Building a Molecular Trap for a Serine Protease from Aptamer and

Subscriber access provided by Western Michigan University

Article

Building a molecular trap for a serine protease from aptamer and peptide modules Daniel M. Dupont, Nils Bjerregaard, Ben Verpaalen, Peter A. Andreasen, and Jan Kristian Jensen Bioconjugate Chem., Just Accepted Manuscript • DOI: 10.1021/acs.bioconjchem.6b00007 • Publication Date (Web): 01 Mar 2016 Downloaded from http://pubs.acs.org on March 2, 2016

Just Accepted “Just Accepted” manuscripts have been peer-reviewed and accepted for publication. They are posted online prior to technical editing, formatting for publication and author proofing. The American Chemical Society provides “Just Accepted” as a free service to the research community to expedite the dissemination of scientific material as soon as possible after acceptance. “Just Accepted” manuscripts appear in full in PDF format accompanied by an HTML abstract. “Just Accepted” manuscripts have been fully peer reviewed, but should not be considered the official version of record. They are accessible to all readers and citable by the Digital Object Identifier (DOI®). “Just Accepted” is an optional service offered to authors. Therefore, the “Just Accepted” Web site may not include all articles that will be published in the journal. After a manuscript is technically edited and formatted, it will be removed from the “Just Accepted” Web site and published as an ASAP article. Note that technical editing may introduce minor changes to the manuscript text and/or graphics which could affect content, and all legal disclaimers and ethical guidelines that apply to the journal pertain. ACS cannot be held responsible for errors or consequences arising from the use of information contained in these “Just Accepted” manuscripts.

Bioconjugate Chemistry is published by the American Chemical Society. 1155 Sixteenth Street N.W., Washington, DC 20036 Published by American Chemical Society. Copyright © American Chemical Society. However, no copyright claim is made to original U.S. Government works, or works produced by employees of any Commonwealth realm Crown government in the course of their duties.

Page 1 of 17

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Bioconjugate Chemistry

Building a molecular trap for a serine protease from aptamer and peptide modules

Daniel M. Dupont*, Nils Bjerregaard, Ben Verpaalen, Peter A. Andreasen and Jan K. Jensen

Department of Molecular Biology and Genetics, Aarhus University, Gustav Wieds Vej 10C, 8000 Aarhus, Denmark

*Corresponding author: Science park, Gustav Wieds Vej 10C, 8000 Aarhus C, Denmark, Phone: +45 87155542, Fax: +45 86123178 E-mail: [email protected]

ABSTRACT In drug development, molecular intervention strategies are usually based on interference with a single protein function, like enzyme activity or receptor binding. However, in many cases, protein drug targets are multi-functional, with several molecular functions contributing to their pathophysiological actions. Aptamers and peptides are interesting synthetic building blocks for the design of multi-valent molecules capable of modulating multiple functions of a target protein. Here, we report a molecular trap with the ability to interfere with activation, catalytic activity, receptor binding, etc. of the serine protease urokinase-type plasminogen activator (uPA) by a rational combination of two RNA aptamers and a peptide with different inhibitory properties. The assembly of these artificial inhibitors into one molecule enhanced the inhibitory activity between 10 and 10,000 fold towards several functions of uPA. The study highlights the potential of multi-valent designs and illustrates how they can easily be constructed from aptamers and peptides using nucleic acid engineering, chemical synthesis and bioconjugation chemistry. By aptamer to aptamer and aptamer to peptide conjugation, we created, to the best of our knowledge, the first tri-valent molecule which combines three artificial inhibitors binding to three different sites in a protein target. We hypothesize that by simultaneously preventing all of the functional interactions and activities of the target protein, this approach may represent an alternative to siRNA technology for a functional knock-out.

TABLE OF CONTENTS GRAPHICS

ACS Paragon Plus Environment


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

INTRODUCTION The physiological and pathophysiological functions of many proteins depend on several molecular interactions, each often associated with different folded protein domains. For instance, trypsin-like serine proteases contain, besides their C-terminal catalytic domains, multiple types of domains, e.g. epidermal growth factor-like (EGF-like) domains, Gla domains, kringles, CUB domains, SEA domains, and low density receptor class A domains

1,2

. Such domains confer to the enzymes

receptor-binding properties, membrane association and binding properties, cofactor interactions, and augmentation of binding of serpin inhibitors. One serine protease of particular interest in this respect is urokinase-type plasminogen activator (uPA), consisting of, as mentioned from the N-terminus, an EGF-like domain, a kringle, and a catalytic domain 3. The function of its catalytic domain is the hydrolysis of a specific peptide bond in the zymogen plasminogen, thereby converting it to the active serine protease plasmin. Plasmin in turn catalyzes the degradation of matrix proteins such as fibrin and laminin, and is also able to catalyze the proteolytic activation of zymogen forms of metalloproteases and uPA (pro-uPA). The EGF-like domain of uPA binds to the membrane-anchored urokinase-type plasminogen activator receptor (uPAR) on target cells. As plasminogen binds to C-terminal lysines on cell surfaces, co-localization of the two enzymes leads to reciprocal zymogen activation and accumulation of plasmin activity at the cell surface, enabling the cell to perform site-specific proteolytic processing. In addition, the binding of uPA to uPAR also enhances the affinity of uPAR to the extracellular matrix protein vitronectin and thus confers uPAR with a pro-adhesive function

4,5

. Furthermore, the interaction between uPAR and

6

vitronectin induces cytoskeletal rearrangements . uPA plays an important role for cell migration, cell invasion and tissue remodeling in the healthy organism, but is also a validated mediator of cancer metastasis and a prognostic marker in cancer 3,7. To interfere with pathophysiological functions of serine proteases, a variety of chemically diverse inhibitors have been designed. In most cases, such inhibitors have been directed towards the proteolytic activity. In other cases, it has proved possible to inhibit receptor or cofactor binding or membrane association. A recurrent theme has been the specific intervention by each agent with a specific molecular interaction. The perspective has been that different molecular interactions of one and the same molecule may have different physiological functions and therefore must be modulated individually in order to achieve specific pharmacological effects. In the case of uPA, direct inhibitors of the protease activity have been developed in the form of small molecules, antibodies, or peptides 8– 10

