(BPSIP) Exposure on Reproduction and Endocrine ... - ACS Publications

Article pubs.acs.org/est

Cite This: Environ. Sci. Technol. XXXX, XXX, XXX−XXX

Effects of 4‑Hydroxyphenyl 4‑Isoprooxyphenylsulfone (BPSIP) Exposure on Reproduction and Endocrine System of Zebrafish Jiyun Lee,† Na-Youn Park,‡ Younglim Kho,‡ and Kyunghee Ji*,†,§ †

Department of Environmental Health, Graduate School of Yongin University, Yongin, 17092, Republic of Korea Department of Health, Environment and Safety, Eulji University, Seongnam, Gyeonggi, 13135, Republic of Korea § Department of Occupational and Environmental Health, Yongin University, Yongin, 17092, Republic of Korea ‡

S Supporting Information *

ABSTRACT: The compound 4-hydroxyphenyl 4-isoprooxyphenylsulfone (BPSIP), a derivative of bisphenol S (BPS), has been detected in thermal paper and human urine samples; however, its potential effects on the endocrine system are largely unknown. The present study was conducted to determine the adverse effects of BPSIP on egg production, relative organ weights, plasma levels of sex hormones, and transcription of genes related to the hypothalamus-pituitarygonad (HPG) axis in zebrafish (Danio rerio). In male fish, the gonadosomatic index was significantly decreased at concentrations of 5 and 50 μg/L BPSIP. The estrogenic (increase in the 17β-estradiol/testosterone [E2/T] ratio) and antiandrogenic (decrease in T) effects were observed in fish exposed to BPSIP and males were more sensitive to the adverse effects than females. The changes in sex hormones were supported by the regulation of genes along the HPG axis, such as cyp19, 17βhsd, and cyp17 transcripts. Although the effective concentration for endocrine disruption was greater than that of BPS, the actions of BPSIP on the steroidogenic pathway were similar to the effects of BPS exposure.

■

INTRODUCTION Bisphenol A (BPA) has been widely used in the manufacture of polycarbonate plastic and epoxy resins in food packaging containers, plastics, and thermal paper products.1 Many scientists have raised concerns over the use of BPA because of its wide range of application and the discovery of associated adverse health effects, particularly, endocrine disruption in animal1 and human studies.2,3 Following the precautionary principle, BPA was banned in plastic baby bottles in Canada, France, and the European Union.4 In 2014, France submitted a proposal to restrict the concentration of BPA used in the manufacturing of thermal paper.5 Because BPA regulation has been tightened, manufacturers have begun to eliminate BPA from their products and are gradually converting to using BPA analogues as alternatives. Bisphenol S (BPS) and 4-hydroxyphenyl 4-isoprooxyphenylsulfone (BPSIP, also known as D-8 and WinCon-8), have been introduced as alternative compounds for dye developing.6 BPS has been detected in numerous products, biota, and environmental samples (e.g., personal care7 and paper products,8 human urine and blood,9 and surface water10). However, there is limited information on the monitoring data for BPSIP. In thermal paper receipts used in Switzerland markets, BPSIP was detected in the range of 3.4−13.2 mg/g.11 The levels of BPS and BPSIP were higher in cashiers after work, and were also detected in noncashiers.9 BPSIP in cashiers’ blood was detected © XXXX American Chemical Society

more often than BPA and BPS were, suggesting that it may be more persistent with more widespread exposure than previously assumed.9 Alternative compounds used to replace a chemical of concern should be far less toxic than the original chemicals. Unfortunately, numerous chemical alternatives are not fully tested before being placed on the market, and sometimes as toxic as the original chemicals.12 For instance, BPS has a para hydroxyl group on each phenol ring, similar to BPA, and its chemical potency is similar or slightly lower than that of BPA. Previous studies have reported that BPS has estrogenic13 and antiandrogenic activities14 similar to BPA, and is toxic to aquatic organisms.15,16 Our previous study reported that the exposure of zebrafish to low concentrations of BPS disrupts 17β-estradiol (E2) and testosterone (T) hormone levels, and transcription of the hypothalamus-pituitary-gonad (HPG) axis genes, consequently leading to decreased egg production.17 Another study on zebrafish showed that exposure to BPS decreased body weight, altered sex hormone levels, increased the female to male sex ratio, and disrupted reproduction.18 However, information on Received: January 26, 2017 Revised: April 12, 2017 Accepted: April 17, 2017

A

DOI: 10.1021/acs.est.7b00498 Environ. Sci. Technol. XXXX, XXX, XXX−XXX

Article

Environmental Science & Technology Table 1. Sequences of Primers for the Genes Measureda gene name

accession no.

