Calcium Silicate

Subscriber access provided by UNIVERSITY OF ADELAIDE LIBRARIES

Article

Novel Reduced Graphene Oxide/Zinc Silicate/ Calcium Silicate Electroconductive Biocomposite for Stimulating Osteoporotic Bone Regeneration Kun Xiong, Tingting Wu, Qingbo Fan, Lin Chen, and Minhao Yan ACS Appl. Mater. Interfaces, Just Accepted Manuscript • DOI: 10.1021/acsami.7b16206 • Publication Date (Web): 06 Dec 2017 Downloaded from http://pubs.acs.org on December 7, 2017

Just Accepted “Just Accepted” manuscripts have been peer-reviewed and accepted for publication. They are posted online prior to technical editing, formatting for publication and author proofing. The American Chemical Society provides “Just Accepted” as a free service to the research community to expedite the dissemination of scientific material as soon as possible after acceptance. “Just Accepted” manuscripts appear in full in PDF format accompanied by an HTML abstract. “Just Accepted” manuscripts have been fully peer reviewed, but should not be considered the official version of record. They are accessible to all readers and citable by the Digital Object Identifier (DOI®). “Just Accepted” is an optional service offered to authors. Therefore, the “Just Accepted” Web site may not include all articles that will be published in the journal. After a manuscript is technically edited and formatted, it will be removed from the “Just Accepted” Web site and published as an ASAP article. Note that technical editing may introduce minor changes to the manuscript text and/or graphics which could affect content, and all legal disclaimers and ethical guidelines that apply to the journal pertain. ACS cannot be held responsible for errors or consequences arising from the use of information contained in these “Just Accepted” manuscripts.

ACS Applied Materials & Interfaces is published by the American Chemical Society. 1155 Sixteenth Street N.W., Washington, DC 20036 Published by American Chemical Society. Copyright © American Chemical Society. However, no copyright claim is made to original U.S. Government works, or works produced by employees of any Commonwealth realm Crown government in the course of their duties.

Page 1 of 41 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

ACS Applied Materials & Interfaces

Novel Reduced Graphene Oxide/Zinc Silicate/Calcium Silicate Electroconductive Biocomposite for Stimulating Osteoporotic Bone Regeneration Kun Xionga, #, *, Tingting Wub, #, Qingbo Fana, #, Lin Chena, Minhao Yana,* a

State Key Laboratory Cultivation Base for Nonmetal Composites and Functional Materials, Southwest University of Science and Technology, Mianyang 621010, China

b

Department of Bone and Joint Surgery, Institute of Orthopedic Diseases, The First Affiliated Hospital, Jinan University, Guangzhou 510630, China *Corresponding author: Dr. Xiong Kun, Tel: +86 816 5351468, Email: [email protected] Prof. Yan Minhao, Tel : 008613778092806 Email : [email protected] #

The first three author contribute equally to this work.

ACS Paragon Plus Environment

ACS Applied Materials & Interfaces 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Abstract: In the absence of external assistance, autogenous healing of bone fracture is difficult due to an impaired regeneration ability under osteoporosis pathological condition. In this study, a reduced graphene oxide/zinc silicate/calcium silicate (RGO/ZS/CS) conductive biocomposite with an optimal surface electroconductivity of 5625 S/m was prepared by a two-step spin-coating method. The presence of lamellar apatite nanocrystals on the surfaces of the biocomposite, suggest that it has good in vitro biomineralization ability. The silicon and zinc released from the biocomposite induced a significant increase in the osteogenesis of mouse bone mesenchymal stem cells (mBMSCs). Furthermore, alkaline phosphatase activities were further promoted when 3 µA direct current was applied to stimulate the mBMSCs that were cultured on the RGO/ZS/CS surface. However, electrical stimulation failed to further up-regulate the osteogenesis related gene expression. Moreover, RGO/ZS/CS extracts were found to suppress the RANKL-induced osteoclastic differentiation of mouse leukaemic monocyte macrophages (RAW264.7 cells). Although the zinc ions in the RGO/ZS/CS extracts showed an inhibitory role in the human umbilical vein endothelial cells (HUVECs) proliferation, the dilutions of RGO-ZS-CS extracts (1/16, 1/32 and 1/64) promoted the HUVECs proliferation, and their angiogenesis related gene expression also was up-regulated. Based on the results of the in vitro angiogenesis model more interconnected tubes formed when the above dilutions of RGO-ZS-CS extracts were added to ECMatrixTM. The new RGO/ZS/CS electroconductive biocomposite has potential use for stimulating osteoporotic bone regeneration. Keywords: reduced graphene oxide; silicates; electroconductive biocomposite; osteoporotic bone regeneration; vascularization; osteoclastogenesis.


Page 2 of 41

Page 3 of 41 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


1. Introduction With the coming of aging population, osteoporosis has become a universal disease which mostly happens in postmenopausal women as well as elders1-3. Typically, osteoporosis symptom behaves as impaired bone regeneration capacity and enhanced bone resorption ability, which leads to bone mass reduction, diminished bone mineral density and increased fractures risk4-5. Up to now, it is very difficult to absolutely heal osteoporosis, and the current strategy is to retard bone resorption as much as possible, which can be achieved through calcium supplements6-7, oral bisphosphonates7-8 as well as hormone injections9-13. Nevertheless, oestrogen plus progestin hormone replacement therapy would increase the risk of breast cancer, stroke and blood clots14. In addition, it was found that osteonecrosis of the jaw was temporally related with high-dose intravenous bisphosphonates in cancer patients15. Under osteoporosis pathological condition, the autogenous healing of fracture is extremely challenging due to its poor bone regeneration ability. Recent studies reported strontium-containing and magnesium-containing silicate biomaterials exhibited good performances in stimulating osteoporotic bone regeneration16-20. Zinc (Zn) is a key trace element in bone, it has dual effects on bone metabolism, which not only favors osteogenic differentiation but also reduces osteoclastic differentiation21-24. Besides the Zn, silicon (Si) is also considered as an important trace element in human bone, which can facilitate the calcification of bone matrix and has positive effects on bone regeneration25-27. Furthermore, Si is also found to benefit for angiogenesis28-31. It is well known that vascularization is very important in bone remolding because blood vessels can deliver essential nutrients for new bone formation32. Therefore, the biomaterials which can simultaneously release Zn and Si appeals considerable focus. In addition to Si and Zn, it has been reported electrical



stimulation (ES) is also able to promote cell proliferation, stimulate osteogenic differentiation, and benefit bone regeneration as well as fracture healing33-38. Moreover, ES is capable of inducing cell elongation, modulating cell alignment and facilitating cell migration as well39. Therefore, Si, Zn in combination with ES are theoretically promising to promote the osteoporotic bone regeneration. In this study, we will prepare a novel electroconductive biocomposite (RGO/ZS/CS), which is composed of a calcium silicate (CS) substrate, a zinc silicate (ZS) middle layer and a reduced graphene oxide (RGO) surface layer. It is widely known that CS possesses good bioactivity and excellent osteoinductivity40-42. Our previous study demonstrated that mouse bone mesenchymal stem cells (mBMSCs) could significantly proliferate when they were cultured on the ZS/CS biocomposite surface, and their alkaline phosphatase (ALP) activity were also remarkablely promoted43. In addition, graphene and its derivates have been extensively studied in bone tissue engineering as well, which are mainly concentrated on the mechanical properties reinforcement for bone repair materials and the photothermal therapy for bone tumors44-45. As far as we know, the studies associated to the utilization of RGO in electrically promoting osteogenesis is rarely reported. In this study, effects of Zn, Si and ES on the in vitro osteogenesis of mBMSCs were explored. Moreover, effects of RGO/ZS/CS extracts on the in vitro osteoclastogenesis and angiogenesis were also investigated.

2. Experimental Section 2.1. Preparation of RGO/ZS/CS Biocomposite The preparation of CS precursor powders has been reported previously43, 46. ZS nanocrystals were synthesized by the hydrothermal method (170°C, 6 hours). Zinc nitrate hexahydrate (Zn(NO3)2·6H2O) was used as Zn source, and tetraethyl orthosilicate (TEOS) was used as Si source. For accelerating TEOS hydrolysis, 25 wt% ammonia solution was added to the reaction liquid, and