; inhibitors of zymogen activation in the form of antibodies or RNA aptamers 11–13; and inhibitors of

uPAR-binding in the form of peptides, antibodies, or RNA aptamers 12,14–16. RNA aptamers binding to specific protein targets can be selected from libraries with up to 1015 different sequences by a procedure known as systematic evolution of ligands by exponential enrichment (SELEX)

17–19

. Despite consisting of only 4 building blocks (nucleotides), the individual

aptamers can achieve high affinity and high specificity for specific protein targets due to their ability


Page 2 of 17

Page 3 of 17

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


to adopt unique three-dimensional structures. Aptamers can affect the biochemical functions of proteins by sterical hindrance of molecular interactions and/or by induction of conformational changes 20

. As aptamers can be produced by chemical synthesis, they are often termed chemical antibodies. We

have previously reported the isolation of several RNA aptamers binding to components of the plasminogen activation system 12,15,21,22. This includes two 2´-fluoropyrimidine RNA aptamers binding to different epitopes of uPA. One of them, upanap-12, binds to the amino-terminal fragment of uPA (the kringle and EGF-like domains), while the other, upanap-126, binds to an epitope in the catalytic domain

13

. In spite of their different epitopes, the two have overlapping functions, as both inhibit

activation of pro-uPA, uPAR binding, and binding to the endocytosis receptor low density lipoprotein receptor-related protein 1A (LRP-1A). In addition, upanap-126 is able to interfere with the binding of pro-uPA:uPAR complexes to vitronection. uPA-binding aptamers have been shown to be able to inhibit uPA-mediated tumor cell invasion and dissemination in vivo 12.

Figure 1. Aptamer and peptide building blocks used for conjugation. From the left, the predicted secondary structures for full-length 2´-F-pyrimidine RNA aptamer upanap-12, the shorter upanap-12 variants (upanap-12.33 and -12.49) and upanap-126. Duplex regions are highlighted using grey boxes. To the right, the amino acid sequence of the competitive inhibitor upain-1* is illustrated. The peptide carries the reactive amino acid analogue aminooxyLysine (aoL) in position 14 to enable specific conjugation of the peptide to the 3´-end of RNA. The peptide was acetylated (Ac) and amidated (CONH2) at the terminals. Secondary structure prediction was performed using the mfold Web Server (http://unafold.rna.albany.edu/?q=mfold).

Using a phage-displayed library of disulfide-bridge constrained cyclic peptides we identified upain-1 (CSWRGLENHRMC), a competitive inhibitor of the proteolytic activity of human uPA 8. Although highly specific for human uPA, its affinity to the enzyme was modest, with a Ki of approximately 35 µM. An N-terminally extended version had a somewhat improved inhibitory activity, with a Ki close to 2 µM

23

. We have reported the X-ray crystal structure of upain-1 in

24

complex with human uPA .



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 4 of 17

In this study, we investigate a different strategy for intervening with the molecular functions of a multi-functional serine protease. Here, we combine several different inhibitors of uPA into one molecule to create a hetero-multivalent inhibitor. We demonstrate that by combining two uPA-binding aptamers we achieve much more efficient inhibitory activities towards pro-uPA activation and uPAR binding compared to those of the individual aptamers. Bioconjugation of the bi-valent aptamer to a variant of upain-1 further expands the inhibitory repertoire and ultimately creates a single molecule capable of interfering with all of the tested functions of uPA. The study highlights the potential of multi-valent designs and illustrates how they can easily be constructed from aptamers and peptides using nucleic acid engineering, chemical synthesis and bioconjugation chemistry.

RESULTS AND DISCUSSION Serine proteases are multi-functional enzymes for which several activities and functional sites contribute to their physiological and pathophysiological actions. For uPA it has been shown that interfering with catalytic activity directly, pro-uPA activation and uPA association to uPAR on the cell surface are all validated and attractive targets for pharmacological intervention with cancer metastasis 12,25

and potentially in other degenerative diseases, like arthritis 26. Typical strategies for intervention

with the pathological functions of uPA, however, target a single function at a time, thereby leaving other functional sites or activities unaffected. This strategy may in some respects represent an advantage in terms of functional specificity, as different molecular interactions of one and the same molecule may have different physiological and pathophysiological functions. Nevertheless, we here decided to investigate the possibility of engineering multi-functional inhibitors of uPA by the assembly of existing aptamers and peptide ligands identified by SELEX and screening of phagedisplayed peptide libraries, respectively. RNA aptamer and peptide modules - For constructing multi-valent molecules directed towards uPA we used the following building blocks (Figure 1): 1) Truncated variants of upanap-12 (79 nucleotides), upanap-12.49 and upanap-12.33 (49 and 33 nucleotides, respectively) 15. Upanap-12 binds to the amino terminal fragment (ATF) of uPA (Figure 2)

13

. 2) Full-length RNA aptamer

upanap-126 (Figure 1) 12, which binds to the serine protease domain of uPA outside the catalytic site (Figure 2) 13. 3) A variant of the disulphide bond-constrained upain-1 peptide 8 with the amino acid sequence ADGACSWRGLENH(aminooxyLys)AC (referred to as upain-1*; Figure 1). The crystal structure of upain-1 (CSWRGLENHRMC) with uPA shows how the peptide binds at the catalytic site of the serine protease domain (Figure 2)

24

. Compared to upain-1, upain-1* contains an N-terminal

ADGA extension, which improves competitive inhibition of uPA catalytic activity more than 10-fold 23

. In addition, position 10 and 11 of upain-1 are solvent exposed in the uPA:upain-1 complex and

unimportant for the inhibitory activity

8,24

. They were therefore replaced by a lysine analogue with a

reactive aminooxy group (aminooxyLys) and an alanine, respectively. Although both types of ligands can be generated by chemical synthesis, we chose to produce and combine aptamer building blocks by


Page 5 of 17

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


transcription (126-12.33 and 126-12.49). Coupling of the upain-1* peptide to the bi-valent aptamer was subsequently accomplished using the reactive amino acid analogue in the peptide, thus allowing site-specific RNA-peptide conjugation by bioconjugation chemistry (Figure 3).