β-actin

NM_131031

18s rRNA

BX296557

gnrh2

AY657018

gnrh3

NM_182887

gnrhr2

NM_001144979

gnrhr4

NM_001098193

fshβ

NM_205624

lhβ

NM_205622

cyp19b

AF183908

erα

NM_152959

er2β

NM_174862

ar

NM_001083123

fshr

NM_001001812

lhr

AY424302

hmgra

BC155135

hmgrb

NM_001014292

star

NM_131663

cyp11a

NM_152953

cyp17

AY281362

17βhsd

AY306005

cyp19a

AF226620

description

sequence (5′−3′)

forward reverse forward reverse forward reverse forward reverse forward reverse forward reverse forward reverse forward reverse forward reverse forward reverse forward reverse forward reverse forward reverse forward reverse forward reverse forward reverse reverse reverse forward reverse forward reverse forward reverse forward reverse

TGCTGTTTTCCCCTCCATTG TCCCATGCCAACCATCACT TCGCTAGTTGGCATCGTTTATG CGGAGGTTCGAAGACGATCA CTGAGACCGCAGGGAAGAAA TCACGAATGAGGGCATCCA TTGCCAGCACTGGTCATACG TCCATTTCACCAACGCTTCTT CAACCTGGCCGTGCTTTACT GGACGTGGGAGCGTTTTCT CACCAACAACAAGCGCAAGT GGCAACGGTGAGGTTCATG GCTGTCGACTCACCAACATCTC GTGACGCAGCTCCCACATT GGCTGCTCAGAGCTTGGTTT TCCACCGATACCGTCTCATTTA GTCGTTACTTCCAGCCATTCG GCAATGTGCTTCCCAACACA GAAGCATTCAAGGTCACAATGACT GCATGCTTGGCAGCTCTTTC TTCAACCACGGAGCCCTAAC TTCGGACACAGGAGGACGAT TCTGGGTTGGAGGTCCTACAA GGTCTGGAGCGAAGTACAGCAT CGTAATCCCGCTTTTGTTCCT CCATGCGCTTGGCGATA GGCCATCGCCGGAAA GGTTAATTTGCAGCGGCTAGTG GAATCCACGGCCTCTTCGT GGGTTACGGTAGCCACAATGA TGGCCGGACCGCTTCTA GTTGTTGCCATAGGAACATGGA GGTCTGAGGAAGAATGCAATGAT CCAGGTCCGGAGAGCTTGT GGCAGAGCACCGCAAAA CCATCGTCCAGGGATCTTATTG TCTTTGACCCAGGACGCTTT CCGACGGGCAGCACAA TGCATCTCGCATCAAATCCA GTCCAAGTTCCGCATAGTAGCA GCTGACGGATGCTCAAGGA CCACGATGCACCGCAGTA

Abbreviations: β-actin, beta actin; 18s rRNA, 18s ribosomal RNA; gnrh, gonadotropin-releasing hormone; gnrhr, gonadotropin-releasing hormone receptor; fshβ, follicle stimulating hormone β; lhβ, luteinizing hormone β; cyp, cytochrome; er, estrogen receptor; ar, androgen receptor; fshr, follicle stimulating hormone receptor; lhr, luteinizing hormone receptor; hmgr, hydroxymethylglutaryl CoA reductase; star, steroidogenic acute regulatory protein; 17βhsd, 17β-hydroxysteroid dehydrogenase. a

■

MATERIALS AND METHODS Test Chemicals and Chemical Analysis. BPSIP (CAS No. 95235-30-6, 98%) was purchased from AK Scientific, Inc., (Union City, CA, USA). No solvent was used in the water the fish were exposed to. During the exposure, the test medium was collected from each aquarium. The actual BPSIP concentrations were measured following methods previously described for BPS17 with minor modifications. BPSIP was analyzed using a highperformance liquid chromatography system (Agilent Technologies, Palo Alto, CA, USA). After admixing water samples (200 μL) and internal standards (BPS, 20 μL), BPSIP was separated using a Cadenza C18 column (Imtakt Co., Kyoto, Japan). The

endocrine disruption by BPSIP is very limited. Estrogenic activity was not observed in an estrogen receptor (ER) binding assay,19 whereas antiestrogenic activity was observed in a competitive ER binding assay in the presence of E2.20 Although BPSIP is structurally related to BPS, no effects were observed on the concentration of E2 or free T in H295R cells.21 In the present study, the potential endocrine disruption of BPSIP was investigated with the hypothesis that it impairs reproduction and molecular biomarkers of the HPG axis in zebrafish. The findings of this study will improve the understanding of reproductive endocrine disruption in fish exposed to BPSIP. B