Page 4 of 41

Page 5 of 41 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


the addition of ammonia solution was stopped when the pH value of reaction liquid was adjusted to 7. Furthermore, graphene oxide (GO) was firstly prepared according to the protocol described in our previous work47. Thereafter, ascorbic acid was used to make GO to be chemically reduced into RGO. Hereinto, ascorbic acid was added into GO powders with a mass ratio of 10:1, and the reaction time was 48 hours. Schematic diagram for preparation of RGO/ZS/CS biocomposite was presented in Fig. 1. By using a cylindrical steel mould, CS precursor disks with a diameter of 12 mm were firstly obtained under a 10 MPa pressure. The as-prepared ZS nanocrystals were added into 3 wt% sodium alginate (SA) solution to form the ZS/SA suspension, whose concentration was 0.1 mg/mL. Afterwards, they were spin-coated onto the CS precursor disks surface and heated at 1150°C for 2 h to obtain ZS/CS disks. In addition, different amounts of the as-prepared RGO powders were added into 3 wt% SA solution to form the RGO/SA suspensions, and their final concentrations were 1 mg/mL, 2 mg/mL and 3 mg/mL, respectively. Thereafter, the above RGO/SA suspensions were spin-coated onto the ZS/CS disks surface and annealed at varying temperatures (400°C, 500°C and 600°C) in an argon atmosphere for 2 h to obtain the RGO/ZS/CS biocomposites (Φ11 mm×2 mm) afterwards. Before being used in cell culture experiments, all the RGO/ZS/CS biocomposites needed to be sterilized with 15 kGy gamma ray irradiation. 2.2. In Vitro Biomineralization Experiments RGO/ZS/CS biocomposites were soaked in simulated body fluid (SBF) for predetermined time (7, 14, 21 and 28 days), and the SBF was refreshed every two days. In this study, SBF was prepared according to the method described by Kokubo and Takadama48, which possessed similar ion concentrations with human blood plasma. At a surface area to liquid volume ratio of 0.1 cm2/mL,



RGO/ZS/CS biocomposites were kept soaking in the SBF, and then they were placed in a shaker, the temperature and the shaking speed were accordingly 37°C, 60 rpm. 2.3. Characterizations A X-ray diffractometer (XRD, X′Pert PRO, PANalytical, The Netherland) that operated by a Cu Kα source (λ = 1.5406 Å) was applied for characterization of the phase compositions of samples. In addition, the final components of samples were ascertained through the comparience between the diffraction patterns and the Joint Committee Powder Diffraction Standards of (JCPDS) cards. The morphology of samples was observed via a field emission scanning electron microscope (FE-SEM, Ultra55, ZEISS, Germany). Selected area elemental analysis was performed by the aid of an energy dispersive X-ray spectrometer (EDS, INCA X-act, Oxford, U.K.), which worked under an 10 kV acceleration voltage. X-ray photoelectron spectroscopy (XPS, ESCALAB 250Xi, Thermo Scientific, USA) was used to test the chemical compositions of samples, the binding energy was normalized to the adventitious C 1s signal at 284.8 eV. The Surface electroconductivity of RGO/ZS/CS biocomposite was measured via a four probe meter (34001A, Hewlett Packard, USA). 2.4. In Vitro Osteogenesis of the RGO/ZS/CS Electroconductive Biocomposite 2.4.1. Cell Culture in Presence of ES The primary mBMSCs were purchased from ATCC (Cat.No.CRL-12424, USA), which were subcultivated according to the protocol described in our previous work43. The mBMSCs after 3 to 6 times of passages were selected for the subsequent cell culture experiments. The mixed liquid which contained 10 vol% of fetal bovine serum (FBS, Cat.no. 10099-141, Gibco, USA) and 90 v0l% of High-glucose Dulbecco′s Modified Eagle′s Medium (H-DMEM, Cat.no. 11965-092, Gibco, USA) was applied to culture the mBMSCs. In this study, the RGO/ZS/CS biocomposites which had


Page 6 of 41

Page 7 of 41 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


optimal surface electroconductivity were chosen for investigating the effect of ES on osteogenesis, they were placed in 24-well culture plates (Corning Inc., USA). Before the mBMSCs were seeded on the RGO/ZS/CS biocomposite surface, they needed to be prewetted for 12 h with serum-free H-DMEM. According to the ES system described by M. Vila49, a similar ES system was used in the present study, which consisted of the electrodes (GKS-050 306 090 A, Ingun, Germany) and the power supply (2400, Keithley, USA). As displayed in Fig. 2, the electrodes were mechanically clamped to the plate cover for providing the necessary pressure to ensure a good electrical contact between electrodes and RGO/ZS/CS biocomposites. Moreover, the RGO/ZS/CS biocomposite disks connected together via a serial electrical scheme to guarantee each disk having the same current intensity. After mBMSCs were seeded on the RGO/ZS/CS surface for 24 h, 3 µA direct current (DC) was applied to stimulate the mBMSCs, and the stimulation time was 1 h per day. In this study, the mBMSCs incubated on the cell culture plate is considered as control group, while the abbreviations of RZS-NES and RZS-ES separately represent the mBMSCs which were cultured on the RGO/ZS/CS surface without DC stimulus and in the presence of DC stimulus. 2.4.2. ALP Activity of mBMSCs The RGO/ZS/CS biocomposite disks were placed in a 24-well plate, and their surface were seeded by the mBMSCs with a seeding density of 1×105 cells per well. At day 7, ALP activity was quantitatively determined by normalizing the ALP content to the total protein content (U/mg), and the ALP activity testing was according to the operation process described in our previous work43. In this study, there are three parallel samples in each groups. 2.4.3. Osteogenesis Related Gene Expression in mBMSCs The mBMSCs were seeded on the RGO/ZS/CS surface with a density of 1×105 cells per well.



After cultured for 7 days, the relative expression level of genes related to osteogenesis such as type I collagen (Col-I), osteocalcin (OC) and runt-related transcription factor 2 (Runx2) was analyzed, and the Glyceraldehyde-3-phosphatedehydrogenase (GAPDH) was considered as the housekeeping gene for normalization. Total RNA was isolated from the treated mBMSCs by applying a HiPure Total RNA Micro Kit (Magen, China), and they were detected by Nanodrop 2000 (Thermo Scientific, USA). The isolated RNA was then reverse transcribed into complementary DNA (cDNA) by using the iScript cDNA Synthesis Kit (cat. no.489703001, Roche SR, USA) according to the protocols of the manufacturer. The quantitative real-time polymerase chain reaction (qRT-PCR) was carried out by using a SsoAdvanced Universal SYBR Green Supermix (cat. no. 4913914001, Roche SR, USA) and conducted on a QuantStudioTM 6 Flex (Thermo Scientific, USA). The gene expressions were calculated by the 2- ∆∆Ct method. The primer sequences were listed in Table 1, and there are three parallel samples in each groups. 2.5. In Vitro Osteoclastogenesis of RGO/ZS/CS Extracts 2.5.1. Cell Culture and Extracts Preparation Mouse leukaemic monocyte macrophages (RAW264.7, Cat. No.TCM13, Chinese Academy of Sciences cell bank, China) were used to test the osteoclastogenesis of RGO/ZS/CS extracts. The complete culture medium for RAW264.7 cells contains α-Modified Eagle's Medium (α-MEM; Gibco, USA), 10 vol.% FBS and 50 ng/mL recombinant mouse receptor activator of nuclear factor-κB ligand (RANKL; Cat. No. 462-TR-010, R&D). The RAW264.7 cells after 3 to 6 times of passages were used for the subsequent cell culture experiments, and the culture medium was refreshed every three days. At a surface area to liquid volume ratio of 0.1 cm2/mL, sterilized RGO/ZS/CS biocomposites were soaked in α-MEM and they were maintained in a shaker at 37°C


Page 8 of 41

Page 9 of 41 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


with a speed of 60 rpm. After 24 h of incubation, the RGO/ZS/CS extracts were collected after centrifugation and the supernatants were sterilized using a 0.22 µm filter membrane (Millipore). Thereafter, 10 vol.% FBS and 50 ng/mL RANKL were added into the above RGO/ZS/CS extracts for further use. 2.5.2. Tartrate-Resistant Acid Phosphatase (TRAP) Activity Assay and TRAP Staining RAW264.7 cells were seeded at a density of 5000 cells per well in 48-well plates. After being attached for 24 h, cells were then co-cultured with RGO/ZS/CS extracts for 6 days in the presence of RANKL. For evaluation of osteoclastogenesis, the RAW264.7 cells were firstly fixed with 4% formaldehyde, and then TRAP staining was performed by using the TRAP kit (Cat. No. 387-A, Sigma-Aldrich) following the manufacturer's protocol. Quantitative detection of TRAP activity after 6 days was measured by a Tartrate Resistant Acid Phosphatase Assay Kit (Cat. No. P0332, Beyotime, China) according to the instruction of the manufacturer. 2.5.3. Osteoclastogenesis Related Gene Expression RAW264.7 cells were seeded in a 24-well plate with a density of 1.5 ×104 cells per well. After being cultured with RGO/ZS/CS extracts and RANKL for 6 and 13 days, respectively, total RNA was isolated from RAW264.7 cells according to the method as described in section 2.4.3. The relative expression level of genes related to osteoclastogenesis such as TRAP, nuclear factor of activated T-cell cytoplasmic 1 (NFATc1), matrix metalloproteinase-9 (MMP-9) and carbonic anhydrase II (Car2) was detected by qRT-PCR, and the housekeeping gene was β-actin in this section. The primer sequences were listed in Table 1, and there are three parallel samples in each groups.