Figure 2. The binding sites of RNA aptamer and peptide building blocks in uPA. (A). Surface representations of the amino-terminal fragment (growth factor and kringle domains) and the serine protease domain of uPA according to the crystal structures with PDB ID 2I9A and 2NWN, respectively. In the full-length protein, the two uPA fragments are connected by an interdomain linker. Site-directed mutagenesis previously identified residues important for binding of the aptamers upanap12 (blue; N22, K23, Y24, W30, K46, K48, K61 and K98) and upanap-126 (red; Y284, R323, K338 and R391) 13. The active site of uPA is located on the opposite side of the upanap-126 binding site in the uPA catalytic domain and is not visible in this orientation. (B). The crystal structure of the complex between the serine protease domain and upain-1 (PDB ID 2NWN) demonstrating that the peptide, besides binding in the active site, has an extended interaction surface with uPA. Nevertheless, the side chain of amino acid number 10 in upain-1 (number 14 in upain-1*) is solvent exposed (marked with a *). The active site serine 195 residue (chymotrypsinogen template numbering) is shown in cyan. The catalytic domain in B is rotated approximately 180⁰ around a vertical axis relative to the catalytic domain in A. The figure was prepared using PyMOL (https://www.pymol.org/).



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Figure 3. Strategy for the chemical conjugation of bi-valent aptamer 126-1233 and upain-1*. Step 1: Periodate oxidation of the 3´-ribonucleotide of 126-1233. Step 2: Formation of a stable RNApeptide conjugate by reaction of the 3´-aldehyde of the RNA with the aminooxyLys of the upain-1* peptide. For more details see the Experimental Procedures.

Multi-valent constructs – An overview of the multi-valent constructs described here is found in Table 1. RNA aptamer constructs 126-12.33 and 126-12.49 were produced by adding the corresponding DNA sequences of upanap-12.33 and upanap-12.49 aptamers to the double-stranded DNA transcription template of full-length upanap-126 followed by RNA transcription. The upanap126 sequence includes the 5´ and 3´ primer binding regions, which are necessary during the aptamer selection procedure, but usually unimportant for target binding. Secondary structure prediction for upanap-126 (Figure 1) therefore suggests that the 3´-constant region of upanap-126 provides a flexible single-stranded linker sequence between the two aptamer modules. For the construction of aptamer-peptide conjugates 126-12.33-upain-1* and 126-12.49-upain-1*, the 3´-end of the RNA constructs included an additional 8-nucleotide linker sequence to similarly separate the truncated upanap-12 aptamer modules from the upain-1* peptide by a flexible molecular spacer. The upain-1* peptide was coupled to RNA 3´-ends using the aminooxyLys residue, which efficiently reacts with 3´ribonucleotide aldehydes produced by periodate oxidation (Figure 3). Successful reaction and purity of the products was confirmed by band-shift analysis on denaturing polyacrylamide gels (Figure S1).

Table 1. Multi-valent constructs described in this study. Conjugate*

Sequence

126-12.33

GGGGCCACCAACGACAUUCAUUCGCACGCUGUGUGGGGAUUAGUCCCG AUGUUGUUGAUAUAAAUAGUGCCCAUGGAUCGGUGCGACUGUUAUAACC UAACAGCGACGUACC


Page 6 of 17

Page 7 of 17

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


126-12.49

GGGGCCACCAACGACAUUCAUUCGCACGCUGUGUGGGGAUUAGUCCCG AUGUUGUUGAUAUAAAUAGUGCCCAUGGAUCGGACGACAUUUGCGACU GUUAUAACCUAACAGCGACGUAAAGAUAGUCC

126-12.33-upain-1*

GGGGCCACCAACGACAUUCAUUCGCACGCUGUGUGGGGAUUAGUCCCG AUGUUGUUGAUAUAAAUAGUGCCCAUGGAUCGGUGCGACUGUUAUAACC UAACAGCGACGUACCGAAGGGUA-upain-1*

126-12.49-upain-1*

GGGGCCACCAACGACAUUCAUUCGCACGCUGUGUGGGGAUUAGUCCCG AUGUUGUUGAUAUAAAUAGUGCCCAUGGAUCGGACGACAUUUGCGACU GUUAUAACCUAACAGCGACGUAAAGAUAGUCCGAAGGGUA-upain-1*

*Construct names are based on the building blocks used. Hence, 126-12.33 is the RNA transcript of upanap-126 followed by upanap-12.33 and so forth. The upanap-126 sequence is shown as black letters on a white background. Upanap-12.33 and -12.49 sequences are shown as white letters on a black background. The 8-nucleotide long nucleic acid linker sequence between 126-12.33 or 12612.49 and the upain-1* peptide is shown as black letters on a grey background.

Figure 4. The effect of aptamer conjugation on the ability to inhibit the binding of uPA to uPAR. The binding of 125I-pro-uPA (10 pM) to U937 cells was determined in the presence of RNA variants at the indicated concentrations. In the case of the mixture of the individual aptamers (Up-12 + Up-126) the samples contained each of the two aptamers at the indicated concentrations at a 1:1 ratio. Binding levels were normalized to the binding level observed without additions. Shown average binding levels and standard deviations are based on at least three independent experiments.