Article

Environmental Science & Technology

Figure 1. Effects on reproductive performances and sex steroid hormones in zebrafish exposed to BPSIP for 21 d. (A) average number of eggs/ breeding tank/day, (B) 17β-estradiol (E2) concentration, (C) testosterone (T) concentration, and (D) E2/T ratio. For egg production, a total of 63 measurements per control or treatment (3 reps × 21 d = 63) were employed for the statistical comparison. The results are shown as mean ± standard deviation (for hormone analysis, n = 4 in males and n = 6 in females). Asterisk indicates significant difference between exposure groups and control group (p < 0.05).

each exposure group. The number of fish sampled was derived by power analysis of data obtained from a previous BPS study17 and preliminary experiments. Hormone Measurement. The levels of E2 and T were measured using an enzyme-linked immunosorbent assay (ELISA) following methods previously described.22 Briefly, blood samples collected from each fish were centrifuged at 2000 × g for 15 min, and 400 μL UltraPure water was added. The diluted plasma samples were then extracted twice with diethyl ether. The solvent was evaporated, and then the residues were dissolved in the ELISA buffer. The ELISA kits (Cat No. 582251 and 582701 for E2 and T, respectively) were purchased from Cayman Chemical Co. (Ann Arbor, MI, USA), and the sex steroid hormones were measured following the manufacturer’s instructions. Real-Time Polymerase Chain Reaction (PCR) Assay. The relative transcription levels of the HPG axis-related genes were determined using a previously described method.22 The transcription of ten and nine genes in brain and gonad samples, respectively, and two housekeeping genes (beta-actin [β-actin] and 18s ribosomal RNA [18s rRNA]) were measured. The full names of genes and primer sequences are shown in Table 1. The mRNA was extracted from each tissue sample using the RNeasy mini-kit (QIAGEN). The RNA quality and concentration were verified using an Epoch Take3 microplate spectrophotometer (BioTek Instruments Inc., Winooski, VT, USA). RNA samples were then synthesized to complementary DNA (cDNA) using an iScript cDNA Synthesis kit (BIORAD, Hercules, CA, USA). For the quantitative real-time PCR, the ABI 7500 Fast Real-Time PCR System (Applied Biosystems, Foster City, CA, USA) was used. The threshold cycle (Ct)

analytes were identified and quantified using an API 4500 triple quadrupole mass spectrometry system (Applied Biosystems, Foster City, CA, USA). The electrospray ionization conditions for the analysis, recovery, precision, and linearity of the calibration curves are described in Tables S1−S3 and Figure S1. The limit of detection was 0.260 ng/mL. The nominal and measured concentrations showed a good agreement (Table S4), and therefore the nominal concentrations were used throughout the study. Zebrafish Exposure and Sampling. Adult zebrafish were maintained in a tank filled with dechlorinated tap water at 26 ± 2 °C under a 14:10 h light:dark photoperiod. Zebrafish pairs were exposed to the control, 0.5, 5, or 50 μg/L of BPSIP for 21 days. Test concentrations were chosen based on the concentrations of BPS reported elsewhere17 and preliminary experiments. Thirty fish (six female and four male fish/tank with three replicates) were allocated to each exposure or control group. The number of eggs produced and the mortality were monitored daily. The fish were fed with freshly hatched brine shrimp (Artemia nauplii) and mosquito larvae twice daily. Exposure medium was carefully replaced with freshly prepared medium more than five times per week to maintain a constant quality during the test period. The exposure media were routinely monitored for temperature, pH, dissolved oxygen, and conductivity. Following exposure, all surviving fish were euthanized by placing them in an ice bath. The total length, weight, and organ weights (the gonads and liver) were recorded, and the gonadosomatic index (GSI) and hepatosomatic index (HSI) were calculated. For hormone and gene transcription measurement, four males and six females were randomly collected from C


Article

Environmental Science & Technology values for each target gene were normalized to levels of the corresponding endogenous genes (β-actin and 18s rRNA) using the ΔΔCt method. Statistical Analysis. The data were analyzed using a oneway analysis of variance (ANOVA) to investigate the differences between the control and treatment groups. Spearman correlation analysis was performed to determine the correlation between 19 gene transcripts in the HPG axis. A principal component analysis (PCA) was performed to determine the principal components (PCs) from a set of gene transcripts. To evaluate the correlation between gene transcriptions and hormone production, the first two PCs (PC1 and PC2) were used in regression analyses. For all statistical results, p < 0.05 was considered significant. Statistical analyses were performed using the IBM statistical package for the social sciences (SPSS) version 19 (IBM Corp., New York, NY, USA) and the statistical analysis software (SAS) program (version 9.2, SAS Institute, Cary, NC, USA).

