S. (2010) Structure, function, and folding of phosphoglycerate kinase are strongly perturbed by macromolecular crowding, Proc. Natl. Acad. Sci. U. S. A. 107, 17586-17591. [63] Asaad, N., and Engberts, J. B. (2003) Cytosol-mimetic chemistry: kinetics of the trypsin-catalyzed hydrolysis of p-nitrophenyl acetate upon addition of polyethylene glycol and N-tert-butyl acetoacetamide, J. Am. Chem. Soc. 125, 6874-6875. [64] Cermakian, N., Ikeda, T. M., Miramontes, P., Lang, B. F., Gray, M. W., and Cedergren, R. (1997) On the evolution of the single-subunit RNA polymerases, J. Mol. Evol. 45, 671-681. [65] Werner, F., and Grohmann, D. (2011) Evolution of multisubunit RNA polymerases in the three domains of life, Nat. Rev. Microbiol. 9, 85-98. [66] Koga, S., Williams, D. S., Perriman, A. W., and Mann, S. (2011) Peptide-

39


Biochemistry 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

nucleotide microdroplets as a step towards a membrane-free protocell model, Nat. Chem. 3, 720-724. [67] Sokolova, E., Spruijt, E., Hansen, M. M., Dubuc, E., Groen, J., Chokkalingam, V., Piruska, A., Heus, H. A., and Huck, W. T. (2013) Enhanced transcription rates in membrane-free protocells formed by coacervation of cell lysate, Proc. Natl. Acad. Sci. U. S. A. 110, 11692-11697. [68] Li, M., Huang, X., Tang, T. Y., and Mann, S. (2014) Synthetic cellularity based on non-lipid micro-compartments and protocell models, Curr. Opin. Chem. Biol. 22, 1-11. [69] Wanrooij, S., Fuste, J. M., Farge, G., Shi, Y., Gustafsson, C. M., and Falkenberg, M. (2008) Human mitochondrial RNA polymerase primes lagging-strand DNA synthesis in vitro, Proc. Natl. Acad. Sci. U. S. A. 105, 11122-11127. [70] Tizei, P. A., Csibra, E., Torres, L., and Pinheiro, V. B. (2016) Selection platforms for directed evolution in synthetic biology, Biochem. Soc. Trans. 44, 11651175. [71] Padilla, R., and Sousa, R. (1999) Efficient synthesis of nucleic acids heavily modified with non-canonical ribose 2'-groups using a mutant T7 RNA polymerase (RNAP), Nucleic Acids Res. 27, 1561-1563.

40


Page 40 of 41

Page 41 of 41 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

For Table of Contents Use Only

41


Bisubstrate Function of RNA Polymerases Triggered by Molecular

Recommend Documents