Aptamer conjugation potentiates aptamer-mediated interference with uPA – uPA receptor binding - One important function of uPA is to direct the generation of plasmin to cell-surfaces carrying its receptor uPAR thereby providing cells with the necessary proteolytic potential for migration and invasion events. Moreover, uPA-uPAR receptor binding induces cell signaling through uPAR-associated cell surface receptors which can lead to cytoskeletal changes of importance for motility as well as rescue from apoptosis

27,28

. In addition, the conformational change in uPAR upon



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

uPA binding exposes binding sites in the receptor for the extracellular matrix protein vitronectin enabling cell adhesion 29. We initially investigated the effect of conjugating the two uPA aptamers into one bivalent molecule, i.e. 126-12.33 or 126-12.49. We tested the ability of the different aptamer constructs to interfere with the binding of

125

I-labelled pro-uPA to U937 cells, which express the uPA receptor,

uPAR (Figure 4). As found previously 13, both full-length upanap-12 and -126 aptamers are able to dose-dependently inhibit 125I-labelled pro-uPA binding to U937 cells (IC50-values = 1.6 ± 0.6 nM and 500 ± 50 nM, respectively), whereas a control RNA sequence does not inhibit binding. The shorter variants of upanap-12, i.e. upanap-12.33 and -12.49, inhibit the interaction with an IC50-value similar to that of the full-length version (2.6 ± 0.3 nM and 1.7 ± 0.9 nM). No significant additive effect was observed when adding a mixture of the upanap-12 and -126 aptamers to 125I-labelled pro-uPA prior to incubation with U937 cells (IC50 = 2.0 ± 0.8 nM). However, direct conjugation of the aptamers into bivalent constructs resulted in significantly more efficient inhibition of the uPA-uPAR interaction (IC50-values 82 ± 50 pM and 81 ± 24 pM for 126-12.33 and -12.49, respectively). Hence, the covalent assembly of the two aptamers into one molecule increases the collective inhibitory activity 20-25-fold. Accordingly, a qualitative surface plasmon resonance binding analysis suggests a dramatically reduced rate of dissociation of uPA from the aptamer conjugate compared to the individual aptamers (Figure S2). Aptamer conjugation potentiates aptamer-mediated inhibition of pro-uPA activation – uPA is synthesized as a single-chain pro-enzyme (pro-uPA), requiring proteolytic processing to become an efficient activator of plasminogen. Both upanap-12 and -126 interfere with pro-uPA activation by plasmin

12,13

. The effect of aptamer conjugation was therefore also investigated using a

pro-uPA – plasminogen reciprocal zymogen activation assay. Upon mixing pro-uPA and plasminogen in solution, trace amounts of proteolytic activity will eventually initiate a self-reinforcing (reciprocal) activation of plasminogen to plasmin by uPA and pro-uPA to uPA by plasmin. The progress of the reaction over time can be monitored using a chromogenic substrate for plasmin. In Figure 5A, reciprocal zymogen activation is followed in the presence of increasing concentrations of control RNA, which does not affect the reaction. However, with upanap-126 and -12.33, a dose-dependent delay in the reaction is observed (Figure 5B and 5C). The simultaneous addition of the two aptamers does not lead to any significant improvement of the inhibitory activity (Figure 5D). On the contrary, just 50 pM of the bi-valent aptamer 126-12.33 inhibits reciprocal zymogen activation to the same extent as an equimolar mixture of 50 nM upanap-126 and 50 nM upanap-12.33 (Figure 5E). Hence, covalent conjugation of the two aptamers enhances the inhibitory activity towards plasmin-mediated pro-uPA activation at least 1000-fold. The enhancement may be even larger but cannot be determined exactly due to the concentration of pro-uPA used (50 pM). Similar results were obtained when conjugating upanap-126 and upanap-12.49 (data not shown). In an additional experiment it was


Page 8 of 17

Page 9 of 17

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


confirmed that 126-1233, as previously shown for the individual aptamers, interferes directly with prouPA activation (Figure S3).

Figure 5. The effect of multi-valent aptamer-peptide constructs on reciprocal zymogen activation. Pro-uPA and plasminogen was mixed and the reciprocal reaction of uPA-mediated plasminogen activation and plasmin-mediated pro-uPA activation monitored by plasmin specific chromogenic substrate turnover (absorbance at 405 nm) over time. The following additions were included in a 10-fold dilution series from 50 nM to 5 pM: control RNA (A), upanap-126 (B), upanap12.33 (C) upanap-12 + upanap-12.33 (D), bi-valent aptamer 126-12.33 (E), and tri-valent aptamerpeptide construct (F). The shown figures each represent one of three similar experiments. For each curve the absorbance (A405 nm) at time 0 was subtracted. At around A405 nm = 1, substrate conversion was complete. The addition of 50 nM upain-1* alone relative to no addition caused no significant effect (data not shown).

The addition of the upain-1* peptide to the bi-valent 126-12.33 aptamer dramatically enhances the inhibition of reciprocal zymogen activation - Interestingly, the results with 126-12.33 show that saturating concentrations of the bi-valent aptamer, can only delay pro-uPA activation and reciprocal zymogen activation to a certain extent (Figure 5E). This may stem from the fact that the binding sites of the two aptamers do not overlap with the pro-uPA activation site. Hence, although the bulky aptamers hinder the access of plasmin to the cleavage site, they do not block it completely. Furthermore, once uPA is formed, the two aptamers are unable to interfere directly with the catalytic activity of uPA, i.e. uPA-mediated plasminogen activation

12,15

. As a consequence, although the bi-

valent aptamer conjugates efficiently interfere with pro-uPA activation, catalytically active uPA will eventually be generated. Therefore, to enable more efficient inhibition of reciprocal zymogen activation, a tri-valent construct was created including the competitive uPA active site inhibitor upain-