■

RESULTS

Reproductive Performance and Hormonal Levels. The average number of eggs was not significantly changed even at the highest experimental concentration of 50 μg/L BPSIP (Figure 1A). In male fish, the plasma concentrations of E2 and T were significantly reduced following exposure to 50 and ≥5 μg/L BPSIP, respectively (Figure 1B−C). In female fish, plasma concentrations of E2 and T were significantly increased at 50 μg/L BPSIP (Figure 1B−C). The E2/T ratio was significantly increased following treatment with ≥5 μg/L BPSIP in male fish, whereas in female fish, the E2/T ratio was significantly decreased at 50 μg/L BPSIP (Figure 1D). Changes in Relative Tissue Weight. The effects of BPSIP on the GSI and HSI of adult zebrafish are summarized in Figure 2. In male fish, the GSI and HSI were significantly decreased following exposure to ≥5 and ≥0.5 μg/L BPSIP, respectively. Gene Transcription Alterations. The transcription of the HPG axis-related genes was affected by exposure to BPSIP (Figure 3). In males, transcripts of gonadotropin-releasing hormone 2 (gnrh2), gnrh receptor 2 (gnrhr2), gnrhr4, and erα genes in the brain were significantly up-regulated by exposure to BPSIP (Figure 3A). Transcripts of follicle-stimulating hormone beta (fshβ) and cytochrome P450 aromatase b (cyp19b) in the brain (Figure 3A), and fsh receptor ( fshr), cyp17, 17βhydroxysteroid dehydrogenase (17βhsd), and cyp19a genes in the testis (Figure 3B) were significantly down-regulated in male zebrafish. BPSIP exposure also significantly up-regulated gnrh2, gnrhr2, gnrhr4, fshβ, cyp19b, erα, and er2β in the brain (Figure 3C), and cyp17 and cyp19a in the ovary (Figure 3D) in female fish. The association between gene transcription and sex steroid hormones in zebrafish was investigated. PCA was used to covert a number of potentially correlated genes (Table S5) to fewer factors. The PC1 and PC2 explained 59% and 57% of the total variation in male and female fish, respectively (Table S6). In male fish, concentrations of T (β = 0.273, p < 0.01) and E2 (β = 0.267, p < 0.01) were significantly correlated with PC1 (gnrh2, gnrhr2, gnrhr4, fshβ, erα, fshr, cyp17, 17βhsd, and cyp19a). In females, PC1 (gnrh2, gnrhr2, cyp19b, erα, er2β, cyp17, and cyp19a) was significantly correlated with T (β = 0.240, p < 0.01).

Figure 2. Effects on somatic indices of zebrafish exposed to BPSIP for 21 d. Gonadosomatic index = gonad weight/body weight ×100, hepatosomatic index = liver weight/body weight ×100. The values are mean ± standard deviation. Asterisk indicates significant difference between exposure groups and control group (p < 0.05).

■

DISCUSSION The results of our study demonstrated that BPSIP altered the relative organ weights, sex hormone levels, and the transcription of genes regulated by the HPG axis in zebrafish. As expected, the BPSIP endocrine-disrupting effects such as estrogenicity and antiandrogenicity, were similar to those of BPS. For example, the estrogenic (increase in the E2/T ratio) and antiandrogenic (down-regulation of 17βhsd and cyp17 genes and a decrease in T concentrations) characteristics were observed in male fish exposed to BPS17 or BPSIP. However, BPSIP was less potent in the disruption of hormonal balance and gene transcription than BPS or BPA were. Specifically, the lowest observed effective concentration was in the range of 0.5−1 μg/L BPS17,18 and 0.228 μg/L BPA,23 whereas it was approximately 5 μg/L for BPSIP. Sex steroid hormones (T and E2) and their balance play crucial roles in masculinization or feminization of fish.24 The significant increase in the E2/T ratio following BPSIP exposure suggests that the balance of sex steroid hormones in male zebrafish was disrupted. Interestingly, males were more sensitive than females to the adverse effects of BPSIP; greater adverse effects on hormonal levels were observed in male zebrafish. Males were likewise more sensitive to BPS exposure.17,18 The GSI is a common indicator of exposure to environmental contaminants, and is widely used as an unspecific biomarker to investigate the effects of endocrine disrupting chemicals in addition to the determination of other more specific biomarkers.25 In a recent study on zebrafish, GSI values were significantly reduced after a 21 day BPS exposure.17 Previously, it was documented that estrogenic chemicals caused D


Article


Figure 3. Transcriptional response of the genes in zebrafish exposed to BPSIP for 21 d. Responses in (A) male brain, (B) male gonad, (C) female brain, and (D) female gonad are summarized. The values are mean ± standard deviation (n = 4 in males and n = 6 in females). Asterisk indicates significant difference between exposure groups and control group (p < 0.05).