2.6. In Vitro Angiogenesis of RGO/ZS/CS Extracts 2.6.1. Cell Culture and Extracts Preparation Human umbilical vein endothelial cells (HUVECs; Cat. No. 8010, Sciencell, USA) were used to test the angiogenesis of RGO/ZS/CS extracts. The endothelial cell medium (ECM; Cat. No. 1001, Sciencell, USA), which contained endothelial cell medium without glutamine (ECM-NG), 5 vol.% FBS and 1 vol.% endothelial cells growth supplements (ECGs), was used for culturing the HUVECs. The HUVECs after 3 to 6 times of passages were used for the following cell culture experiments, and the culture medium was refreshed every two days. According to a surface area to liquid volume ratio of 0.1 cm2/mL, sterilized RGO/ZS/CS biocomposites were soaked in ECM and they were maintained in a shaker at 37°C with a speed of 60 rpm. At day 1, 3 and 5, the RGO/ZS/CS extracts were collected after centrifugation, concentrations of Si and Zn in the RGO/ZS/CS extracts were tested via using an inductively coupled plasma atomic emission spectroscopy (ICP-AES, Optima 5300DV, Perkin Elmer, USA). By adding different amounts of ECM, serial dilutions of RGO/ZS/CS extracts (1/2, 1/4, 1/8, 1/16, 1/32, 1/64 and 1/128) were prepared in this study. After being sterilized by using a 0.22 µm filter membrane (Millipore), the above RGO/ZS/CS extracts were stored at 4°C for following use. 2.6.2. HUVECs Proliferation Assay A Cell Counting Kit-8 (CCK-8, Dojindo, Japan) assay was used to determine the HUVECs proliferation. Briefly, HUVECs were seeded in a 48-well plate with a density of 5000 cells per well. After being cultured for 12 h, the ECM culture medium was replaced by a series of the dilutions of RGO/ZS/CS extracts, and they were continued to be cultured for 1, 3, 5 days, respectively. Only ECM cultured HUVECs were considered as the control group. At the predetermined intervals,


Page 10 of 41

Page 11 of 41 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


removed the residue cell culture medium and used cold PBS to rinse the RGO/ZS/CS biocomposite. Afterward, added 200 µL CCK-8 working solution to each well and experienced 1 h of incubation. At last, 100 µL/well supernatants were extracted and accordingly added into a new 96-well plate. Furthermore, an enzyme linked immunoadsorbent assay plate reader was applied to measure the absorbance of the supernatants that situated at 405 nm. There are six parallel samples in each group. 2.6.3. Angiogenesis Related Gene Expression HUVECs were seeded in a 6-well plate with a density of 1 ×105 cells per well. After being cultured with the dilutions of RGO/ZS/CS extracts (1/16, 1/32 and 1/64) for 5 days, total RNA was isolated from HUVECs according to the method as described in section 2.4.3. The expressions of the vascular endothelial growth factor (VEGF), basic fibroblast growth factor (bFGF) and endothelial nitric oxide synthase (eNOS) was detected by qRT-PCR, and the housekeeping gene was GAPDH in this section. The primer sequences were listed in Table 1, and there are three parallel samples in each groups. 2.6.4. Cytoskeletal Organization After being cultured with the dilutions of RGO/ZS/CS (1/16 and 1/64) for 24 h, the cytoskeletal organization of HUVECs were observed by using a confocal laser scanning microscope (CLSM, TCS SP5, Leica, Germany). The detailed preparation process of cell samples has been reported previously. 2.6.5. In vitro angiogenesis assay The endothelial cells (ECs) migration ability as well as the tube-like network structures formation ability are key factors for angiogenesis. ECMatrixTM (Millipore, Cat. no. ECM625), which contained collagen type IV, laminin, heparin sulfate proteoglycans, nidogen and entactin, was



used for evaluation of the angiogenic capability of RGO/ZS/CS extracts. In brief, the 96-well plate was in advance covered by a ECMatrixTM layer prior to HUVECs seeding. According to a seeding density of 1×104 cells/well, HUVECs were cultured on ECMatrixTM for 3, 7 and 11 h in the presence of the dilutions of RGO/ZS/CS extracts (1/16 and 1/64), and the HUVECs cultured on ECMatrixTM without the RGO/ZS/CS extracts were considered as control group. At predetermined time intervals, an inverted fluorescence microscope (Eclipse Ti-U, Nikon, Japan) was used for observation of the HUVECs in the 96-well plates under bright filed, and randomly selected five microscopic areas for photographing. The number of the formed nodes, circles and tubes were manually counted according to the methods described by J. Chang50. 2.7. Statistical Analysis All the quantitative data obtained in this work were expressed as mean ± standard deviation, and the statistical analyzing method has been reported previously47.

3. Results 3.1. Phase Composition, Morphology and Biomineralization Performance of the RGO/ZS/CS Biocomposite As shown in Fig. 3, besides the pseudowollastonite phased calcium silicate (JCPDS card no. 01-074-0874) and the willemite phased zinc silicate (JCPDS card no. 002-0813), the as-prepared RGO/ZS/CS biocomposite also contained some other calcium zinc silicates, such as CaZn2(Si2O7) (JCPDS card no. 01-088-1790), CaZnSi2O6 (JCPDS card no. 040-0494), CaZnSi3O8 (JCPDS card no. 054-0604) and CaZn(Si2O6) (JCPDS card no. 01-086-0748), which were formed by the happening of solid solution reactions between ZS and CS. Furthermore, the annealing of RGO/SA under argon atmosphere probably led to the formation of sodium carbonate (Na2CO3, JCPDS card no.


Page 12 of 41

Page 13 of 41 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


01-086-0291). Since the melting point of Na2CO3 was 851°C, the solid solution reactions would happen among Na2CO3, CS and ZS as well (the sintering temperature of the ZS/CS is 1150°C), which resulted in formations of Na4Ca4(Si6O18) (JCPDS card no. 01-079-1089) and (Ca, Na)2Zn3Si12O30 (JCPDS card no. 051-1432). Fig.3 demonstrated the as-prepared RGO/ZS/CS biocomposite still had good in vitro biomineralization ability because carbonated hydroxyapatite (JCPDS card no. 019-0272) and (Na, Zn) co-doped hydroxyapatite (JCPDS card no. 01-070-3371) could be formed on its surface after being soaked in SBF for no less than 7 days, which suggested RGO/ZS/CS biocomposite possessed bone bonding ability. On the RGO/ZS/CS biocomposites surface, the selected area scanning results of C, O, Zn, Si, Ca and Na element (Fig. 4(a)) indicated that CS substrate was indeed covered by the ZS and the RGO. The cross-sectional SEM image of the RGO/ZS/CS biocomposite revealed the RGO surface layer possessed a porous structure, and it was produced by the accumulation of many staggered RGO sheets (Fig. 4(b)). After being kept soaking in the SBF for 7 days, many lamellar nanocrystals could be observed on the RGO/ZS/CS surface (Fig. 4(c)). Based on the XRD (Fig. 3) and the EDS (Fig. 4(f)) testing results, these lamellar nanocrystals probably belonged to mineralized apatites, while few lamellar nanocrystals formed in the CS substrate at this time (Fig. 4(d)). As soaking time extended to 14 days, obviously more mineralized apatite nanocrystals formed in the CS substrate (Fig. 4(e)), and its quantity seemed to be in proportion to soaking time (Fig. 4(g) and Fig. 4(h)). More importantly, the RGO surface layer was stable enough, and no RGO detachments were found even if the soaking time extended to 28 days. 3.2. Surface Electroconductivity of the RGO/ZS/CS Biocomposite As shown in Fig. 5, the surface electroconductivity of the RGO/ZS/CS biocomposite enhanced



with the raise of annealing temperature, and it was probably due to the decrease of the oxygen-containing groups in the RGO surface layer. As confirmed by Fig. 6, the RGO surface layer which experienced a 600°C of annealing really contained fewer C-O bonds and C=O bonds than those in the unannealed RGO surface layer. In addition, the peak at 289.7 eV should be assigned to carbonate ([CO3]2-)51. Based on the XRD analysis in Fig. 3, the [CO3]2- should be from Na2CO3. Fig. 5 also reveals that relatively high RGO/SA suspension concentration contributes to achievement of a better surface electroconductivity, and the coating times will greatly affect the final electroconductivity of RGO surface layer as well. In this study, when 3 mg/mL of RGO/SA suspension was spin coated on the ZS/CS disks for 2 times, and experienced an annealing treatment at 600°C for 2 h afterwards, the obtained RGO/ZS/CS biocomposite exhibited optimal surface electroconductivity (5625 S/m). Owing to porous structure of RGO surface layer (Fig. 4(b)), it could be deduced that the horizontal connections between RGO sheets might be not good enough when only 1 time of spin coating is carried out, whereas the interspace between RGO sheets would be enlarged when 3 times of spin coating was carried out, which resulted in the decrease of surface electroconductivity. 3.3. Effect of ES on Osteogenic Differentiation of mBMSCs ALP activity is thought to be a sign of osteogenic differentiation at early stage. By comparing with control group, the RZS-NES group showed a significant higher ALP activity (Fig. 7(a)), implying the released Zn and Si probably contributed to the enhancement of the osteogenic differentiation ability of mBMSCs. In fact, the ICP data proved the RGO/ZS/CS biocomposite really could release a certain amount of Zn and Si during cell culture process (Table 2). More interestingly, the ALP activity of the RZS-ES group was remarkablely higher than both of control group and