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

1* (126-12.33-upain-1*). Figure 5F demonstrates that the conjugation of upain-1* to the bivalent 126-12.33 aptamer molecule inhibits reciprocal zymogen activation beyond detection in the current experimental setup, as soon as the conjugate concentration exceeds the concentration of pro-uPA in the assay (50 pM). In summary, engineering conjugates containing upain-1 (126-12.33/12.49-upain1*) enables inhibition of generated uPA as well, silencing uPA catalyzed reactions almost completely. Specifically, the attachment of upain-1 to the aptamer conjugates seems to enhance the inhibitory activity of the peptide towards uPA-mediated plasminogen activation from the micromolar to the subnanomolar range. Coupling the upain-1* module to the aptamers provides potent inhibition of uPAmediated plasminogen activation - To decipher the significance of aptamer-upain-1* conjugation in more detail, we examined the ensuing effect exclusively on uPA-mediated plasminogen activation. In agreement with previous studies of upain-1 variants

23

, the upain-1* peptide is a low-micromolar

inhibitor of uPA-mediated plasminogen activation (IC50 of around 5 µM with and without the aminooxylysine; Figure 6). However, the conjugation of upain-1* to 126-12.33 improves the inhibitory activity by more than 10,000-fold (IC50 around 0.2 nM; Figure 6). As expected, preincubation of uPA with aptamer constructs (upanap-126, -12.33, and 126-12.33) did not affect plasminogen activation significantly at a concentration of 100 nM (data not shown). In addition, no significant inhibitory effect was observed when adding the mixture of 100 nM 126-12.33 and 100 nM upain-1* (data not shown). To test the specificity of 126-12.33-upain-1*, we investigated the effect of the aptamer-peptide construct on the plasminogen activation by another serine protease plasminogen activator, i.e. tissue-type plasminogen activator (tPA). Pre-incubation of 200 nM 126-12.33-upain-1* with tPA did not significantly affect the conversion of plasminogen to plasmin relative to no addition (data not shown).

Figure 6. The effect of conjugating upain-1* to 126-12.33 on uPA-mediated plasminogen activation. uPA and plasminogen were mixed and uPA-mediated plasminogen activation measured by the turnover of a plasmin specific chromogenic substrate (absorbance at 405 nm). The rate of


Page 10 of 17

Page 11 of 17

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


plasminogen activation was determined in the presence of increasing concentration of ADGACSWRGLENH(aminooxyLys)AC (upain-1*; black triangles), ADGACSWRGLENHAAC (white squares) or 126-12.33-upain-1* (black circles). Shown are the average relative rates of plasminogen activation and standard deviations based on at least three independent experiments.

The tri-valent 126-12.33-upain-1* aptamer-peptide construct retains the ability to interfere with pro-uPA-LRP binding and pro-uPA:uPAR. Apart from inhibiting pro-uPA activation and uPA-uPAR binding, both aptamers also interfere with the interaction of uPA with the endocytosis receptor LRP-1A 13. In addition, upanap-126 appears to extend from the binding site in the serine protease domain to interfere with the interaction of the pro-uPA:uPAR complex with vitronectin 12,13

. We conducted surface plasmon resonance analysis to investigate the effect of 126-12.33-upain-1*

on these interactions. Firstly, both aptamer (126-12.33) and aptamer-peptide (126-12.33-upain-1*) conjugates retain the ability to prevent pro-uPA from binding to a sensor surface containing immobilized LRP (Figure 7A). Secondly, incorporating upanap-126 into the two constructs does not affect the ability of this aptamer to interfere with the binding of pro-uPA:uPAR complexes to a sensor surface with immobilized vitronectin (Figure 7B). However, as the assays are incompatible with subnanomolar concentrations of pro-uPA and pro-uPA:uPAR, respectively, we could not determine whether aptamer and aptamer-peptide conjugation stimulate the inhibitory activities.

Figure 7. Conjugates retain the ability to inhibit pro-uPA – LRP and pro-uPA:uPAR – vitronectin binding – Inhibitory activities were determined by surface plasmon resonance analysis. (A). Pro-uPA (25 nM) in the presence of aptamer and aptamer-peptide constructs (150 nM) was passed over a sensor surface coupled with LRP. The pro-uPA binding level in each case was normalized compared to the addition of control RNA. (B). The binding of 10 nM pro-uPA:uPAR complex to a vitronectin (VN) sensor surface was determined in the presence of aptamer and aptamerpeptide constructs (50 nM). Binding levels were normalized relative to the samples with control RNA.



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 12 of 17

Average binding levels and standard deviation are the results of at least three independent experiments.

Combining aptamers and conjugating aptamers to peptides have previously been shown to be efficient methods of improving inhibitory activities within the serine protease field. Thrombin-binding DNA aptamers HD-1 and HD-22 targeting exosite I and II of the protease, respectively, have been combined using various linkers by different groups to enhance affinities and inhibitory activities

20

.

One conjugate of the aptamers (HD1-22) was found to prolong blood coagulation time 30-fold more potently than HD-1 alone

30

. For the dual-function hepatitis C virus non-structural protein 3 (HCV

NS3), RNA aptamers binding both the serine protease moiety and the helicase moiety were selected 20. Linking the two resulted in an aptamer constructs with subnanomolar affinity and superior dual inhibitory activity

31

. Finally, a DNA aptamer for neutrophil elastase with no inhibitory activity

towards hydrolysis of small artificial chromogenic substrates was covalently tethered to a weak active site tetrapeptide inhibitor (Ki ~1 mM), which generated a conjugate inhibiting the protease with a Ki of ~28 nM 32. Here, we combined aptamer - aptamer and aptamer - peptide conjugation. To the best of our knowledge, we have succeeded in creating the first tri-valent molecule, which combines three artificial inhibitors that bind to three different sites in the same protein. We are confident that the inhibitory activities of each of the individual modules are maintained and potentiated by the conjugation. Rational assembly of specific ligands for the same target therefore represents a promising strategy for improving the inhibitory activity of existing inhibitors. Furthermore, as the trimeric heterovalent inhibitor prevents interaction with all of the functional sites of uPA, our approach may illustrate an alternative approach to siRNA technology for complete functional knock-out of proteins.