changes. Our observation of a significant decrease in E2 and T concentrations was supported by the down-regulation of cyp17, 17βhsd, and cyp19 genes in male zebrafish exposed to BPSIP. In female fish, significant increase in E2 and T concentrations was accompanied by a significant up-regulation of cyp17 and cyp19a genes. Cyp17 is responsible for the conversion of progesterone

changes in the GSI of zebrafish by altering the number and size of germ cells.18,26,27 Our observation of a significant decrease in gonad weight in fish exposed to BPSIP suggests that this chemical has the potential to induce gonadal recrudescence. The measurement of gene transcripts in the HPG axis has been frequently used as a functional biomarker of hormonal E


Article


Figure 4. Structural characteristics of bisphenol A, bisphenol S, and bisphenol SIP which might possess endocrine disrupting activity.

to androstenedione,28 and 17βhsd is a primary enzyme catalyzing the reduction of androstenedione to testosterone.29 Cyp19 is involved in the final step of the conversion of T to E2.30 While the genes involved in regulating the steroidogenic pathway are not transcribed to the same extent, protein levels or enzyme activities are generally well correlated with their mRNA levels.31 Therefore, significant alteration in cyp17, 17βhsd, and cyp19 transcript levels may affect the steroidogenic process and change the sex hormone levels in zebrafish exposed to BPSIP. GnRH plays a crucial role in regulating reproduction through the HPG axis and synthesizing gonadotropin hormones in zebrafish.17 The up-regulation of gnrh2, gnrhr2, and gnrhr4 genes in male zebrafish can be explained by two hypotheses. The first suggests that a negative feedback action in the hypothalamus compensates for the reduced E2 production, while the second proposes the direct action of BPSIP on the production of GnRHs. The greater transcription of gnrh2, gnrhr2, and gnrhr4 genes in female zebrafish suggests that BPSIP could regulate GnRH levels, which could subsequently affect the secretion of gonadotropin hormones. FSH and luteinizing hormone (LH) act by binding to the FSHR and LHR, respectively, to induce gametogenesis.32,33 A previous study showed that BPA reduces serum LH concentration and sperm production, causing a state of hypogonadotropic hypogonadism in rats.34 In addition, the serum FSH and T levels in male rats exposed to BPA were lower than those in control rats, and the number of apoptotic germ cells was significantly increased in rats exposed to BPA.35 In our study, significant up- or down-regulation of fshβ and lhβ genes in the brain and fshr and lhr genes in the gonads of zebrafish exposed to BPSIP suggests possible effects on gametogenesis. The relationship between sex steroid hormone concentrations and gene transcriptions in fish exposed to BPSIP was evaluated. The group of genes constituting the PC1 and PC2 differed between male and female fish. The key contributors to the PC1 (gnrh2, gnrhr2, gnrhr4, fshβ, erα, fshr, cyp17, 17βhsd, and cyp19a) were correlated with concentrations of E2 and T in males, whereas the major genes comprising the PC1 (gnrh2, gnrhr2, cyp19b, erα, er2β, cyp17, and cyp19a) were correlated with concentrations of T in female fish. These specific genes could be potential molecular biomarkers for investigating the sex-dependent effects of BPSIP, and a larger sample size than

that used in the present study would improve the reliability of these results suggesting the relationships. The commonalities and differences in the toxicity of BPS and BPSIP can be explained by their chemical structure (Figure 4). Previous studies have shown that the phenolic hydroxyl group is the key structural component responsible for the estrogenic and antiandrogenic activities of bisphenol analogues.14,36 In addition, the hydrophobic group of the propane moiety and the 4-hydroxyl group on the A-phenyl ring are suggested regulatory factors for these activities.14,36 For example, the estrogenic and antiandrogenic activities of BPS have been explained by the presence of a para hydroxyl group on phenol ring.36 One explanation for the differential toxicity of BPS and BPSIP could be the extent of isopropyl ether at the end of the phenolic rings in BPSIP. BPSIP was shown to be an active antiestrogenic substance in a competitive ER binding assay.20 However, the effects of BPSIP on steroidogenesis are still unclear. BPSIP showed no effects on the concentration of E2 or free T in H295R cells.21 In the present study, exposure to BPSIP was associated with hormonal changes (E2 and T) and alteration of gene transcription in the HPG axis of zebrafish. These data suggest that the effects of BPSIP exposure on sex steroid hormone levels differ between in vitro and in vivo systems. The production of steroid hormones is a complex process involving multiple regulatory factors. Therefore, the measurement of other steroid hormones would enhance the understanding of the holistic effects on steroidogenesis37 and differences between in vitro and in vivo systems. BPSIP and BPS are presently not regulated and are used without restriction. However, BPSIP exhibited BPA-like effects (estrogenicity, antiandrogenicity, and greater effects on male reproductive function than on female reproduction) because both compounds have similar chemical structures. The results suggesting that BPSIP appeared to have more profound effects on T levels than it did on E2 levels in males should be carefully considered, because similar effects were observed in rats exposed to BPA.34 Recently, it was reported that environmentally relevant low levels of BPA and BPS caused similar effects on the neuroendocrine system in zebrafish.38 Several studies have shown that BPS exposure alters maternal behavior of mice,39 as well as spermatogenesis in male rats.40 If the current trends continue, the production and release of BPA alternatives into the environment could increase. Because F