Page 14 of 41

Page 15 of 41 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


RZS-NES group, so it indicated ES might further enhance the mBMSCs osteogenic differentiation ability. Observing from Fig. 7(b), as compared to control group, osteogenesis related gene expressions such as OC and Runx2 were significantly up-regulated in RZS-NES group, so it indicated the released Si and Zn really could facilitate the osteogenic differentiation of mBMSCs through the up-regulation of Runx2 and OC. With the introduction of ES, besides Runx2 and OC, the expression of Col-I was also significantly up-regulated in comparison with control group. However, no significant statistical differences in osteogenesis related gene expression could be detected between RZS-NES group and RZS-ES group. 3.4. Effect of RGO/ZS/CS Extracts on Osteoclastogenic Differentiation of RAW264.7 cells Osteoclastogenic differentiation of the RAW264.7 cells mediated by RANKL was investigated via the detection of TRAP activity. The RAW264.7 cells cultured by RANKL without RGO/ZS/CS extracts were considered as control group, whereas the cells cultured by a mixed medium containing RANKL and RGO/ZS/CS extracts were regarded as RANKL+RZS group. As shown in Fig. 8(a), the TRAP immunofluorescence staining images showed less TRAP (wine red color) were visible in RANKL+RZS group by comparing with those in control group, and the quantitative analysis results further confirmed the TRAP activity in the RANKL+RZS group significantly decreased (Fig. 8(b)). Since TRAP is highly expressed by osteoclasts, it suggests that RGO/ZS/CS extracts probably can suppress the RANKL-induced osteoclast formation. It is well known that osteoclast activity is closely associated with osteoclastogenesis related gene expression, such as TRAP, NFATc1, Car2 and MMP-9. Fig. 8(c) and Fig. 8(d) showed these gene expressions were remarkablely down-regulated in the RANKL+RZS group by comparing with those in the control group, implying RGO/ZS/CS extracts really could retard RAW264.7 cells differentiating into osteoclasts.



3.5. Proliferation and Angiogenesis Related Gene Expression of HUVECs Cultured in the RGO/ZS/CS Extracts As presented in Fig. 9(a), no obvious cytotoxicity was found when HUVECs were cultured in serial dilutions of RGO/ZS/CS extracts, all HUVECs could proliferate in a time-dependent manner. As compared to control group, the dilutions of RGO/ZS/CS extracts (1/16, 1/32 and 1/64) were able to significantly promote the HUVECs proliferation, whereas 2 times diluted RGO/ZS/CS extracts (1/2) had a remarkable inhibitory effect on HUVECs proliferation. Nevertheless, when RGO/CS extracts had the same dilution ratios as those of RGO/ZS/CS extracts, they did not suppress the HUVECs proliferation (Fig. 9(b)), suggesting overhigh concentration of Zn probably has a inhibitory effect on HUVECs proliferation. The HUVECs cultured in the dilutions of RGO/ZS/CS extracts (1/16, 1/32 and 1/64) for 5 days were chosen to be used for the following PCR testing. As depicted in Fig. 9(c), in comparison with control group, the dilutions of RGO/ZS/CS extracts (1/16, 1/32 and 1/64) could significantly promote the expressions of the angiogenesis related genes such as VEGF, eNOS and bFGF, implying Si and Zn at appropriate concentrations facilitate angiogenesis. 3.6. In vitro Angiogenesis An in vitro angiogenesis assay kit containing ECMatrixTM gel was employed to assess the angiogenic capacity of RGO/ZS/CS extracts. As shown in Fig. 10A, cultured 3 h later, no matter whether presence of RGO/ZS/CS extracts or not, all the HUVECs cultured on ECMatrixTM gel could gradually assembled to form branched nodes (node), which was a indication of angiogenesis at early stage. However, as compared to control group, the HUVECs cultured with the dilutions of RGO/ZS/CS extracts (1/16 and 1/64) could form more branched nodes (Fig. 10B). In the 1/16 group and 1/64 group, some mesh-like circles (circle) as well as tube-like parallel cell lines (tube) were


Page 16 of 41

Page 17 of 41 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


also found, which separately represented the interim and later stage phenomena of angiogenesis, whereas fewer circles and tubes were observed in the control group. After being cultured for 7 h, although there were increased nodes, circles and tubes in the control group, they were still less in comparison with the 1/16 group and 1/64 group (Fig. 10C). Additionally, the diameter of the circles became larger. As the culturing time prolonged to 11 h, the mesh-like structures in control group gradually collapsed, whereas the HUVECs still maintained the integrated circle and tube shapes in the 1/16 group and 1/64 group although their quantities had a slight decrease in comparison to those at 7 h (Fig. 10D), implying Si and Zn at appropriate concentrations might be able to assist HUVECs to resist apoptosis. Endothelial cell migration is thought to be one of the essential components in angiogenesis, cell migration ability is closely associated with the formed stress fiber and actin containing microfilament. By comparing with control group, more evident stress fibers, actin containing microfilaments and fully expanded cytoskeletons could be found in the 1/16 group and 1/64 group (Fig. 11), so it well explained why the dilutions of RGO/ZS/CS extracts (1/16 and 1/64) could help the HUVECs connect to each other and form mesh-like circle structures in a shorter time.

4. Discussions When 3 µA DC stimulus was applied to stimulate the mBMSCs cultured on the RGO/ZS/CS biocomposites surface, they showed up-regulated expressions of Col-I, OC and Runx2, which demonstrated the released Si, Zn in combination with ES could promote the in vitro osteogenic ability of mBMSCs. Col-I is not only well known as a osteoblastic primary gene product during bone matrix formation, but also the most abundant extracellular matrix protein in bone52. As the earliest transcription factor for osteogenic differentiation, Runx2 is capable of activating the expressions of multiple late stage osteogenic related genes, such as OC, which is recognized as an



important component in bone matrix53-54. D. Mata, et al. claimed that the expression of Runx2 was especially sensitive to the inductive effect of ES55. Previous studies already proved Si, Zn and ES could independently facilitate osteogenesis24, 28, 38. However, it was found in this study ES failed to further promote the osteogenesis related gene expressions on the basis of the stimulatory effect of Si and Zn. It has been reported the voltage-gated calcium channels exists in the osteoblast plasma membranes can be activated by ES, which will lead to elevated concentration of cytosolic calcium ions, and finally the osteoblast functions are regulated through the calmodulin pathways56-57. In addition to voltage-gated calcium channels, J.Y. Zhang, et al. found ES also could activate the voltage-gated sodium, potassium as well as chloride channels, and all these four voltage-gated ions channels played a role in regulation of the adipose-derived mesenchymal stem cells behaviors58. Nevertheless, L. Khatib, et al. thought ES might induce the structure of proteins to undergo changes, which subsequently would vary their physiological functions and further affect the cells behavior59. Since approximately 98% of Zn in normal plasma is protein bound, it could not exclude the possibility that ES could retard Zn binding to the proteins at the mBMSCs membranes. Up to now, it remains unknown whether ES can affect the interactions among Si, Zn and mBMSCs, which will be investigated in the following work. RANKL can guide the differentiation of macrophages into osteoclasts during bone remolding. As compared to control group, the RAW264.7 cells in the RANKL+RZS group was found to exhibit down-regulated expressions of TRAP, NFATc1, Car2 and MMP-9, implying the Si and Zn in the RGO/ZS/CS extracts could retard RAW264.7 cells differentiating into osteoclasts. M. Yamaguchi, et al. found Zn was able to suppress osteoclastogenesis through blocking the NF-κB signaling pathway24. N.M. Lowe, et al. also claimed Zn played an inhibitory role in osteoclastic absorption of


Page 18 of 41

Page 19 of 41 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


bone60. H.P. Dimai, et al. reported the TRAP expression could be down-regulated through the supplement of dietary Zn61. Although Z. Mladenovic, et al. found Si was also able to inhibit the formation of osteoclasts as well as bone resorption in vitro, its molecular mechanism in suppressing RANK-induced osteoclastogenesis was still unknown due to the deficiency of homology between Si transporters in varying species62. Bone resorption is chiefly mediated by osteoclasts, which includes both minerals removal and the degradation of organic constituents in bone matrix63. The RANKL-RANK-activated NF-κB signaling pathway is found to be capable of inducing NFATc1 gene expression64-65. As a master regulator in controlling osteoclastogenic differentiation, NFATc1 is able to regulate the expression of some osteoclastic specific genes, such as TRAP, MMP-9 and Car266. It has been proved TRAP is closely associated with the bone resorptive function of mature osteoclasts67. MMP-9 is a kind of zinc-dependent proteinases which can mediate the degradation of organic constituents in bone matrix (primarily Col-I)68. Itoh, et al. reported that MMP-9 got involved in bone erosion in rheumatoid arthritis69. Furthermore, selective inhibition of MMP-9 was found to result in reduced bone degradation based on a prostate cancer bone metastasis experimental model70. In this study, the molecular mechanism of Zn in suppressing the RANKL-induced osteoclastogenesis