EXPERIMENTAL PROCEDURES Proteins – Recombinant purified human pro-uPA was a kind gift from Abbott Laboratories (Abbott Park). Human uPA was purchased from Wakamoto. Glu-plasminogen purified from human plasma was a kind gift from Lars Sottrup-Jensen (Aarhus University, Aarhus, Denmark). Human soluble uPAR lacking the glycolipid anchor (residues 1–283) was a kind gift from Michael Ploug (Rigshospitalet, Copenhagen, Denmark). RNA and conjugates – 2´-F-pyrimidine RNA was transcribed as described

15

in a reaction

containing 80 mM HEPES (pH 7.5), 30 mM DTT, 25 mM MgCl2, 2 mM spermidine-HCl, 2.5 mM ATP and GTP (Thermo Scientific), and 2.5 mM 2′-F-dCTP and 2′-F-dUTP (TriLink Biotechnologies), 100 µg/mL bovine serum albumin (BSA; Thermo Scientific), 0.5 - 1 µM dsDNA template, and 150 µg/mL mutant T7 RNA polymerase Y639F. RNA was purified by 6-8% denaturing polyacrylamide gel electrophoresis (National Diagnostics) and retrieved by passive elution. The dsDNA templates for


Page 13 of 17

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


upanap-12 and -126 were produced by Klenow extension (Klenow Fragment exo- system; Thermo Scientific) of the standard primer sets (Eurofins Genomics) used for library preparation as described 15, but with specified random regions. For upanap-12.33 and upanap-12.49 templates the full-length sense and antisense oligonucleotides were ordered and annealed. Aptamer conjugate templates for 126-12.33 and 126-12.49 transcription were prepared by PCR (Thermo Scientific) of the upanap-126 template using a reverse primer extending the template with the corresponding DNA sequence. All templates were purified by non-denaturing polyacrylamide gel purification (National Diagnostics). The control RNA

sequence

used

was

5′-

GGACGACAUUAACUCACGUUGCAACUAAUACGCUGAGUGGAAACCGUCC-3′. Peptide aptamer conjugation – The peptide variants ADGACSWRGLENHAAC and upain-1* (ADGACSWRGLENH(aminooxyLys)AC), a kind gift from Renée Roodbeen and Knud J. Jensen (Copenhagen University, Copenhagen, Denmark), were synthesized by standard solid phase synthesis from available amino acids and amino acid analogous. Specifically, Fmoc-L-Lys(Boc2-Aoa)-OH (Iris Biotech Gmbh) was used in the position of the aminooxyLys. Both peptides were N-terminally acetylated and C-terminally amidated. To prepare the RNA for coupling with upain-1*, 3′-end ribose oxidation using sodium-metaperiodate (NaIO4) was performed essentially as described in the standard protocol of the provider (Thermo Scientific). Two nanomoles of RNA was incubated with 10 mM NaIO4 in 0.1 M NaOAc pH 5.2 for 30 minutes at room temperature. Subsequently, the NaOAc concentration was adjusted to 0.3 M and RNA precipitated with ethanol. To couple RNA and upain1*, the 3´-end ribose oxidized RNA was incubated with 0.5-1 mg/mL of the peptide in 30 mM HEPES pH 7.4 for 4 hours at room temperature. The RNA was then passed over a micro Bio-spin P-6 column (Bio-Rad) to remove excess peptide and the RNA-peptide conjugate purified by 8% denaturing polyacrylamide gel electrophoresis. Pro-uPA – uPAR binding assay using U937 cells. U937 cells were maintained in RPMI 1640 medium with L-glutamine, supplemented with 10% fetal calf serum (FCS), 100 units/mL penicillin, and 100 units/mL streptomycin (Life Technologies). Purified pro-uPA was labeled with described

33

6

. Samples containing 10 U937 cells per mL, 10 pM

125

125

I as

I-pro-uPA and 0–500 nM RNA

were prepared in culture medium and incubated for 1 hour at 4 °C. The cells were then pelleted and the amounts of radioactivity in the pellets and the supernatants, respectively, determined. The bound 125

I-pro-uPA was divided by total amount of 125I-pro-uPA added to the sample and normalized binding

relative to no addition determined. Reciprocal zymogen activation. Pro-uPA and the plasmin-specific chromogenic substrate HD-Val-Leu-Lys-p-nitroanilide (S-2251; Chromogenix) with or without addition of aptamer or aptamerpeptide constructs was pre-incubated for 30 minutes at 37°C in 10 mM HEPES pH 7.4 with 140 mM NaCl (HBS), containing 2 mM MgCl2 and 0.1% BSA (Sigma-Aldrich). The reaction was initiated by the addition of one volume plasminogen and the hydrolysis of the chromogenic substrate followed at



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

37°C by the increase in absorbance at 405 nm. Final concentrations were 50 pM pro-uPA, 500 µM S2251, 200 nM plasminogen and aptamer or aptamer-peptide construct as indicated in the Figure 5. uPA-mediated plasminogen activation. uPA and the plasmin-specific substrate S-2251 with or without addition of aptamer, peptide or aptamer-peptide construct was pre-incubated for 15 minutes at 37°C in HBS with 2 mM MgCl2 and 0.1% BSA. One volume of plasminogen was added and the conversion of S-2251 followed by measuring the absorbance at 405 nm. Final concentrations were 100 pM uPA, 500 µM S-2251, 100 nM plasminogen and aptamer-peptide construct as indicated in the Figure 6. Rates of plasminogen activation were determined at t=50 minutes. Aptamer interference with the pro-uPA – LRP interaction. Surface plasmon resonance experiments were performed on a Biacore T200 (GE Healthcare) as described before 13. Murine LRP1A was purified from mouse liver by affinity chromatography on a receptor associated proteincolumn, as described 34. The purified LRP-1A was coupled (10 µg/mL in 10 mM glycine-HCl pH 2.8) to a CM5 chip (GE Healthcare) to a level of 2500 RU. Twentyfive nM of pro-uPA was pre-incubated with aptamer or aptamer-peptide construct as indicated in the figure and passed over the chip. The binding level of pro-uPA to the LRP was determined after a 60 s injection. Samples were prepared in HBS with 2 mM MgCl2 and 0.1% BSA, and the sensor surface regenerated with 10 mM glycine-HCl (pH 2.5) containing 0.5 M NaCl. Binding of pro-uPA:uPAR complexes to vitronectin. Monomeric vitronectin, a kind gift Cynthia Peterson (The University of Tennessee, Knoxville, USA), was immobilized (20 ug/mL in 10 mM sodium acetate pH 4.5) on the surface of a CM5 chip. Ten nM of pre-formed pro-uPA:uPAR complex was pre-incubated with aptamer or aptamer-peptide construct and passed over the chip. The binding level after a 60 second injection was determined. Sample and regeneration buffers were as described above.