Article


sulfone (BPSIP) in urine and blood of cashiers. Environ. Health Perspect. 2016, 124 (4), 437−444. (10) Yang, Y.; Lu, L.; Zhang, J.; Yang, Y.; Wu, Y.; Shao, B. Simultaneous determination of seven bisphenols in environmental water and solid samples by liquid chromatography-electrospray tandem mass spectrometry. J. Chromatogr A 2014, 1328, 26−34. (11) Goldinger, D. M.; Demierre, A. L.; Zoller, O.; Rupp, H.; Reinhard, H.; Magnin, R.; Becker, T. W.; Bourqui-Pittet, M. Endocrine activity of alternatives to BPA found in thermal paper in Switzerland. Regul. Toxicol. Pharmacol. 2015, 71 (3), 453−462. (12) Rochester, J. R.; Bolden, A. L. Bisphenol S and F: systematic review and comparison of the hormonal activity of bisphenol A substitutes. Environ. Health Perspect. 2015, 123 (7), 643−650. (13) Grignard, E.; Lapenna, S.; Bremer, S. Weak estrogenic transcriptional activities of bisphenol A and bisphenol S. Toxicol. In Vitro 2012, 26 (5), 727−731. (14) Kitamura, S.; Suzuki, T.; Sanoh, S.; Kohta, R.; Jinno, N.; Sugihara, K.; Yoshihara, S.; Fujimoto, N.; Watanabe, H.; Ohta, S. Comparative study of the endocrine-disrupting activity of bisphenol A and 19 related compounds. Toxicol. Sci. 2005, 84 (2), 249−259. (15) Chen, M. Y.; Ike, M.; Fujita, M. Acute toxicity, mutagenicity, and estrogenicity of bisphenol-A and other bisphenols. Environ. Toxicol. 2002, 17 (1), 80−86. (16) Tišler, T.; Krel, A.; Gerželj, U.; Erjavec, B.; Dolenc, M. S.; Pintar, A. Hazard identification and risk characterization of bisphenols A, F, and AF to aquatic organisms. Environ. Pollut. 2016, 212, 472− 479. (17) Ji, K.; Hong, S.; Kho, Y.; Choi, K. Effects of bisphenol S exposure on endocrine functions and reproduction of zebrafish. Environ. Sci. Technol. 2013, 47 (15), 8793−8800. (18) Naderi, M.; Wong, M. Y.; Gholami, F. Developmental exposure of zebrafish (Danio rerio) to bisphenol-S impairs subsequent reproduction potential and hormonal balance in adults. Aquat. Toxicol. 2014, 148, 195−203. (19) Terasaki, M.; Shiraishi, F.; Fukazawa, H.; Makino, M. Occurrence and estrogenicity of phenolics in paper-recycling process water: pollutants originating from thermal paper in waste paper. Environ. Toxicol. Chem. 2007, 26 (11), 2356−2366. (20) Kuruto-Niwa, R.; Nozawa, R.; Miyakoshi, T.; Shiozawa, T.; Terao, Y. Estrogenic activity of alkylphenols, bisphenol S, and their chlorinated derivatives using a GFP expression system. Environ. Toxicol. Pharmacol. 2005, 19 (1), 121−130. (21) Goldinger, D. M.; Demierre, A. L.; Zoller, O.; Rupp, H.; Reinhard, H.; Magnin, R.; Becker, T. W.; Bourqui-Pittet, M. Endocrine activity of alternatives to BPA found in thermal paper in Switzerland. Regul. Toxicol. Pharmacol. 2015, 71, 453−462. (22) Kwon, B.; Shin, H.; Moon, H. B.; Ji, K.; Kim, K. T. Effects of tris(2-butoxyethyl) phosphate exposure on endocrine systems and reproduction of zebrafish (Danio rerio). Environ. Pollut. 2016, 214, 568−574. (23) Chen, J.; Xiao, Y.; Gai, Z.; Li, R.; Zhu, Z.; Bai, C.; Tanguay, R. L.; Xu, X.; Huang, C.; Dong, Q. Reproductive toxicity of low level bisphenol A exposures in a two-generation zebrafish assay: evidence of male-specific effects. Aquat. Toxicol. 2015, 169, 204−214. (24) Pradhan, A.; Olsson, P. E. Zebrafish sexual behavior: role of sex steroid hormones and prostaglandins. Behav. Brain Funct. 2015, 11, 23. (25) Hutchinson, T. H.; Ankley, G. T.; Segner, H.; Tyler, C. R. Screening and testing for endocrine disruption in fish − biomarkers as “signposts,” not “traffic lights,” in risk assessment. Environ. Health Perspect. 2006, 114 (1), 106−114. (26) Van den Belt, K.; Verheyen, R.; Witters, H. Reproductive effects of ethynylestradiol and 4t-octylphenol on the zebrafish (Danio rerio). Arch. Environ. Contam. Toxicol. 2001, 41 (4), 458−467. (27) Yang, F. X.; Xu, Y.; Hui, Y. Reproductive effects of prenatal exposure to nonylphenol on zebrafish (Danio rerio). Comp. Biochem. Physiol., Part C: Toxicol. Pharmacol. 2006, 142 (1−2), 77−84. (28) Hinfray, N.; Baudiffier, D.; Leal, M. C.; Porcher, J. M.; Aït-Aïssa, S.; Le Gac, F.; Schulz, R. W.; Brion, F. Characterization of testicular expression of P450 17α-hydroxylase, 17,20-lyase in zebrafish and its