can

be

deduced

as

follows,

the

released

Zn

may

block

the

RANKL-RANK-activated NF-κB signaling pathway, which results in the inhibition of NFATc1 gene expression, because NFATc1 can regulate the expressions of TRAP, MMP-9 and Car2, thereby the expressions of downstream functional genes such as TRAP, MMP-9 and Car2 are accordingly down-regulated as well. Angiogenesis is a vital step in the bone regeneration process, which can provide blood supply and consequently facilitate the following progress of osteogenesis32. All the critical steps in the



angiogenesis process, including the proliferation, differentiation and aggregation of endothelial cells (ECs), are able to be regulated by VEGF71. J. Chang, et al. found VEGF was capable of activating VEGFR-2, which thereafter initiated the synthesis and production of nitric oxide via activation of eNOS72. The knockout mice for eNOS exhibited impaired angiogenic ability73. Furthermore, ECs migration is thought to be one of the essential components in angiogenesis as well. As reported by L. Lamalice, et al., VEGF, bFGF and angiopoietins are three major promoters in regulating ECs migration74. It is confirmed by recent studies that Si has a stimulatory effect on angiogenesis. However, it is still uncertain whether co-existence of Si and Zn will have influences on angiogenesis or not. In the present study, it was found the proliferation and the angiogenesis related genes (VEGF, bFGF and eNOS) expression were significantly promoted when the HUVECs were cultured in the dilutions of RGO/ZS/CS extracts (1/16, 1/32 and 1/64). The results of the in vitro model of angiogenesis indicated the dilutions of RGO/ZS/CS extracts (1/16 and 1/32) were able to induce a visible increase in tube number and tube interconnectivity as well. Nevertheless, it was also found the Zn in the RGO/ZS/CS extracts had a inhibitory effect on HUVECs proliferation, especially when its concentration was 40 µM (1/2 group). In general, our findings demonstrated RGO/ZS/CS extracts still had a stimulatory effect on angiogenesis when the Zn concentration stayed ranging from 1.25 to 5 µM and the Si concentration stayed ranging from 34. 22 to 137 nM.

5. Conclusion Novel reduced graphene oxide/zinc silicate/calcium silicate (RGO/ZS/CS) biocomposite which has a surface electroconductivity of 5625 S/m was successfully prepared in this study. It was found RGO/ZS/CS electroconductive biocomposite has good in vitro biomineralization ability. The ALP activities could be further promoted when 3 µA direct current was applied to stimulate the mBMSCs


Page 20 of 41

Page 21 of 41 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


cultured on the RGO/ZS/CS surface, whereas electrical stimulation failed to further up-regulate the osteogenesis related gene expression. RGO/ZS/CS extracts were able to effectively suppress the RANKL-induced osteoclastic differentiation of RAW264.7 cells. Although the zinc ions in the RGO/ZS/CS extracts were found to have a slight inhibitory effect on HUVECs proliferation, the dilutions of RGO/ZS/CS extracts (1/16, 1/32 and 1/64) still could significantly promote the HUVECs proliferation. In addition, the angiogenesis related gene expression and the in vitro angiogenic ability were remarkablely improved as well. In summary, RGO/ZS/CS electroconductive biocomposite has superior in vitro osteogenesis, osteoclastogenesis and angiogenesis performances, which is promising to be used for stimulating osteoporotic fractures healing.

Acknowledgements This work is financially supported by National Nature Science Foundation of China (Grant No. 51402247); Sichuan Education Department Innovation Team Foundation (16zd1104); Sichuan Province Science Foundation for Young Scientists (No. 15zs2111); Open Project of State Key Laboratory Cultivation Base for Nonmetal Composites and Functional Materials (No.11zxfk26).

References 1.

Brown, C., Osteoporosis: Staying strong. Nature 2017, 550 (7674), S15-S17.

2.

Langdahl, B. L., Osteoporosis in premenopausal women. Current Opinion in Rheumatology 2017, 29 (4), 410-415.

3.

Genant, H. K.; Cooper, C.; Poor, G.; Reid, I.; Ehrlich, G.; Kanis, J.; Nordin, B. E. C.; Barrett-Connor, E.; Black, D.;

Bonjour, J.-P.; Dawson-Hughes, B.; Delmas, P. D.; Dequeker, J.; Eis, S. R.; Gennari, C.; Johnell, O.; Johnston Jr, C. C.; Lau, E. M. C.; Liberman, U. A.; Lindsay, R.; Martin, T. J.; Masri, B.; Mautalen, C. A.; Meunier, P. J.; Miller, P. D.; Mithal, A.; Morii, H.; Papapoulos, S.; Woolf, A.; Yu, W.; Khaltaev, N., Interim Report and Recommendations of the World Health Organization Task-Force for Osteoporosis. Osteoporosis International 1999, 10 (4), 259-264. 4.

Hendrickx, G.; Boudin, E.; Van Hul, W., A look behind the scenes: the risk and pathogenesis of primary

osteoporosis. Nat Rev Rheumatol 2015, 11 (8), 462-474. 5.

Lerner, U. H., Bone remodeling in post-menopausal osteoporosis. Journal of dental research 2006, 85 (7), 584-595.



6.

Harvey, N. C.; Biver, E.; Kaufman, J.-M.; Bauer, J.; Branco, J.; Brandi, M. L.; Bruyère, O.; Coxam, V.; Cruz-Jentoft, A.;

Czerwinski, E.; Dimai, H.; Fardellone, P.; Landi, F.; Reginster, J.-Y.; Dawson-Hughes, B.; Kanis, J. A.; Rizzoli, R.; Cooper, C., The role of calcium supplementation in healthy musculoskeletal ageing. Osteoporosis International 2017, 28 (2), 447-462. 7.

Hegde, V.; Jo, J. E.; Andreopoulou, P.; Lane, J. M., Effect of osteoporosis medications on fracture healing.

Osteoporosis International 2016, 27 (3), 861-871. 8.

Wang, J.; Yao, M.; Xu, J. h.; Shu, B.; Wang, Y. j.; Cui, X. j., Bisphosphonates for prevention of osteopenia in

kidney-transplant recipients: a systematic review of randomized controlled trials. Osteoporosis International 2016, 27 (5), 1683-1690. 9.

Dang, M.; Koh, A. J.; Danciu, T.; McCauley, L. K.; Ma, P. X., Preprogrammed Long-Term Systemic Pulsatile Delivery

of Parathyroid Hormone to Strengthen Bone. Advanced Healthcare Materials 2017, 6 (3), 1600901. 10. de Boissieu, P.; Trenque, T., Denosumab treatment in postmenopausal women with osteoporosis. The Lancet Diabetes & Endocrinology 2017, 5 (10), 767-768. 11. Metcalf, L. M.; Aspray, T. J.; McCloskey, E. V., The effects of parathyroid hormone peptides on the peripheral skeleton of postmenopausal women. A systematic review. Bone 2017, 99 (Supplement C), 39-46. 12. Minisola, S.; Cipriani, C.; Occhiuto, M.; Pepe, J., New anabolic therapies for osteoporosis. Internal and Emergency Medicine 2017, 12 (7), 915-921. 13. Shi, C.; Wu, J.; Yan, Q.; Wang, R.; Miao, D., Bone marrow ablation demonstrates that estrogen plays an important role in osteogenesis and bone turnover via an antioxidative mechanism. Bone 2015, 79, 94-104. 14. Writing Group for the Women's Health Initiative, I., Risks and benefits of estrogen plus progestin in healthy postmenopausal women: Principal results from the women's health initiative randomized controlled trial. JAMA 2002, 288 (3), 321-333. 15. Khan, A., Bisphosphonate-associated osteonecrosis of the jaw. Canadian Family Physician 2008, 54 (7), 1019. 16. Lin, K.; Xia, L.; Li, H.; Jiang, X.; Pan, H.; Xu, Y.; Lu, W. W.; Zhang, Z.; Chang, J., Enhanced osteoporotic bone regeneration by strontium-substituted calcium silicate bioactive ceramics. Biomaterials 2013, 34 (38), 10028-10042. 17. Weng, L.; Boda, S. K.; Teusink, M. J.; Shuler, F. D.; Li, X.; Xie, J., Binary Doping of Strontium and Copper Enhancing Osteogenesis and Angiogenesis of Bioactive Glass Nanofibers while Suppressing Osteoclast Activity. ACS Applied Materials & Interfaces 2017, 9 (29), 24484-24496. 18. Xia, L. G.; Yin, Z. L.; Mao, L. X.; Wang, X. H.; Liu, J. Q.; Jiang, X. Q.; Zhang, Z. Y.; Lin, K. L.; Chang, J.; Fang, B., Akermanite bioceramics promote osteogenesis, angiogenesis and suppress osteoclastogenesis for osteoporotic bone regeneration. Scientific Reports 2016, 6. 19. Zhang, W.; Zhao, F.; Huang, D.; Fu, X.; Li, X.; Chen, X., Strontium-Substituted Submicrometer Bioactive Glasses Modulate Macrophage Responses for Improved Bone Regeneration. ACS Applied Materials & Interfaces 2016, 8 (45), 30747-30758. 20. Mao, L.; Xia, L.; Chang, J.; Liu, J.; Jiang, L.; Wu, C.; Fang, B., The synergistic effects of Sr and Si bioactive ions on osteogenesis, osteoclastogenesis and angiogenesis for osteoporotic bone regeneration. Acta Biomaterialia 2017, 61, 217-232. 21. Aaseth, J.; Boivin, G.; Andersen, O., Osteoporosis and trace elements – An overview. Journal of Trace Elements in Medicine and Biology 2012, 26 (2), 149-152. 22. Bhardwaj, P.; Rai, D. V.; Garg, M. L., Zinc as a nutritional approach to bone loss prevention in an ovariectomized rat model. Menopause 2013, 20 (11), 1184-1193. 23. Yamaguchi, M., Role of nutritional zinc in the prevention of osteoporosis. Molecular and Cellular Biochemistry 2010, 338 (1), 241-254. 24. Yamaguchi, M.; Weitzmann, M. N., Zinc stimulates osteoblastogenesis and suppresses osteoclastogenesis by