SUPPORTING INFORMATION Figure S1. Gel analysis of the aptamer conjugate products 126-1233 and 126-1233-upain-1*. Figure S2. Surface plasmon resonance analysis of uPA binding to the aptamer conjugate 126-1233. Figure S3. The aptamer conjugate 126-1233 inhibits plasmin-mediated activation of pro-uPA to uPA. ACKNOWLEDGMENTS The upain-1* peptide was a kind gift from Renée Roodbeen and Knud J. Jensen (Copenhagen University, Copenhagen, Denmark).

FUNDING SOURCES


Page 14 of 17

Page 15 of 17

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


This work was supported by grants from the Danish Cancer Society (R56-A2997-12-S2); the Carlsberg Foundation (2010-01-0819); the Danish National Research Foundation (26-331-6); and the Lundbeck Foundation (R83-A7828).

ABBREVIATIONS BSA, bovine serum albumin; EGF, epidermal growth factor; HBS, HEPES-buffered saline (10 mM HEPES pH 7.4, 140 mM NaCl); LRP-1A, low density lipoprotein receptor-related protein 1A; tPA, tissue-type plasminogen activator; uPA, urokinase-type plasminogen activator; uPAR, urokinase-type plasminogen activator receptor; VN, vitronectin.

REFERENCES (1) Furie, B., and Furie, B. C. (1988) The molecular basis of blood coagulation. Cell 53, 505–518. (2) Bugge, T. H., Antalis, T. M., and Wu, Q. (2009) Type II transmembrane serine proteases. J. Biol. Chem. 284, 23177–23181. (3) Andreasen, P. A., Kjøller, L., Christensen, L., and Duffy, M. J. (1997) The urokinase-type plasminogen activator system in cancer metastasis: a review. Int. J. Cancer 72, 1–22. (4) Stahl, A., and Mueller, B. M. (1997) Melanoma cell migration on vitronectin: regulation by components of the plasminogen activation system. Int.J.Cancer 71, 116–122. (5) Wei, Y., Waltz, D. A., Rao, N., Drummond, R. J., Rosenberg, S., and Chapman, H. A. (1994) Identification of the urokinase receptor as an adhesion receptor for vitronectin. J. Biol. Chem. 269, 32380–32388. (6) Kjoller, L. (2002) The urokinase plasminogen activator receptor in the regulation of the actin cytoskeleton and cell motility. Biol Chem 383, 5–19. (7) Harbeck, N., Sotlar, K., Wuerstlein, R., and Doisneau-Sixou, S. (2014) Molecular and protein markers for clinical decision making in breast cancer: Today and tomorrow. Cancer Treat. Rev. 40, 434–444. (8) Hansen, M., Wind, T., Blouse, G. E., Christensen, A., Petersen, H. H., Kjelgaard, S., Mathiasen, L., Holtet, T. L., and Andreasen, P. A. (2005) A urokinase-type plasminogen activator-inhibiting cyclic peptide with an unusual P2 residue and an extended protease binding surface demonstrates new modalities for enzyme inhibition. J. Biol. Chem. 280, 38424–37. (9) Sgier, D., Zuberbuehler, K., Pfaffen, S., and Neri, D. (2010) Isolation and characterization of an inhibitory human monoclonal antibody specific to the urokinase-type plasminogen activator, uPA. Protein Eng. Des. Sel. 23, 261–269. (10) Gladysz, R., Adriaenssens, Y., De Winter, H., Joossens, J., Lambeir, A.-M., Augustyns, K., and Van der Veken, P. (2015) Discovery and SAR of novel and selective inhibitors of urokinase plasminogen activator (uPA) with an imidazo[1,2-a]pyridine scaffold. J. Med. Chem. 58, 9238-57. (11) Blouse, G. E., Botkjaer, K. A., Deryugina, E., Byszuk, A. A., Jensen, J. M., Mortensen, K. K., Quigley, J. P., and Andreasen, P. A. (2009) A novel mode of intervention with serine protease activity: targeting zymogen activation. J. Biol. Chem.13, 4647-57. (12) Botkjaer, K. A., Deryugina, E. I., Dupont, D. M., Gårdsvoll, H., Bekes, E. M., Thuesen, C. K., Chen, Z., Chen, Z., Ploug, M., Quigley, J. P., et al. (2012) Targeting tumor cell invasion and dissemination in vivo by an aptamer that inhibits urokinase-type plasminogen activator through a