BPSIP likely persists longer in the environment (log Kow = 3.36) than BPS (log Kow = 1.65) or BPA (log Kow = 3.32) does, the toxicological consequences of its presence in ecosystems should receive more attention.

■

ASSOCIATED CONTENT

* Supporting Information S

The Supporting Information is available free of charge on the ACS Publications website at DOI: 10.1021/acs.est.7b00498. Detail information on analytical conditions using LCMS/MS, parameters for chemical analysis and method detection limits, recovery and precision, linearity of the calibration curves, results of nominal and measured concentrations, spearman correlation coefficients between transcriptions of the genes along the HPG axis, and principal component analysis (PDF)

■

AUTHOR INFORMATION

Corresponding Author

*Tel: 82-31-8020-2747. Fax: 82-31-8020-2886. E-mail: [email protected]. ORCID

Kyunghee Ji: 0000-0001-8123-7445 Notes

The authors declare no competing financial interest.

■ ■

ACKNOWLEDGMENTS This study was supported by National Research Foundation of Korea (NRF; Project no. 2015R1D1A1A01056628). REFERENCES

(1) Richter, C. A.; Birnbaum, L. S.; Farabollini, F.; Newbold, R. R.; Rubin, B. S.; Talsness, C. E.; Vandenbergh, J. G.; Walser-Kuntz, D. R.; vom Saal, F. S. In vivo effects of bisphenol a in laboratory rodent studies. Reprod. Toxicol. 2007, 24 (2), 199−224. (2) Huang, Y. Q.; Wong, C. K.; Zheng, J. S.; Bouwman, H.; Barra, R.; Wahlström, B.; Neretin, L.; Wong, M. H. Bisphenol A (BPA) in China: a review of sources, environmental levels, and potential human health impacts. Environ. Int. 2012, 42, 91−99. (3) Rochester, J. R. Bisphenol a and human health: a review of the literature. Reprod. Toxicol. 2013, 42, 132−155. (4) Eladak, S.; Grisin, T.; Moison, D.; Guerquin, M. J.; N’TumbaByn, T.; Pozzi-Gaudin, S.; Benachi, A.; Livera, G.; Rouiller-Fabre, V.; Habert, R. A new chapter in the bisphenol A story: bisphenol S and bisphenol F are not safe alternatives to this compound. Fertil. Steril. 2015, 103 (1), 11−21. (5) ECHA. Annex XV Restriction Report, Proposal for a restriction. Substance Name: 4.4′-isopropylidenediphenol (bisphenol A; BPA), 2014. https://echa.europa.eu/documents/10162/c6a8003c-81f3-4df6b7e8-15a3a36baf76 (accessed January 2017). (6) U.S. Environmental Protection Agency (EPA). Bisphenol A Alternatives in Thermal Paper. Final Report, January 2014.http:// www.epa.gov/sites/production/files/2015-08/documents/bpa_final. pdf (accessed July 2016). (7) Liao, C.; Kannan, K. A survey of alkylphenols, bisphenols, and triclosan in personal care products from China and the United States. Arch. Environ. Contam. Toxicol. 2014, 67 (1), 50−59. (8) Liao, C.; Liu, F.; Kannan, K. Bisphenol S, A new bisphenol analogue, in paper products and currency bills and its association with bisphenol A residues. Environ. Sci. Technol. 2012, 46 (12), 6515−6522. (9) Thayer, K. A.; Taylor, K. W.; Garantziotis, S.; Schurman, S. H.; Kissling, G. E.; Hunt, D.; Herbert, B.; Church, R.; Jankowich, R.; Churchwell, M. I.; Scheri, R. C.; Birnbaum, L. S.; Bucher, J. R. Bisphenol A, bisphenol S, and 4-hydroxyphenyl 4-isoprooxyphenylG