Page 22 of 41

Page 23 of 41 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


antagonizing NF-kappa B activation. Molecular and Cellular Biochemistry 2011, 355 (1-2), 179-186. 25. Carlisle, E. M., Silicon: a possible factor in bone calcification. Science (New York, N.Y.) 1970, 167 (3916), 279-280. 26. Carlisle, E. M., Silicon: a requirement in bone formation independent of vitamin D1. Calcified tissue international 1981, 33 (1), 27-34. 27. Kim, M.-H.; Bae, Y.-J.; Choi, M.-K.; Chung, Y.-S., Silicon Supplementation Improves the Bone Mineral Density of Calcium-Deficient Ovariectomized Rats by Reducing Bone Resorption. Biological Trace Element Research 2009, 128 (3), 239-247. 28. Bai, L.; Wu, R.; Wang, Y.; Wang, X.; Zhang, X.; Huang, X.; Qin, L.; Hang, R.; Zhao, L.; Tang, B., Osteogenic and angiogenic activities of silicon-incorporated TiO2 nanotube arrays. Journal of Materials Chemistry B 2016, 4 (33), 5548-5559. 29. Dashnyam, K.; Jin, G.-Z.; Kim, J.-H.; Perez, R.; Jang, J.-H.; Kim, H.-W., Promoting angiogenesis with mesoporous microcarriers through a synergistic action of delivered silicon ion and VEGF. Biomaterials 2017, 116 (Supplement C), 145-157. 30. Feito, M. J.; Serrano, M. C.; Onaderra, M.; Matesanz, M. C.; Sanchez-Salcedo, S.; Arcos, D.; Vallet-Regi, M.; Portoles, M. T., Effects of immobilized VEGF on endothelial progenitor cells cultured on silicon substituted and nanocrystalline hydroxyapatites. Rsc Advances 2016, 6 (95), 92586-92595. 31. Shi, M.; Zhou, Y.; Shao, J.; Chen, Z.; Song, B.; Chang, J.; Wu, C.; Xiao, Y., Stimulation of osteogenesis and angiogenesis of hBMSCs by delivering Si ions and functional drug from mesoporous silica nanospheres. Acta Biomaterialia 2015, 21, 178-189. 32. Winet, H., The role of microvasculature in normal and perturbed bone healing as revealed by intravital microscopy. Bone 1996, 19 (1 Suppl), S39- S57. 33. Bins-Ely, L. M.; Cordero, E. B.; Souza, J. C. M.; Teughels, W.; Benfatti, C. A. M.; Magini, R. S., In vivo electrical application on titanium implants stimulating bone formation. Journal of Periodontal Research 2017, 52 (3), 479-484. 34. He, Y.; Wang, S.; Mu, J.; Dai, L.; Zhang, Z.; Sun, Y.; Shi, W.; Ge, D., Synthesis of polypyrrole nanowires with positive effect on MC3T3-E1 cell functions through electrical stimulation. Materials Science & Engineering C-Materials for Biological Applications 2017, 71, 43-50. 35. Kim, I. S.; Song, J. K.; Song, Y. M.; Cho, T. H.; Lee, T. H.; Lim, S. S.; Kim, S. J.; Hwang, S. J., Novel Effect of Biphasic Electric Current on In Vitro Osteogenesis and Cytokine Production in Human Mesenchymal Stromal Cells. Tissue Engineering Part A 2009, 15 (9), 2411-2422. 36. Zhang, J.; Neoh, K. G.; Hu, X.; Kang, E.-T.; Wang, W., Combined effects of direct current stimulation and immobilized BMP-2 for enhancement of osteogenesis. Biotechnology and Bioengineering 2013, 110 (5), 1466-1475. 37. Cui, H.; Wang, Y.; Cui, L.; Zhang, P.; Wang, X.; Wei, Y.; Chen, X., In Vitro Studies on Regulation of Osteogenic Activities by Electrical Stimulus on Biodegradable Electroactive Polyelectrolyte Multilayers. Biomacromolecules 2014, 15 (8), 3146-3157. 38. Thrivikraman, G.; Lee, P. S.; Hess, R.; Haenchen, V.; Basu, B.; Schamweber, D., Interplay of Substrate Conductivity, Cellular Microenvironment, and Pulsatile Electrical Stimulation toward Osteogenesis of Human Mesenchymal Stem Cells in Vitro. Acs Applied Materials & Interfaces 2015, 7 (41), 23015-23028. 39. Oezkucur, N.; Monsees, T. K.; Perike, S.; Do, H. Q.; Funk, R. H. W., Local Calcium Elevation and Cell Elongation Initiate Guided Motility in Electrically Stimulated Osteoblast-Like Cells. Plos One 2009, 4 (7), e6131. 40. Wang, C.; Lin, K.; Chang, J.; Sun, J., Osteogenesis and angiogenesis induced by porous beta-CaSiO3/PDLGA composite scaffold via activation of AMPK/ERK1/2 and PI3K/Akt pathways. Biomaterials 2013, 34 (1), 64-77. 41. Xu, S.; Lin, K.; Wang, Z.; Chang, J.; Wang, L.; Lu, J.; Ning, C., Reconstruction of calvarial defect of rabbits using porous calcium silicate bioactive ceramics. Biomaterials 2008, 29 (17), 2588-2596. 42. Zhang, N.; Molenda, J. A.; Fournelle, J. H.; Murphy, W. L.; Sahai, N., Effects of pseudowollastonite (CaSiO3)



bioceramic on in vitro activity of human mesenchymal stem cells. Biomaterials 2010, 31 (30), 7653-7665. 43. Xiong, K.; Zhang, J.; Shi, H.; Liu, J.; Wu, H.; Li, H.; Ye, J., Preparation and in vitro cell-biological performance of sodium alginate/nano-zinc silicate co-modified calcium silicate bioceramics. Rsc Advances 2015, 5 (11), 8329-8339. 44. Ma, H.; Jiang, C.; Zhai, D.; Luo, Y.; Chen, Y.; Lv, F.; Yi, Z.; Deng, Y.; Wang, J.; Chang, J.; Wu, C., A Bifunctional Biomaterial with Photothermal Effect forTumor Therapy and Bone Regeneration. Advanced Functional Materials 2016, 26 (8), 1197-1208. 45. Mehrali, M.; Moghaddam, E.; Shirazi, S. F. S.; Baradaran, S.; Mehrali, M.; Latibari, S. T.; Metselaar, H. S. C.; Kadri, N. A.; Zandi, K.; Abu Osman, N. A., Synthesis, Mechanical Properties, and in Vitro Biocompatibility with Osteoblasts of Calcium Silicate-Reduced Graphene Oxide Composites. Acs Applied Materials & Interfaces 2014, 6 (6), 3947-3962. 46. Xiong, K.; Shi, H.; Liu, J.; Shen, Z.; Li, H.; Ye, J., Control of the Dissolution of Ca and Si Ions from CaSiO3 Bioceramic via Tailoring Its Surface Structure and Chemical Composition. Journal of the American Ceramic Society 2013, 96 (3), 691-696. 47. Xiong, K.; Fan, Q.; Wu, T.; Shi, H.; Chen, L.; Yan, M., Enhanced bovine serum albumin absorption on the N-hydroxysuccinimide activated graphene oxide and its corresponding cell affinity. Materials Science & Engineering C-Materials for Biological Applications 2017, 81, 386-392. 48. Kokubo, T.; Takadama, H., How useful is SBF in predicting in vivo bone bioactivity? Biomaterials 2006, 27 (15), 2907-2915. 49. Vila, M.; Cicuéndez, M.; Sánchez-Marcos, J.; Fal-Miyar, V.; Manzano, M.; Prieto, C.; Vallet-Regi, M., Electrical stimuli to increase cell proliferation on carbon nanotubes/mesoporous silica composites for drug delivery. Journal of Biomedical Materials Research Part A 2013, 101A (1), 213-221. 50. Kong, N.; Lin, K.; Li, H.; Chang, J., Synergy effects of copper and silicon ions on stimulation of vascularization by copper-doped calcium silicate. Journal of Materials Chemistry B 2014, 2 (8), 1100-1110. 51. Ni, M.; Ratner, B. D., Differentiating calcium carbonate polymorphs by surface analysis techniques—an XPS and TOF-SIMS study. Surface and Interface Analysis 2008, 40 (10), 1356-1361. 52. Sasano, Y.; Zhu, J. X.; Kamakura, S.; Kusunoki, S.; Mizoguchi, I.; Kagayama, M., Expression of major bone extracellular matrix proteins during embryonic osteogenesis in rat mandibles. Anatomy and embryology 2000, 202 (1), 31-37. 53. Isaacson, B. M.; Bloebaum, R. D., Bone bioelectricity: What have we learned in the past 160 years? Journal of Biomedical Materials Research Part A 2010, 95A (4), 1270-1279. 54. Zhu, H.; Cao, B.; Zhen, Z.; Laxmi, A. A.; Li, D.; Liu, S.; Mao, C., Controlled growth and differentiation of MSCs on grooved films assembled from monodisperse biological nanofibers with genetically tunable surface chemistries. Biomaterials 2011, 32 (21), 4744-4752. 55. Mata, D.; Oliveira, F. J.; Neto, M. A.; Belmonte, M.; Bastos, A. C.; Lopes, M. A.; Gomes, P. S.; Fernandes, M. H.; Silva, R. F., Smart electroconductive bioactive ceramics to promote in situ electrostimulation of bone. Journal of Materials Chemistry B 2015, 3 (9), 1831-1845. 56. Bergh, J. J.; Xu, Y.; Farach-Carson, M. C., Osteoprotegerin Expression and Secretion Are Regulated by Calcium Influx through the L-Type Voltage-Sensitive Calcium Channel. Endocrinology 2004, 145 (1), 426-436. 57. Zayzafoon, M., Calcium/calmodulin signaling controls osteoblast growth and differentiation. Journal of Cellular Biochemistry 2006, 97 (1), 56-70. 58. Zhang, J.; Li, M.; Kang, E.-T.; Neoh, K. G., Electrical stimulation of adipose-derived mesenchymal stem cells in conductive scaffolds and the roles of voltage-gated ion channels. Acta Biomaterialia 2016, 32 (Supplement C), 46-56. 59. Khatib, L.; Golan, D. E.; Cho, M., Physiologic electrical stimulation provokes intracellular calcium increase mediated by phospholipase C activation in human osteoblasts. FASEB journal : official publication of the Federation of American Societies for Experimental Biology 2004, 18 (15), 1903-1905.