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

novel multifunctional mechanism. Mol. Cancer Res. 10, 1532–43. (13) Dupont, D. M., Thuesen, C. K., Bøtkjær, K. A., Behrens, M. A., Dam, K., Sørensen, H. P., Pedersen, J. S., Ploug, M., Jensen, J. K., and Andreasen, P. A. (2015) Protein-Binding RNA Aptamers Affect Molecular Interactions Distantly from Their Binding Sites. PLoS One 10, e0119207. (14) Bauer, T. W., Liu, W., Fan, F., Camp, E. R., Yang, A., Somcio, R. J., Bucana, C. D., Callahan, J., Parry, G. C., Evans, D. B., et al. (2005) Targeting of urokinase plasminogen activator receptor in human pancreatic carcinoma cells inhibits c-Met- and insulin-like growth factor-I receptor-mediated migration and invasion and orthotopic tumor growth in mice. Cancer Res. 65, 7775–7781. (15) Dupont, D. M., Madsen, J. B., Hartmann, R. K., Tavitian, B., Ducongé, F., Kjems, J., and Andreasen, P. A. (2010) Serum-stable RNA aptamers to urokinase-type plasminogen activator blocking receptor binding. RNA 16, 2360–2369. (16) Goodson, R. J., Doyle, M. V, Kaufman, S. E., and Rosenberg, S. (1994) High-affinity urokinase receptor antagonists identified with bacteriophage peptide display. Proc. Natl. Acad. Sci. U. S. A. 91, 7129–33. (17) Stoltenburg, R., Reinemann, C., and Strehlitz, B. (2007) SELEX—A (r)evolutionary method to generate high-affinity nucleic acid ligands. Biomol. Eng. 24, 381–403. (18) Tuerk, C., and Gold, L. (1990) Systematic evolution of ligands by exponential enrichment: RNA ligands to bacteriophage T4 DNA polymerase. Science 249, 505–510. (19) Ellington, A. D., and Szostak, J. W. (1990) In vitro selection of RNA molecules that bind specific ligands. Nature 346, 818–822. (20) Dupont, D. M., Andersen, L. M., Botkjaer, K. A., and Andreasen, P. A. (2011) Nucleic acid aptamers against proteases. Curr. Med. Chem. 18, 4139–51. (21) Madsen, J. B., Dupont, D. M., Andersen, T. B., Nielsen, A. F., Sang, L., Brix, D. M., Jensen, J. K., Broos, T., Hendrickx, M. L. V, Christensen, A., et al. (2010) RNA aptamers as conformational probes and regulatory agents for plasminogen activator inhibitor-1. Biochemistry 49, 4103–4115. (22) Bjerregaard, N., Bøtkjær, K. A., Helsen, N., Andreasen, P. A., and Dupont, D. M. (2015) Tissuetype plasminogen activator-binding RNA aptamers inhibiting low-density lipoprotein receptor familymediated internalisation. Thromb. Haemost. 114, 139–49. (23) Jiang, L., Svane, A. S. P., Sørensen, H. P., Jensen, J. K., Hosseini, M., Chen, Z., Weydert, C., Nielsen, J. T., Christensen, A., Yuan, C., et al. (2011) The binding mechanism of a peptidic cyclic serine protease inhibitor. J. Mol. Biol. 412, 235–50. (24) Zhao, G., Yuan, C., Wind, T., Huang, Z., Andreasen, P. A., and Huang, M. (2007) Structural basis of specificity of a peptidyl urokinase inhibitor, upain-1. J. Struct. Biol. 160, 1–10. (25) Ulisse, S., Baldini, E., Sorrenti, S., and D’Armiento, M. (2009) The urokinase plasminogen activator system: a target for anti-cancer therapy. Curr. Cancer Drug Targets 9, 32-71. (26) Hamilton, J. A. (2008) Plasminogen activator/plasmin system in arthritis and inflammation: Friend or foe? Arthritis Rheum. 58, 645–648. (27) Alfano, D., Iaccarino, I., and Stoppelli, M. P. (2006) Urokinase signaling through its receptor protects against anoikis by increasing BCL-xL expression levels. J. Biol. Chem. 281, 17758–67. (28) Carriero, M. V, Del Vecchio, S., Capozzoli, M., Franco, P., Fontana, L., Zannetti, A., Botti, G., D’Aiuto, G., Salvatore, M., and Stoppelli, M. P. (1999) Urokinase receptor interacts with alpha(v)beta5 vitronectin receptor, promoting urokinase-dependent cell migration in breast cancer. Cancer Res. 59, 5307–14. (29) Mertens, H. D. T., Kjaergaard, M., Mysling, S., Gårdsvoll, H., Jørgensen, T. J. D., Svergun, D. I., and Ploug, M. (2012) A flexible multidomain structure drives the function of the urokinase-type


Page 16 of 17

Page 17 of 17

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


plasminogen activator receptor (uPAR). J. Biol. Chem. 287, 34304–34315. (30) Müller, J., Wulffen, B., Pötzsch, B., and Mayer, G. (2007) Multidomain Targeting Generates a High-Affinity Thrombin-Inhibiting Bivalent Aptamer. ChemBioChem 8, 2223–2226. (31) Umehara, T., Fukuda, K., Nishikawa, F., Kohara, M., Hasegawa, T., and Nishikawa, S. (2005) Rational design of dual-functional aptamers that inhibit the protease and helicase activities of HCV NS3. J. Biochem. 137, 339–347. (32) Lin, Y., Padmapriya, A., Morden, K. M., and Jayasena, S. D. (1995) Peptide conjugation to an in vitro-selected DNA ligand improves enzyme inhibition. Proc. Natl. Acad. Sci. 92, 11044–11048. (33) Jensen, P., Christensen, E., Ebbesen, P., Gliemann, J., and Andreasen, P. (1990) Lysosomal degradation of receptor-bound urokinase-type plasminogen activator is enhanced by its inhibitors in human trophoblastic choriocarcinoma cells. Cell Regul. 1, 1043–56. (34) Wiborg Simonsen, A. C., Heegaard, C. W., Rasmussen, L. K., Ellgaard, L., Kjøller, L., Christensen, A., Etzerodt, M., and Andreasen, P. A. (1994) Very low density lipoprotein receptor from mammary gland and mammary epithelial cell lines binds and mediates endocytosis of Mr, 40,000 receptor associated protein. FEBS Lett. 354, 279–283.


Building a Molecular Trap for a Serine Protease from Aptamer and

Recommend Documents