Article

Environmental Science & Technology perturbation by the pharmaceutical fungicide clotrimazole. Gen. Comp. Endocrinol. 2011, 174 (3), 309−317. (29) Mindnich, R.; Haller, F.; Halbach, F.; Moeller, G.; Hrabé de Angelis, M.; Adamski, J. Androgen metabolism via 17beta-hydroxysteroid dehydrogenase type 3 in mammalian and non-mammalian vertebrates: comparison of the human and the zebrafish enzyme. J. Mol. Endocrinol. 2005, 35 (2), 305−316. (30) Kallivretaki, E.; Eggen, R.; Neuhauss, S.; Alberti, M.; Kausch, U.; Segner, H. Aromatase in zebrafish: a potential target for endocrine disrupting chemicals. Mar. Environ. Res. 2006, 62, S187−S190. (31) Trant, J. M.; Gavasso, S.; Ackers, J.; Chung, B. C.; Place, A. R. Developmental expression of cytochrome P450 aromatase genes (CYP19a and CYP19b) in zebrafish fry (Danio rerio). J. Exp. Zool. 2001, 290, 475−483. (32) Schulz, R. W.; de França, L. R.; Lareyre, J.; LeGac, F.; ChiariniGarcia, H.; Nobrega, R. H.; Miura, T. Spermatogenesis in fish. Gen. Comp. Endocrinol. 2010, 165 (3), 390−411. (33) Ohta, T.; Miyake, H.; Miura, C.; Kamei, H.; Aida, K.; Miura, T. Follicle-stimulating hormone induces spermatogenesis mediated by androgen production in Japanese eel. Biol. Reprod. 2007, 77 (6), 970− 977. (34) Wisniewski, P.; Romano, R. M.; Kizys, M. M. L.; Oliveira, K. C.; Kasamatsu, T.; Giannocco, G.; Chiamolera, M. I.; Dias-da-Silva, M. R.; Romano, M. A. Adult exposure to bisphenol A (BPA) in Wistar rats reduces sperm quality with disruption of hypothalamic-pituitarytesticular axis. Toxicology 2015, 329, 1−9. (35) Jin, P.; Wang, X.; Chang, F.; Bai, Y.; Li, Y.; Zhou, R.; Chen, L. Low dose bisphenol A impairs spermatogenesis by suppressing reproductive hormone production and promoting germ cell apoptosis in adult rats. J. Biomed Res. 2013, 27 (2), 135−144. (36) Ji, K.; Choi, K. Endocrine disruption potentials of bisphenol A alternatives − are bisphenol A alternatives safe from endocrine disruption? Hangug Hwangyeong Bogeon Haghoeji 2013, 39 (1), 1−18. (37) Ma, Y.; Han, J.; Guo, Y.; Lam, P. K. S.; Wu, R. S. S.; Giesy, J. P.; Zhang, X.; Zhou, B. Disruption of endocrine function in in vitro H295R cell-based and in in vivo assay in zebrafish by 2,4dichlorophenol. Aquat. Toxicol. 2012, 106−107, 173−181. (38) Qiu, W.; Zhao, Y.; Yang, M.; Farajzadeh, M.; Pan, C.; Wayne, N. L. Actions of bisphenol A and bisphenol S on the reproductive neuroendocrine system during early development in zebrafish. Endocrinology 2016, 157 (2), 636−647. (39) Catanese, M. C.; Vandenberg, L. N. Bisphenol S (BPS) alters maternal behavior and brain in mice exposed during pregnancy/ lactation and their daughters. Endocrinology 2017, 158 (3), 516−530. (40) Ullah, H.; Jahan, S.; Ain, Q. U.; Shaheen, G.; Ahsan, N. Effect of bisphenol S exposure on male reproductive system of rats: a histological and biochemical study. Chemosphere 2016, 152, 383−391.

H


(BPSIP) Exposure on Reproduction and Endocrine ... - ACS Publications

Recommend Documents