Page 24 of 41

Page 25 of 41 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


60. Lowe, N. M.; Lowe, N. M.; Fraser, W. D.; Jackson, M. J., Is there a potential therapeutic value of copper and zinc for osteoporosis? The Proceedings of the Nutrition Society 2002, 61 (2), 181-185. 61. Dimai, H. P.; Hall, S. L.; Stilt-Coffing, B.; Farley, J. R., Skeletal response to dietary zinc in adult female mice. Calcified tissue international 1998, 62 (4), 309-315. 62. Mladenovic, Z.; Johansson, A.; Willman, B.; Shahabi, K.; Bjorn, E.; Ransjo, M., Soluble silica inhibits osteoclast formation and bone resorption in vitro. Acta Biomaterialia 2014, 10 (1), 406-418. 63. Qian, Y.; Huang, H.-Z., The role of RANKL and MMP-9 in the bone resorption caused by ameloblastoma. Journal of Oral Pathology & Medicine 2010, 39 (8), 592-598. 64. Asagiri, M.; Sato, K.; Usami, T.; Ochi, S.; Nishina, H.; Yoshida, H.; Morita, I.; Wagner, E. F.; Mak, T. W.; Serfling, E.; Takayanagi, H., Autoamplification of NFATc1 expression determines its essential role in bone homeostasis. The Journal of Experimental Medicine 2005, 202 (9), 1261-1269. 65. Zhao, Q.; Wang, X.; Liu, Y.; He, A.; Jia, R., NFATc1: Functions in osteoclasts. International Journal of Biochemistry & Cell Biology 2010, 42 (5), 576-579. 66. Kim, J.-Y.; Cheon, Y.-H.; Yoon, K.-H.; Lee, M. S.; Oh, J., Parthenolide inhibits osteoclast differentiation and bone resorbing activity by down-regulation of NFATc1 induction and c-Fos stability, during RANKL-mediated osteoclastogenesis. Bmb Reports 2014, 47 (8), 451-456. 67. Halleen, J. M.; Raisanen, S.; Salo, J. J.; Reddy, S. V.; Roodman, G. D.; Hentunen, T. A.; Lehenkari, P. P.; Kaija, H.; Vihko, P.; Vaananen, H. K., Intracellular fragmentation of bone resorption products by reactive oxygen species generated by osteoclastic tartrate-resistant acid phosphatase. The Journal of biological chemistry 1999, 274 (33), 22907-22910. 68. Andersen, T. L.; del Carmen Ovejero, M.; Kirkegaard, T.; Lenhard, T.; Foged, N. T.; Delaisse, J.-M., A scrutiny of matrix metalloproteinases in osteoclasts: evidence for heterogeneity and for the presence of MMPs synthesized by other cells. Bone 2004, 35 (5), 1107-1119. 69. Itoh, T.; Matsuda, H.; Tanioka, M.; Kuwabara, K.; Itohara, S.; Suzuki, R., The role of matrix metalloproteinase-2 and matrix metalloproteinase-9 in antibody-induced arthritis. Journal of immunology (Baltimore, Md. : 1950) 2002, 169 (5), 2643-2647. 70. Bonfil, R. D.; Sabbota, A.; Nabha, S.; Bernardo, M. M.; Dong, Z.; Meng, H.; Yamamoto, H.; Chinni, S. R.; Lim, I. T.; Chang, M.; Filetti, L. C.; Mobashery, S.; Cher, M. L.; Fridman, R., Inhibition of human prostate cancer growth, osteolysis and angiogenesis in a bone metastasis model by a novel mechanism-based selective gelatinase inhibitor. International journal of cancer 2006, 118 (11), 2721-2726. 71. Ferrara, N.; Gerber, H.-P.; LeCouter, J., The biology of VEGF and its receptors. Nature medicine 2003, 9 (6), 669-676. 72. Li, H.; Xue, K.; Kong, N.; Liu, K.; Chang, J., Silicate bioceramics enhanced vascularization and osteogenesis through stimulating interactions between endothelia cells and bone marrow stromal cells. Biomaterials 2014, 35 (12), 3803-3818. 73. Garcia-Cardena, G.; Fan, R.; Shah, V.; Sorrentino, R.; Cirino, G.; Papapetropoulos, A.; Sessa, W. C., Dynamic activation of endothelial nitric oxide synthase by Hsp90. Nature 1998, 392 (6678), 821-824. 74. Lamalice, L.; Le Boeuf, F.; Huot, J., Endothelial cell migration during angiogenesis. Circulation Research 2007, 100 (6), 782-794.



Figure captions Figure 1 Schematic diagram for preparation of RGO/ZS/CS biocomposites. Figure 2 Photograph of electrical stimulation device. Figure 3 XRD patterns of the RGO/ZS/CS biocomposites after being soaked in SBF for 0, 7, 14, 21, and 28 days, respectively. Figure 4 SEM image of the surface morphology of RGO/ZS/CS biocomposites and selected surface area scanning results of C, O, Zn, Si, Ca and Na element (a); SEM image of the cross-sectional morphology of RGO/ZS/CS biocomposites (b); SEM images of the surface morphology (c) and the cross-sectional morphology (d) of RGO/ZS/CS biocomposites after being soaked in SBF for 7 days; SEM image of the cross-sectional morphology of RGO/ZS/CS biocomposites after being soaked in SBF for 14 days (e); EDS spectrum (f) of the minerals formed in the figure of (c); SEM images of the cross-sectional morphology of RGO/ZS/CS biocomposites after being soaked in SBF for 21 (g) and 28 (h) days. Figure 5 Surface electroconductivity of the RGO/ZS/CS biocomposites prepared by varying RGO suspension concentrations, spin coating times and annealing temperatures. (n=6) **The 2 times with 3 mg/mL of RGO group compared with the 1 time with 3 mg/mL of RGO group, P < 0.01. Figure 6 XPS spectra of (a) the 600°C annealed and (b) unannealed RGO surface layer. Figure 7 ALP activity (a) and osteogenesis related genes (Col-I, OC and Runx2) expression (b) of the mBMSCs after being cultured on the RGO/ZS/CS surface for 7 days in presence of ES (RZS-ES) and without ES (RZS-NES). *RZS-ES group and RZS-NES group compared with control group, respectively. Hereinto, *P < 0.05, **P < 0.01 and ***P < 0.001. # RZS-ES group compared with RZS-NES group, ## P < 0.01.


Page 26 of 41

Page 27 of 41 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Figure 8 TRAP staining of RAW264.7 cells stimulated by RGO/ZS/CS extracts containing 50 ng/mL RANKL (RANKL+RZS) for 6 days (a), nuclei were counterstained into blue color; TRAP activity of RAW264.7 cells stimulated by RANKL+RZS for 13 days (b); Osteoclastogenesis related genes (TRAP, NFATc1, Car2 and MMP-9) expression of RAW264.7 cells stimulated by RANKL+RZS for 6 (c) and 13 days (d), respectively. *RANKL+RZS group compared with control group. *P < 0.05, **P < 0.01 and ***P < 0.001. Figure 9 Proliferation of HUVECs after being cultured with serial dilutions of (a) RGO/ZS/CS extracts and (b) RGO/ZS extracts for 1, 3, 5 days, respectively; (c) Angiogenesis related genes (VEGF, bFGF and eNOS) expression of HUVECs after being cultured with RGO/ZS/CS extracts at 1/16, 1/32 and 1/64 dilution ratios for 5 days. *Diluted RGO/ZS/CS extracts group and Diluted RGO/CS extracts group compared with control group, respectively. Hereinto, *P < 0.05, **P < 0.01 and ***P < 0.001. Figure 10 In vitro angiogenesis of HUVECs cultured with varying media on ECMatrixTM gel. (A) Optical images of HUVECs cultured on ECMatrixTM gel in the presence of RGO/ZS/CS extracts at 1/16 and 1/64 dilution ratios for 3 h, 7 h and 12 h. Scale bar = 500 µm. (B-D) The statistics of the number of nodes, circles and tubes formed in the culture after 3, 7 and 11 h, respectively. (n=5) *1/16 group and 1/64 group compared with control group, respectively. **P < 0.01, ***P < 0.001. Figure 11 Fluorescence images of DAPI (nucleus, blue), F-actin (cytoskeleton, green) and their merged images of the HUVECs after being cultured with dilutions of RGO/ZS/CS extracts (1/16 and 1/64) for 24 h.



Tables Table 1. Primer sequences used for RT-PCR analysis Target gene

Gene bank

GAPDH1

NM_008084.2

Runx-2 COL-I OC

β-actin TRAP MMP9 NFATc1

Sequences

NM_009820.4 NM_007742.3 NM_007541.2

NM_007393.3

F: 5'-3'

TGTGTCCGTCGTGGATCTGA

R: 3'-5'

TTGCTGTTGAAGTCGCAGGAG

F: 5'-3'

CACTGGAAGTGCAGCAAGA

R: 3'-5'

TTACATGACAGCGGTGGCATATC

F: 5'-3'

ATGCCGCGACCTCAAGATG

R: 3'-5'

TGAGGCACAGACGGCTGAGTA

F: 5'-3'

AGCAGCTTGGCCCAGACCTA

R: 3'-5'

TAGCGCCGGAGTCTGTTCACTAC

F: 5'-3'

TGACAGGATGCAGAAGGAGA

R: 3'-5'

GCTGGAAGGTGGACAGTGAG

XM_006509945.2 F: 5'-3' NM_013599.4

TACCTGTGTGGACATGACC

R: 3'-5'

CAGATCCATAGTGAAACCGC

F: 5'-3'

TCCAGTACCAAGACAAAGCCTA

R: 3'-5'

TTGCACTGCACGGTTGAA

NM_001164109.1 F: 5'-3'

GGTAACTCTGTCTTTCTAACCTTAAGCTC

R: 3'-5' GTGATGACCCCAGCATGCACCAGTCACAG Car2 GAPDH2 VEGF eNOS bFGF 1

NM_181315.4

NM_002046 AB_021221 NM_001160111.1 NM_002006.4

F: 5'-3'

CAAGTCTCTTCGAGTACATTGCC

R: 3'-5'

CCTGGTTCTGTATGTGCAGGTA

F: 5'-3'

GATTTGGTCGTATTGGGCG

R: 3'-5'

CTGGAAGATGGTGATGG

F: 5'-3'

TGCGGATCAAACCTCACCA

R: 3'-5'

CAGGGATTTTTCTTGTCTTGCT

F: 5'-3'

TGTCCAACATGCTGCTGGAAATTG

R: 3'-5'

AGGAGGTCTTCTTCCTGGTGATGCC

F: 5'-3'

GTGATCGGAAATGACACTGGAG

R: 3'-5'

CATGTTGGTCACTAACAGAAGCA

for mBMSCs, 2 for HUVECs


Page 28 of 41

Page 29 of 41 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Table 2. Concentration of the Si and Zn which released from RGO/ZS/CS biocomposites into ECM at predetermined time intervals. (n=3) Culture time (day)

1

3

5

Si (µM)

80

17.231

8.308

Zn (µM)

2.192

2.802

2.984



TOC 80x55mm (300 x 300 DPI)


Page 30 of 41

Page 31 of 41 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Figure 1 Schematic diagram for preparation of RGO/ZS/CS biocomposites. 199x150mm (300 x 300 DPI)



Figure 2 Photograph of electrical stimulation device. 60x42mm (300 x 300 DPI)


Page 32 of 41

Page 33 of 41 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Figure 3 XRD patterns of the RGO/ZS/CS biocomposites after being soaked in SBF for 0, 7, 14, 21, and 28 days, respectively. 87x133mm (300 x 300 DPI)



Figure 4 SEM image of the surface morphology of RGO/ZS/CS biocomposites and selected surface area scanning results of C, O, Zn, Si, Ca and Na element (a); SEM image of the cross-sectional morphology of RGO/ZS/CS biocomposites (b); SEM images of the surface morphology (c) and the cross-sectional morphology (d) of RGO/ZS/CS biocomposites after being soaked in SBF for 7 days; SEM image of the crosssectional morphology of RGO/ZS/CS biocomposites after being soaked in SBF for 14 days (e); EDS spectrum (f) of the minerals formed in the figure of (c); SEM images of the cross-sectional morphology of RGO/ZS/CS biocomposites after being soaked in SBF for 21 (g) and 28 (h) days. 199x242mm (300 x 300 DPI)


Page 34 of 41

Page 35 of 41 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Figure 5 Surface electroconductivity of the RGO/ZS/CS biocomposites prepared by varying RGO suspension concentrations, spin coating times and annealing temperatures. (n=6) **The 2 times with 3 mg/mL of RGO group compared with the 1 time with 3 mg/mL of RGO group, P < 0.01. 80x59mm (300 x 300 DPI)



Figure 6 XPS spectra of (a) the 600°C annealed and (b) unannealed RGO surface layer. 79x119mm (300 x 300 DPI)


Page 36 of 41

Page 37 of 41 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Figure 7 ALP activity (a) and osteogenesis related genes (Col-I, OC and Runx2) expression (b) of the mBMSCs after being cultured on the RGO/ZS/CS surface for 7 days in presence of ES (RZS-ES) and without ES (RZS-NES). *RZS-ES group and RZS-NES group compared with control group, respectively. Hereinto, *P < 0.05, **P < 0.01 and ***P < 0.001. # RZS-ES group compared with RZS-NES group, ## P < 0.01. 119x47mm (300 x 300 DPI)



Figure 8 TRAP staining of RAW264.7 cells stimulated by RGO/ZS/CS extracts containing 50 ng/mL RANKL (RANKL+RZS) for 6 days (a), nuclei were counterstained into blue color; TRAP activity of RAW264.7 cells stimulated by RANKL+RZS for 13 days (b); Osteoclastogenesis related genes (TRAP, NFATc1, Car2 and MMP-9) expression of RAW264.7 cells stimulated by RANKL+RZS for 6 (c) and 13 days (d), respectively. *RANKL+RZS group compared with control group. *P < 0.05, **P < 0.01 and ***P < 0.001. 160x106mm (300 x 300 DPI)


Page 38 of 41

Page 39 of 41 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Figure 9 Proliferation of HUVECs after being cultured with serial dilutions of (a) RGO/ZS/CS extracts and (b) RGO/ZS extracts for 1, 3, 5 days, respectively; (c) Angiogenesis related genes (VEGF, bFGF and eNOS) expression of HUVECs after being cultured with RGO/ZS/CS extracts at 1/16, 1/32 and 1/64 dilution ratios for 5 days. *Diluted RGO/ZS/CS extracts group and Diluted RGO/CS extracts group compared with control group, respectively. Hereinto, *P < 0.05, **P < 0.01 and ***P < 0.001. 180x46mm (300 x 300 DPI)



Figure 10 In vitro angiogenesis of HUVECs cultured with varying media on ECMatrixTM gel. (A) Optical images of HUVECs cultured on ECMatrixTM gel in the presence of RGO/ZS/CS extracts at 1/16 and 1/64 dilution ratios for 3 h, 7 h and 12 h. Scale bar = 500 µm. (B-D) The statistics of the number of nodes, circles and tubes formed in the culture after 3, 7 and 11 h, respectively. (n=5) *1/16 group and 1/64 group compared with control group, respectively. **P < 0.01, ***P < 0.001. 222x245mm (300 x 300 DPI)


Page 40 of 41

Page 41 of 41 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Figure 11 Fluorescence images of DAPI (nucleus, blue), F-actin (cytoskeleton, green) and their merged images of the HUVECs after being cultured with dilutions of RGO/ZS/CS extracts (1/16 and 1/64) for 24 h. 187x149mm (300 x 300 DPI)


Calcium Silicate

Recommend Documents